ID: 969567011

View in Genome Browser
Species Human (GRCh38)
Location 4:7984665-7984687
Sequence ACTTTTGGCCAGGAGAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969567011 Original CRISPR ACTTTTGGCCAGGAGAGGCA GGG Intronic
901666449 1:10828830-10828852 GAGTTTGTCCAGGAGAGGCAGGG - Intergenic
902415414 1:16236094-16236116 AGCTCTGGCCAGGAGAAGCAAGG - Intronic
902712459 1:18249762-18249784 ACTGTGGGCCAGTAGAGGAAAGG - Intronic
903576072 1:24340659-24340681 ATTTCTGGCCTGGAGAGGCTGGG + Intronic
904032653 1:27542920-27542942 ACTTGTGCCCAGAAGAGTCAGGG + Intronic
905325400 1:37148229-37148251 ACTGTGGGCCAGGAGTTGCAGGG + Intergenic
907048988 1:51317084-51317106 ACTTATGGAAAGCAGAGGCAAGG + Intronic
907189777 1:52638919-52638941 AACTTTGGCCAGGATAGCCAAGG + Intronic
908195407 1:61742480-61742502 ACTTCCGCCCAGGTGAGGCAGGG + Exonic
908838645 1:68255634-68255656 ACTTTAGGCCAGAAGAGTTAGGG + Intergenic
909046312 1:70714306-70714328 ACTTCTGGCCAGGAGAGGTCAGG + Intergenic
911130613 1:94383752-94383774 AATAGTGGCCAGGAGAGGCTCGG + Intergenic
911400853 1:97373467-97373489 ACCTTAGGCAAGGAGATGCATGG - Intronic
912944466 1:114073499-114073521 ACCTTTGGACAGGAGAGGAATGG + Intergenic
915457319 1:156049496-156049518 ACATTTGGGAAGGAGAGGGAAGG - Intronic
915731354 1:158056474-158056496 GCTCATGACCAGGAGAGGCAGGG + Intronic
917165056 1:172102644-172102666 ACTTTGGGACAGTAGAGGCATGG + Intronic
918214845 1:182384523-182384545 ACTGTTGGCCAGGAGAAGAAGGG - Exonic
921554913 1:216586440-216586462 AATTTTGGCCATTAGAGGAATGG + Intronic
923337076 1:232979750-232979772 TCAGTGGGCCAGGAGAGGCACGG + Exonic
923541467 1:234891178-234891200 TCCTTTGCCCAGGAGAGGGATGG + Intergenic
923666084 1:235999849-235999871 ACTTCAGGCCATGAGAGGAAGGG + Intronic
1064884716 10:20098246-20098268 TCTTCTGGCTAGAAGAGGCAAGG - Intronic
1065595918 10:27311297-27311319 AAATTGGACCAGGAGAGGCAAGG + Intergenic
1065869680 10:29945706-29945728 AGTATTGGACATGAGAGGCAAGG - Intergenic
1067461568 10:46462102-46462124 GCTGTTGGCCAGGAAGGGCAGGG + Exonic
1067625626 10:47922499-47922521 GCTGTTGGCCAGGAAGGGCAGGG - Intergenic
1069184093 10:65400677-65400699 ACTTTTGTTCAATAGAGGCATGG + Intergenic
1070546256 10:77455334-77455356 AGACTTGGCCAGGAGAGGCTTGG - Intronic
1071513989 10:86285006-86285028 ACCTGTGGGCTGGAGAGGCATGG - Intronic
1072555428 10:96511139-96511161 GCTTCTGGCCAGAAGAGTCAGGG + Intronic
1074906001 10:117864446-117864468 AATTTTGGCCAGGATAGGGGTGG - Intergenic
1075530347 10:123223735-123223757 CCTTGTGGCCAGGAGTGGCAGGG - Intergenic
1075932861 10:126314058-126314080 GCTTTTGTCCAGGAGAGCCCTGG - Intronic
1076627701 10:131832115-131832137 ACGTTTGGCCAGGAGAGACTGGG - Intergenic
1076700337 10:132269701-132269723 ACCTTTTGCAAGGCGAGGCAAGG - Intronic
1077790847 11:5438166-5438188 ATCTCTGGCAAGGAGAGGCAGGG + Intronic
1078286277 11:9958853-9958875 ACTGTTGGCCAGGAGAAGAAGGG - Intronic
1078797695 11:14609541-14609563 AATTTTAGCTAGGAGAGCCAGGG + Intronic
1079083775 11:17431175-17431197 AGTCTTGGCCAGGACAGGGAGGG - Intronic
1080827462 11:35860228-35860250 ACATTAAGCCAGGAGAAGCAGGG - Intergenic
1081179442 11:39968239-39968261 ACATTTGGGCAGGAGAAACAGGG - Intergenic
1083328905 11:61888051-61888073 ACTTATGGCCAGCAGCGGCTGGG + Intronic
1083367022 11:62147528-62147550 ACTGTTGGTCAGGAGATACATGG + Intronic
1085181449 11:74540297-74540319 ACTTCTAGCCAGAAGAGACAGGG - Intronic
1087603908 11:100351112-100351134 GCTTGAGACCAGGAGAGGCAAGG - Intronic
1087707413 11:101510188-101510210 GCTTTTGCATAGGAGAGGCAGGG - Intronic
1087780411 11:102295689-102295711 ACTTTTGGCCAAGAGAATGAAGG + Intergenic
1088680265 11:112235465-112235487 ACTTTTGGCCAAGAGAATGAAGG - Intronic
1088935977 11:114400637-114400659 CCTTTTGGCCAGGTTAGGGAGGG + Exonic
1089858152 11:121565480-121565502 CCTGTAGGCCAGGATAGGCATGG + Intronic
1089960492 11:122613562-122613584 ACTCTCGGCCAGGAGAAGAAAGG - Intergenic
1090180244 11:124691949-124691971 ATTTTTGATCAAGAGAGGCATGG - Intronic
1090425991 11:126607370-126607392 ACTCTTGGCTGGGAGAGGAAGGG + Intronic
1090570772 11:128042505-128042527 ACTTTTGGTGAGGGGAGCCAGGG + Intergenic
1091227349 11:133965489-133965511 ACTGGTGGTGAGGAGAGGCAGGG - Intergenic
1091700872 12:2660865-2660887 ACTTTTGGCCAAGAGAATGAAGG + Intronic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1093256228 12:16871620-16871642 ACTCTTGCCCAGGCCAGGCATGG - Intergenic
1094277027 12:28689182-28689204 ACTGTTGGTCAGCAGAGCCAGGG + Intergenic
1096039101 12:48498883-48498905 ACTTTTGGGGAGGAGACCCATGG + Intergenic
1096566619 12:52487625-52487647 ACTGGAGGCCAGGAGAGGAAAGG + Exonic
1098359656 12:69642227-69642249 ACTTGAGGCCAGGAGTGGCCTGG + Intergenic
1100475911 12:94935183-94935205 ACTTTAGGCCAAGAGGGGAAAGG - Intronic
1101082672 12:101205081-101205103 CCTCTTGGTCAGAAGAGGCAGGG - Intronic
1101085171 12:101228226-101228248 ACTTTTGGCCAAGAGAATGAAGG - Intergenic
1101426867 12:104595355-104595377 ATCTGAGGCCAGGAGAGGCAGGG - Intronic
1102934165 12:116882754-116882776 ACCTTTAGGCAGCAGAGGCAAGG - Intergenic
1106598011 13:31162819-31162841 ATTTATGGCTAGGAGTGGCAGGG - Intergenic
1106697577 13:32193090-32193112 ACATTTGTCCAGGAGAAGCCTGG - Intronic
1108466832 13:50725148-50725170 ACTTGTGGCCAGTGGAGGCAAGG - Intronic
1109777251 13:67057473-67057495 ACTTTTTTCCTGGGGAGGCATGG + Intronic
1121523039 14:94599509-94599531 ACCTTTGGCCAGGGGAGGGAGGG - Intronic
1122739055 14:103860218-103860240 ACCCCTGGCCAGGAAAGGCAGGG - Intergenic
1124291634 15:28457215-28457237 ACTTGGGGCCAGGTGAGGCGAGG - Intergenic
1125519613 15:40340530-40340552 GCTTTCGGCCTGGAGAGGCTGGG - Intronic
1125717205 15:41826103-41826125 AGTTCTGGCCAGGAGAGTAAGGG - Exonic
1126204861 15:46034239-46034261 TCCTTTGGACAGTAGAGGCAGGG + Intergenic
1126330284 15:47524026-47524048 ACTTTTATCAAGGAGAGGCGAGG + Intronic
1126724525 15:51618136-51618158 ACTTTTGGCCAGGGGAATCAAGG - Intronic
1128095031 15:64947600-64947622 GCTTAGGGCGAGGAGAGGCAAGG - Intronic
1128519235 15:68364665-68364687 GCTTGGGGTCAGGAGAGGCAGGG - Intronic
1130152069 15:81318872-81318894 AATCTCAGCCAGGAGAGGCATGG + Intronic
1130354727 15:83118900-83118922 ACATTTGCCCAGGAGAAGTATGG + Intronic
1131527729 15:93165947-93165969 AATTTTGCCCAGGAGAGTGATGG + Intergenic
1131582468 15:93658185-93658207 GCTGTTGGCCAGGAGTGTCAGGG - Intergenic
1132377692 15:101341220-101341242 ACTTTTGGCCAGGCGCGGTGCGG - Intronic
1132460340 16:50346-50368 AGATGTGGCCAGGAGAGGAAAGG - Intronic
1133307334 16:4818760-4818782 AGCTTTGGAGAGGAGAGGCAAGG - Intronic
1133489342 16:6251809-6251831 ATCTCTGGCAAGGAGAGGCAGGG - Intronic
1134307472 16:13046121-13046143 GCTTTTCCCAAGGAGAGGCAGGG - Intronic
1135041896 16:19123799-19123821 ACTTTAGACAAGGAGTGGCAAGG + Intronic
1136707147 16:32200455-32200477 ACTTGGGGCCAGGTGAGGCGAGG + Intergenic
1136760763 16:32728962-32728984 ACTTGGGGCCAGGTGAGGCGAGG - Intergenic
1136807340 16:33141424-33141446 ACTTGGGGCCAGGTGAGGCGAGG + Intergenic
1137499653 16:49000704-49000726 CCTTGTGGCCAGGTAAGGCAAGG - Intergenic
1137569563 16:49556599-49556621 ACTTGTGGCCAAGAGGGGTAGGG - Intronic
1138329789 16:56204418-56204440 ACATATGGCCAGGAGAGGGAGGG + Intronic
1138858140 16:60720896-60720918 ACTTTAGGCTGTGAGAGGCAGGG + Intergenic
1138916341 16:61469262-61469284 AATTTAGGCCAGGATAGGAATGG - Intergenic
1140058143 16:71543802-71543824 ACCTGTGGCCAGAAGAGGAAAGG + Intronic
1140182076 16:72729899-72729921 ACTTTAAGCCAGCAGAAGCAGGG + Intergenic
1141841441 16:86576701-86576723 ACCTCTGGCCAGGAGGGGCGAGG - Intronic
1141866475 16:86753283-86753305 GCTTATGGCCAGGCGTGGCAGGG - Intergenic
1142223655 16:88867040-88867062 GCTTCCGACCAGGAGAGGCAGGG + Intergenic
1203062915 16_KI270728v1_random:989276-989298 ACTTGGGGCCAGGTGAGGCGAGG - Intergenic
1143100421 17:4501531-4501553 ACTCCAGGCCAGGAGAGGGAGGG - Intronic
1143177148 17:4962357-4962379 ACTTTTGGGAAGGTGAGGCGGGG - Intronic
1144176128 17:12709429-12709451 ACTTTTAGTCAAGACAGGCAGGG + Intronic
1146001095 17:29131025-29131047 CCTTTGGGCCTGGAGAGGCTTGG - Intronic
1146613593 17:34332263-34332285 AGTTTAGGCCAGGCTAGGCAGGG + Intergenic
1148799126 17:50212022-50212044 TCTGCTGGCCAGGAAAGGCATGG + Intergenic
1149855872 17:60082145-60082167 ACTTTGAACCAGGAGAGGCTAGG + Intergenic
1150487887 17:65556596-65556618 ACTGTTGGCGAGGAGAGGAAGGG - Intronic
1153450134 18:5217789-5217811 TCTTTTGGTCAGAAGAAGCATGG - Intergenic
1155172443 18:23276795-23276817 ACTCCTGGCAAGGGGAGGCAGGG - Intronic
1155839998 18:30632316-30632338 CCCCTTGGCCAGGAGAGGAAAGG + Intergenic
1156215819 18:34997141-34997163 ACTATTTGTCAGGAGAGGTAGGG - Intronic
1157266498 18:46227943-46227965 AATTTTGACCAGTAGAGGTAAGG + Intronic
1159755030 18:72353606-72353628 ACTTTTGGCCACCAGAAACAAGG - Intergenic
1161119497 19:2517653-2517675 AATTATGGCCAGGCCAGGCACGG - Intronic
1162762105 19:12894766-12894788 ACTTTTGGCCAAGAGAATGAAGG + Intronic
1163433875 19:17283645-17283667 ACTCCTGTCCAGGAGAGGCATGG - Exonic
1163779892 19:19240545-19240567 GCCCTGGGCCAGGAGAGGCATGG + Intronic
1163951229 19:20589064-20589086 ACTTTTGGAGAAGATAGGCAAGG + Intronic
1164789218 19:30961745-30961767 ACTTTGGGTCAGCAGTGGCAGGG + Intergenic
1167782511 19:51608301-51608323 CCTTTTGGGAAGGAGAGGCCAGG + Intergenic
925121148 2:1419475-1419497 ACTTTTAGGCAATAGAGGCAGGG - Intronic
926194938 2:10757655-10757677 AGTGCTGCCCAGGAGAGGCAGGG - Intronic
926694878 2:15764210-15764232 ACCTTTGGCAAGGAGCGGCTGGG + Intergenic
927741808 2:25577004-25577026 ACTTGTGGACAGGAGAGAAAAGG + Exonic
929553357 2:42908098-42908120 ACTTCTGGCCAGTATAGGTAAGG + Intergenic
932243847 2:70179853-70179875 ACTTTAGCCCAGGAGGGTCAAGG + Intronic
933816010 2:86069405-86069427 ACTCTTGGCCAGGAGTGGCAGGG - Intronic
933990794 2:87632685-87632707 TTTTTTGTCCAGGAAAGGCATGG - Intergenic
935280090 2:101509646-101509668 ACTTTTGGCCAAGAGAATGAAGG - Intergenic
935682872 2:105652918-105652940 ACTTTTAGCCACAAGAAGCAGGG - Intergenic
936171331 2:110178880-110178902 ACTTATTGACAGAAGAGGCATGG + Intronic
936303048 2:111318138-111318160 TTTTTTGTCCAGGAAAGGCATGG + Intergenic
936971815 2:118183781-118183803 ACTTGTGTGCAGGAGAGGGAGGG + Intergenic
937294030 2:120798980-120799002 ACTCATGGCTTGGAGAGGCAGGG - Intronic
937364174 2:121248954-121248976 TCTCCTGGCCAGGAGAGGCCAGG - Intronic
937792373 2:125975839-125975861 ACTTTTAGCCTGGAGGGTCAGGG + Intergenic
938947086 2:136223169-136223191 ATTTTTGGCCAGTAGGGACACGG + Intergenic
940074839 2:149729984-149730006 GCTTTTGGCCAGGAGAGAAAGGG + Intergenic
940904232 2:159154330-159154352 ATTTTTGTCCAGCAGATGCAGGG + Intronic
944062303 2:195582722-195582744 GCTCTTGGGCAGGAGAGGCGGGG + Intronic
944629226 2:201606606-201606628 ACTTATGGAGAGGACAGGCACGG + Intronic
944770401 2:202908472-202908494 AGTTTTTGCCAGGTGAGGGAAGG + Intronic
945991424 2:216398581-216398603 ACTTCTGGCAAGTAGAGGCTGGG + Intergenic
948320648 2:237066017-237066039 ACCCCTGGCCAGGAGAGTCAGGG + Intergenic
1171375992 20:24694380-24694402 ACTTTTGCTAGGGAGAGGCAGGG + Intergenic
1172554583 20:35829818-35829840 GCTTGAGGCCAGGAGAGACAGGG - Intronic
1175586734 20:60147067-60147089 TGGTTTGGCCTGGAGAGGCAGGG + Intergenic
1178345790 21:31826976-31826998 ACCTAAGGCCATGAGAGGCAAGG - Intergenic
1178642314 21:34355025-34355047 ACTGTTGCCCAGGCAAGGCAGGG - Intergenic
1181063780 22:20295704-20295726 ACTGTTGTCCAGGGGAGGGATGG + Intergenic
1182205254 22:28617809-28617831 GCTTTTGGCCAGGAGAACAATGG - Intronic
1182727947 22:32463208-32463230 ACTTATGGGCAGGGGAGGAAAGG + Intronic
1184721115 22:46314043-46314065 ACATCTGGCCAGGTGAGGCCTGG + Intronic
1185144592 22:49124106-49124128 ATCTGTGGCCAGGGGAGGCACGG - Intergenic
949326893 3:2876157-2876179 ACTGCTGAACAGGAGAGGCAAGG - Intronic
951540123 3:23774655-23774677 AGGTTTGGCCAGGGGAGGGATGG - Intergenic
952901180 3:38112590-38112612 ACCTTTTCCCAGGAGATGCAGGG + Intronic
953875789 3:46666186-46666208 ACTTTTGGACATGAGGGGCCAGG + Intergenic
954207453 3:49070723-49070745 AATTCTGGCCAGGCCAGGCATGG - Intronic
955061294 3:55493671-55493693 ACTTTTGCTCAGCAGTGGCATGG - Intergenic
955239665 3:57167450-57167472 GCGTTTGGCCATGAGAGTCAGGG + Intronic
956701900 3:71966110-71966132 ACTTTGGGACAGAGGAGGCAAGG - Intergenic
957154621 3:76532062-76532084 AAGTGAGGCCAGGAGAGGCAGGG - Intronic
958055221 3:88401950-88401972 ACTTTTGGCCATGAGAAAAATGG + Intergenic
962356612 3:134699491-134699513 AATTTCTGTCAGGAGAGGCAGGG + Intronic
962949407 3:140204255-140204277 TGTTTTGGCCTAGAGAGGCAGGG + Intronic
963983644 3:151567654-151567676 ACTATTGGCCTGGAGTGGAAGGG - Intergenic
966735820 3:183186288-183186310 ACTCTTGCCCAGGAGAGGTGCGG + Intronic
968436121 4:590427-590449 AATTTTGGCCTGGAGGTGCAAGG - Intergenic
968812505 4:2806305-2806327 CCTTCAGGCCAGGAGAGGCGAGG + Intronic
968972370 4:3802696-3802718 ACTCTGGGGCAGGGGAGGCATGG + Intergenic
969567011 4:7984665-7984687 ACTTTTGGCCAGGAGAGGCAGGG + Intronic
971140922 4:23924042-23924064 ACCTGTGCCCAGGAGAGGCCAGG - Intergenic
972855703 4:43104074-43104096 ACATTTGGGTAGGAGAGTCATGG - Intergenic
973298792 4:48556879-48556901 GCAGTTGCCCAGGAGAGGCAAGG - Intronic
973529392 4:51819550-51819572 AATTTTGGCCAGAAAAGTCAGGG + Intergenic
976540380 4:86267565-86267587 AGATGAGGCCAGGAGAGGCAGGG - Intronic
978351446 4:107824735-107824757 ACTCTGCGCCAGGAGAGCCACGG + Exonic
978400655 4:108326809-108326831 ACCTCTGGCCAGGAGACACATGG + Intergenic
978841218 4:113215193-113215215 ACTTCTGAACAGGAGAGGAAAGG + Intronic
982476387 4:155856615-155856637 ACTTTTGACCAAGAAATGCAAGG - Intronic
982628909 4:157806476-157806498 AATTTTAGTCAGGAGAGGAATGG - Intergenic
983810359 4:172052663-172052685 ACTTTTGCCCAGGGTAGACAAGG + Intronic
985583430 5:712376-712398 ACCTGTTGCCTGGAGAGGCAGGG + Intronic
985596943 5:796674-796696 ACCTGTTGCCTGGAGAGGCAGGG + Intronic
986597744 5:9441242-9441264 ACTTATGGGCAGAAGAGTCAAGG + Intronic
989196178 5:38718785-38718807 ACTTTCTCCCAGGAGGGGCAGGG - Intergenic
993245722 5:85450542-85450564 ACTGATGTCCAGGAGAGTCAAGG + Intergenic
995769314 5:115652296-115652318 ACTGTTGGGCAGGTGAGGGAGGG - Intergenic
996520257 5:124418286-124418308 ATTTTTAGCTAGGAGAGGAAAGG - Intergenic
996813961 5:127553449-127553471 ACTTTTGTCCAGGAGTAACAGGG + Intronic
998463050 5:142323652-142323674 GGTTGTGGGCAGGAGAGGCAGGG - Intronic
998943518 5:147311978-147312000 ACGTTTGTCAAGGAGAGGCCAGG + Intronic
999470521 5:151850655-151850677 ACTGTTGGCCAGGAGAAGAAGGG + Intronic
999978510 5:156936472-156936494 ACTTGTGGCCTGGAGAGGTCAGG + Intronic
1001250115 5:170140643-170140665 ACATTAAGCCAGGAGAAGCAGGG - Intergenic
1002562530 5:180092044-180092066 AATTTTGCCCAGGAGAGGAGAGG - Intergenic
1004284953 6:14313145-14313167 ATTTTTGGCTAGGAGTGGGAGGG - Intergenic
1005377516 6:25199103-25199125 ACTTCTGTACTGGAGAGGCAGGG - Intergenic
1006027573 6:31157408-31157430 ACCTCTGGCCAGGAGCAGCAGGG - Exonic
1008165006 6:48126074-48126096 ACTATTGGCAAGGAGAGAGAGGG + Intergenic
1011431759 6:87294764-87294786 ATGTTTAGCCTGGAGAGGCAAGG + Intronic
1012430815 6:99161917-99161939 GCTTCTGGAAAGGAGAGGCAAGG + Intergenic
1013368436 6:109451568-109451590 AGTCCTGGCCAGGAGAGGCTGGG - Intronic
1016318500 6:142816678-142816700 ACTTTGAGCCAGGGGAGGCTTGG - Intronic
1020360340 7:7320857-7320879 TGCTTTGGCCAGGAGAGCCATGG - Intergenic
1021871819 7:25014675-25014697 ATGTTTGGCCAGGCCAGGCACGG - Intergenic
1022245855 7:28558648-28558670 TCTTTTGGCCAGGAGAGAACAGG + Intronic
1022741190 7:33123140-33123162 ACTTTAGGAGAGGAGAGGGAAGG - Intergenic
1023100132 7:36709226-36709248 ACTTTTGGCCAGGAGAGCCATGG + Intronic
1024527733 7:50363031-50363053 TAATTTGGCCATGAGAGGCAAGG + Intronic
1025101245 7:56136882-56136904 ACAGTTGGCCAGGCCAGGCACGG - Intergenic
1025202227 7:56969633-56969655 AGGTTTGGCGAGGAGATGCAGGG - Intergenic
1025669720 7:63607294-63607316 AGGTTTGGCGAGGAGATGCAGGG + Intergenic
1029200098 7:98833691-98833713 AATTTTGTCCCGGAGAGCCATGG - Intergenic
1030068274 7:105677128-105677150 ACTTTTGGACAGCAGGGCCAGGG + Intronic
1031925218 7:127632467-127632489 AGTTTTGGCCAGAAGAAACATGG - Intergenic
1033605576 7:142925801-142925823 ACTGGGGGCCAGAAGAGGCAGGG + Intronic
1033663089 7:143416977-143416999 ACTTTTGACCAGGTGAGGAAGGG + Intergenic
1035061982 7:156076149-156076171 AATTGAGGCCCGGAGAGGCAGGG + Intergenic
1036752263 8:11450848-11450870 ACTTGTGGTCAGGGCAGGCAGGG - Intronic
1038631558 8:29249645-29249667 AGTTTTGGCCAGCACAGGGAAGG - Intronic
1040545667 8:48396597-48396619 ACCTGTGGCCGGGAAAGGCAGGG - Intergenic
1041254119 8:55964692-55964714 TCTTTTTTCCAGGAGAGACAGGG - Intronic
1045605484 8:103768912-103768934 ACTTTTGGCCAAGAGAATGAAGG + Intronic
1046977128 8:120292269-120292291 ACTTTTGGCCATGAGAGAAATGG + Intronic
1049518831 8:143077939-143077961 GCAGTTGCCCAGGAGAGGCAAGG - Intergenic
1051355978 9:16240033-16240055 ACTTGTTGGCAGGAGAAGCAAGG - Intronic
1051655398 9:19376493-19376515 ACTTTTGGCCAAGAGAATGAAGG - Exonic
1052258746 9:26490869-26490891 CCTTGTGGCCTGGAGTGGCAGGG - Intergenic
1053046056 9:34918156-34918178 ACTGTCGGCCAGGAGAAGAAGGG + Intergenic
1054462811 9:65474688-65474710 CCTTGGGGCCAGGAGAGGCTGGG - Intergenic
1056957335 9:91092658-91092680 TCTTGTGGCCTGGAGTGGCAGGG + Intergenic
1057173087 9:92975575-92975597 AATTTGGTCCATGAGAGGCATGG + Intronic
1057870708 9:98714896-98714918 ACTTGTGGCCAGGGGAGGTTTGG - Intergenic
1059330761 9:113534036-113534058 ACTTTTGGGCCTGAGAGGAATGG + Intronic
1060170943 9:121460555-121460577 ACTTTAGCCCAGGCCAGGCATGG + Intergenic
1061078863 9:128357990-128358012 ACTTCTGTCCAGGAAAGGCAGGG + Intronic
1061913647 9:133738062-133738084 ACTTGTGGGGAGGAGCGGCAGGG + Intronic
1061944690 9:133902055-133902077 ACTTTTGGCCCAGAGAGGTGGGG - Intronic
1062325074 9:136009053-136009075 ACCCTTGGCCAGGACAGGGAGGG - Exonic
1185516286 X:701534-701556 GCTGTTGTCCAGGGGAGGCAAGG + Intergenic
1186606102 X:11093529-11093551 ACTTTTGGAAAGGCCAGGCACGG - Intergenic
1188767765 X:34117601-34117623 ACTTCTGGCAAGGGGAGGGACGG - Intergenic
1189089847 X:38070104-38070126 ACTTTTTGCCAGTAGTGGAATGG + Intronic
1189398106 X:40641680-40641702 ACTTGTAGCAAGGACAGGCACGG - Intronic
1190077831 X:47331355-47331377 ACTTTTGGCCAGGTGTGGTGTGG + Intergenic
1192498651 X:71633912-71633934 TCATGTGGCCACGAGAGGCAGGG - Intergenic
1192790343 X:74376220-74376242 ACTTTTGGCCAAGAGAATGAAGG - Intergenic
1195357144 X:104049408-104049430 ACTTTTACCCGGCAGAGGCAGGG + Intergenic
1196022957 X:111009420-111009442 ACTTCTTGCCAGGACAGGCTTGG + Intronic
1196718065 X:118828522-118828544 CCTTTTGGCCAGGAGGGTAAAGG - Intergenic
1198597991 X:138257956-138257978 ACTTTAGGGAAGGACAGGCAAGG + Intergenic
1198732712 X:139750081-139750103 ACTATAGGCCAGGATGGGCAAGG + Exonic
1199049931 X:143225228-143225250 TCTTCAGACCAGGAGAGGCAGGG + Intergenic
1199455284 X:148021025-148021047 ACTTTTGGCCCACAGTGGCAAGG + Intronic
1199517432 X:148693799-148693821 ACTTGTTGCCAGGTGAGGCCAGG - Intronic
1199635143 X:149806647-149806669 ACATCTGGCCAGCAGAGGGAGGG + Intergenic