ID: 969568129

View in Genome Browser
Species Human (GRCh38)
Location 4:7992242-7992264
Sequence AATCAGCCCCCAGATTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969568125_969568129 -9 Left 969568125 4:7992228-7992250 CCCCTCTGCAAGGCAATCAGCCC 0: 1
1: 0
2: 1
3: 8
4: 218
Right 969568129 4:7992242-7992264 AATCAGCCCCCAGATTGTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 158
969568124_969568129 -4 Left 969568124 4:7992223-7992245 CCTGGCCCCTCTGCAAGGCAATC 0: 1
1: 0
2: 0
3: 13
4: 178
Right 969568129 4:7992242-7992264 AATCAGCCCCCAGATTGTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 158
969568122_969568129 10 Left 969568122 4:7992209-7992231 CCTGGGGCACAGGGCCTGGCCCC 0: 1
1: 1
2: 6
3: 87
4: 739
Right 969568129 4:7992242-7992264 AATCAGCCCCCAGATTGTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 158
969568116_969568129 27 Left 969568116 4:7992192-7992214 CCTAAGGCGTTCACTGTCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 88
Right 969568129 4:7992242-7992264 AATCAGCCCCCAGATTGTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 158
969568126_969568129 -10 Left 969568126 4:7992229-7992251 CCCTCTGCAAGGCAATCAGCCCC 0: 1
1: 0
2: 0
3: 16
4: 196
Right 969568129 4:7992242-7992264 AATCAGCCCCCAGATTGTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969568129 Original CRISPR AATCAGCCCCCAGATTGTCT GGG Intronic
901047765 1:6408404-6408426 CCTCAGCCTCCAGAGTGTCTGGG - Intergenic
904637844 1:31898210-31898232 ACTCAGCCCCCAGAGTAGCTGGG + Intergenic
905229929 1:36508661-36508683 CATCAGCCTCCAGAATGTCCCGG + Intergenic
905344662 1:37303032-37303054 ATTCAGCCCCCAGATTCTTCTGG - Intergenic
907757714 1:57327052-57327074 CATCAGCCCCCTGAGTATCTGGG + Intronic
911307382 1:96247470-96247492 AATCAGCTGCCAGAGTGGCTAGG + Intergenic
912324815 1:108747172-108747194 AAACAGCGCCCGAATTGTCTCGG - Intronic
912350760 1:109010440-109010462 AATCAGCCCCCTGAGTAGCTGGG - Intronic
912354673 1:109045021-109045043 CATCAGCCCCCAGAGTAGCTGGG + Intergenic
912409711 1:109472230-109472252 CATCAGCCCCCAGAGTAGCTGGG + Intronic
913566709 1:120080067-120080089 CATGAGCCCCCAGCATGTCTGGG - Intergenic
913631422 1:120713485-120713507 CATGAGCCCCCAGCATGTCTGGG + Intergenic
914094739 1:144535149-144535171 CATCAGCCTCCTGATTTTCTGGG + Intergenic
914303782 1:146398749-146398771 CATCAGCCTCCTGATTTTCTGGG - Intergenic
915512437 1:156393540-156393562 AATCAGCCCTCGGGTTGTTTGGG - Intergenic
918815404 1:189174090-189174112 AATCAGCTTCCAGCATGTCTTGG + Intergenic
921665319 1:217863236-217863258 CCTCAGCCTCCAGAGTGTCTGGG + Intronic
923670934 1:236040777-236040799 CCTCAGCCTCCAGATTGGCTGGG + Intronic
1063889768 10:10617593-10617615 AATCTGCAGCCAGATGGTCTGGG - Intergenic
1066220111 10:33329076-33329098 AACAAGTCTCCAGATTGTCTAGG + Intronic
1067915113 10:50389189-50389211 AAACAGCCACCTGAATGTCTAGG + Intronic
1068691855 10:59924679-59924701 AATGAGCCCATAGATTGTGTGGG - Intergenic
1068822174 10:61389781-61389803 GATCAGCCTCCAGAGTGGCTGGG - Intergenic
1079871432 11:25802959-25802981 CCTCAGCCCCCTGATTATCTGGG - Intergenic
1083646693 11:64175629-64175651 CCTCAGCCCCCAGATTAGCTGGG - Intergenic
1083839318 11:65294717-65294739 AAGCAGCCCCTTGATTTTCTTGG - Intronic
1084383903 11:68830160-68830182 CCTCAGCCCCCAGAATGGCTAGG - Intronic
1087834739 11:102861847-102861869 ACTCAGCCTCCAGATTAGCTGGG - Intergenic
1093132042 12:15403465-15403487 ACTCAGCCTCCAGAGTATCTGGG - Intronic
1097553131 12:61100549-61100571 CCTCAGCCTCCTGATTGTCTGGG - Intergenic
1098476992 12:70916531-70916553 AATCATCTCCCAGATCTTCTTGG + Intronic
1098477005 12:70916726-70916748 AATCACCTCCCAGATCTTCTTGG + Intronic
1101102045 12:101403842-101403864 CATCAGCCTCCAGAGTGGCTGGG - Intronic
1101300937 12:103480484-103480506 AATAAGCCCCCAAAATGTATAGG - Intronic
1101333145 12:103773219-103773241 ATACAGCCCACAGCTTGTCTTGG + Exonic
1104247000 12:127053134-127053156 AAGCAGCCCACACCTTGTCTTGG - Intergenic
1107612740 13:42132781-42132803 AATCAGCCTCCTGAGTGGCTGGG - Intronic
1107892026 13:44922263-44922285 AATCACACCCCAGATTGCTTTGG - Intergenic
1109056128 13:57551672-57551694 ATTCAGCCTCCAGATTAGCTGGG - Intergenic
1110278204 13:73662254-73662276 ATACAGCCCCCAGCTTGGCTGGG - Intergenic
1110363057 13:74649868-74649890 AATCAGCTGCCAGTGTGTCTAGG + Intergenic
1112085701 13:96029704-96029726 GATCTGCCACCAGATTGTCCAGG + Intronic
1113060518 13:106317272-106317294 AAGCATCTGCCAGATTGTCTGGG - Intergenic
1113306820 13:109088564-109088586 ATTCAGCTCCCATATTGTCTGGG + Intronic
1117749811 14:58909627-58909649 ACTCTTCCCCCAAATTGTCTGGG - Intergenic
1121136108 14:91500314-91500336 ACTCAGCCTCCAGAGTGGCTGGG + Intronic
1121896611 14:97654392-97654414 TATCAGCCCCCAGGTCCTCTAGG + Intergenic
1123170616 14:106369343-106369365 AAGGATCCCCCAGGTTGTCTTGG + Intergenic
1123470704 15:20550142-20550164 CATCAGCCTCCAGAGTGGCTGGG + Intergenic
1123647356 15:22450561-22450583 CATCAGCCTCCAGAGTGGCTGGG - Intergenic
1123731005 15:23145119-23145141 CATCAGCCTCCAGAGTGGCTGGG + Intergenic
1123749144 15:23342545-23342567 CATCAGCCTCCAGAGTGGCTGGG + Intergenic
1124281516 15:28366427-28366449 CATCAGCCTCCAGAGTGGCTGGG + Intergenic
1124301187 15:28545192-28545214 CATCAGCCTCCAGAGTGGCTGGG - Intergenic
1126768628 15:52033476-52033498 CATCAGACTCCAGATTGTTTGGG + Intronic
1129901681 15:79156424-79156446 AACCAGCCCCCACATTGTGAAGG - Intergenic
1130336120 15:82958677-82958699 AATCAGCCCCCAGTGAGGCTGGG + Intronic
1131649703 15:94385478-94385500 GATAAACCCCCAGATTTTCTTGG + Exonic
1131920184 15:97318485-97318507 AATCAGCCCCCAATGTGACTGGG - Intergenic
1133091158 16:3404622-3404644 AACCAACCCCCAAATTGGCTGGG + Exonic
1138340177 16:56284046-56284068 AATGAGTCCCCAAATTGGCTGGG - Intronic
1138509489 16:57499989-57500011 CCTCAGCCTCCAGAGTGTCTGGG + Intergenic
1138790003 16:59892687-59892709 CATCAGCCTCCAGAGTGGCTGGG + Intergenic
1138926597 16:61599267-61599289 CCTCAGCCCCCAGATTAGCTGGG + Intergenic
1140129706 16:72149705-72149727 ACTCAGCCTCCAGAGTATCTGGG - Intronic
1142831296 17:2551020-2551042 CCTCAGCCTCCAGATTGGCTGGG - Intergenic
1145792420 17:27636080-27636102 AATCAGATCCCAGATTTCCTGGG + Intronic
1145807307 17:27743953-27743975 AATCAGATCCCAGATTTTCTGGG + Intergenic
1146270765 17:31484184-31484206 CCTCAGCCTCCAGAGTGTCTGGG + Intronic
1146665713 17:34701751-34701773 AGTCAGCCTCCAGAGTGTGTTGG + Intergenic
1147484848 17:40802528-40802550 AATCAGGCTCCAGACTGTTTAGG - Intergenic
1148768975 17:50056163-50056185 AACCGGCCCCCAGCTTGTCCCGG - Intronic
1153090214 18:1334427-1334449 AGTCAGCCCCGAGATAGTGTTGG - Intergenic
1153516718 18:5910390-5910412 AAGCAGGCCCCAGTTTGGCTGGG - Intergenic
1159026400 18:63185835-63185857 ACTCAGGACCCAGATTGCCTGGG - Intronic
1160052145 18:75443869-75443891 CCTCAGCCTCCAGAGTGTCTGGG - Intergenic
1162024312 19:7884907-7884929 ACTCAGCCTCCAGAGTGGCTGGG - Intergenic
1162631885 19:11934640-11934662 ACTCAGCCTCCAGAGTGTCTGGG + Intronic
1164066077 19:21718443-21718465 ACTCAGCCTCCAGAGTGGCTGGG - Intergenic
1166423390 19:42655245-42655267 CATCTGCCCCAGGATTGTCTTGG + Intronic
1166941536 19:46369514-46369536 CCTCAGCCCCCAGAGTGGCTAGG - Intronic
926893392 2:17658305-17658327 AATCAGCCCCCAGCTGCTCCAGG - Intergenic
926991937 2:18689552-18689574 GATAAGCCCACAGATTTTCTGGG + Intergenic
927979492 2:27365490-27365512 ACTCAGCCTCCAGATTAGCTGGG + Intronic
930943931 2:57048384-57048406 AATCAGCTTCCAGGTTGTCATGG - Intergenic
932173786 2:69580707-69580729 AATGTGCCCACAGAGTGTCTTGG + Intronic
937725889 2:125166196-125166218 AAGTATCCCCCAGATTGTCCAGG + Intergenic
942022862 2:171884173-171884195 AAAAAGCCCACAGATTGGCTGGG - Intronic
943023588 2:182602453-182602475 AATCAGCCCTCAGATGGACATGG + Intergenic
945285855 2:208080678-208080700 ACTCAGCCTCCAGAGTATCTGGG - Intergenic
948032227 2:234828336-234828358 ATTCAGCCTCCAGATTTTCGGGG - Intergenic
948830446 2:240596036-240596058 CAGCAGCCCCCAGGTTGCCTGGG + Intronic
1170206154 20:13800812-13800834 GATCAGCTGCCAGATCGTCTGGG + Intronic
1171040452 20:21757875-21757897 AAACAGCCCCCTGATCTTCTCGG + Intergenic
1173275500 20:41577467-41577489 AAATAGCCCCCAGATTCTATAGG - Intronic
1175425650 20:58864321-58864343 AATCAGCCCCTCGATTTTTTTGG + Intronic
1176726093 21:10434271-10434293 ACTCAGCCCCCCGAGTATCTGGG + Intergenic
1179719373 21:43306621-43306643 AAGCAGCCCCCAGCGGGTCTGGG + Intergenic
1180288278 22:10772847-10772869 ACTCAGCCCCCCGAGTATCTGGG - Intergenic
1182867625 22:33617968-33617990 AAACAGGCCCTAGATTGCCTTGG - Intronic
1183080920 22:35455892-35455914 ACTCAGGCCCCAGATTATTTTGG + Intergenic
951142795 3:19186182-19186204 AATCACCTCTCTGATTGTCTAGG + Intronic
951331694 3:21377229-21377251 AATCAGCTGCCAGCTTGGCTAGG - Intergenic
953049242 3:39325743-39325765 CCTCAGCCTCCAGATTGGCTGGG - Intergenic
955634728 3:61015058-61015080 AGTCAGGCCCCATTTTGTCTAGG - Intronic
960022775 3:112974319-112974341 ACTCAGCCTCCTGAGTGTCTAGG - Intronic
961978706 3:131054217-131054239 ACTCAGCCCCCAGAGTAGCTGGG - Intronic
964818457 3:160742771-160742793 ACTCAGCCTCCTGATTATCTGGG - Intergenic
967645620 3:191920074-191920096 CAACAGCTCCCAGATTGGCTAGG + Intergenic
969568129 4:7992242-7992264 AATCAGCCCCCAGATTGTCTGGG + Intronic
969590249 4:8117935-8117957 AATCAAGCCCCACATTCTCTGGG + Intronic
969738556 4:9007765-9007787 ACTCAGCCCCCAGAGTTTCTGGG + Intergenic
973278264 4:48332775-48332797 CTTCAGCCCCCAGAGTGGCTGGG - Intergenic
973556196 4:52085713-52085735 AATCCTCCCCCAAATTATCTGGG + Intronic
974631000 4:64488958-64488980 ATTCAGCCCTCAGATAGTTTTGG - Intergenic
975167248 4:71190598-71190620 ACTCAGCCTCCAGAGTATCTGGG - Intronic
977100722 4:92810905-92810927 CCTCAGCCTCCAGATTATCTGGG + Intronic
980778914 4:137471459-137471481 CATCAGCCTCCAGAGTGGCTGGG + Intergenic
981328271 4:143477362-143477384 AACCAGCCCCCAGAAAGGCTGGG + Intergenic
981444546 4:144820586-144820608 AAACAGGCCCCAGATTGCCATGG - Intergenic
981529622 4:145739375-145739397 ATTCATCCCATAGATTGTCTTGG + Intronic
981839725 4:149097247-149097269 TATGAGGCCTCAGATTGTCTAGG + Intergenic
982222839 4:153139712-153139734 AATCAGCCGTCAGCGTGTCTAGG + Intergenic
986048081 5:4060282-4060304 TGCCAGTCCCCAGATTGTCTAGG - Intergenic
986561267 5:9062579-9062601 ACTCAGCCTCCAGAATGACTGGG + Intronic
991142778 5:63264827-63264849 CTCCAGCCCCCAGATAGTCTGGG + Intergenic
991420637 5:66437692-66437714 AAGCAGTCCCCAAATTTTCTTGG - Intergenic
992061434 5:73052037-73052059 CCTCAGCCTCCCGATTGTCTGGG + Intronic
994583001 5:101671677-101671699 AATCAGCCTCCAAATTTTATAGG + Intergenic
996126546 5:119731961-119731983 AATCAGGCCCTAGATTATCCAGG - Intergenic
1004216568 6:13710422-13710444 AATTAGGCCAGAGATTGTCTAGG - Intronic
1004736706 6:18413533-18413555 AATCAGACCTCTGAATGTCTCGG - Intronic
1009325235 6:62340589-62340611 AATCAGCCCCCAGTTTCTTCTGG - Intergenic
1012726819 6:102824223-102824245 CCTCAGCCCCCTGATTATCTGGG - Intergenic
1014196408 6:118564896-118564918 ATACAGCCCCCAGTTGGTCTAGG - Intronic
1014736170 6:125098432-125098454 AATCAGCCCCCGGAGTGGGTGGG + Intergenic
1015308147 6:131733617-131733639 CATCAGCCCGCAGACAGTCTGGG - Exonic
1016284637 6:142459546-142459568 ACTCAGCTCCCAGCTTCTCTGGG + Intergenic
1019020259 6:168912094-168912116 AATCAGCCGCCGGCTTGGCTAGG + Intergenic
1020457982 7:8395946-8395968 AGTCAGATCCCAGAATGTCTTGG - Intergenic
1020800898 7:12731054-12731076 ATACAGCCCCCAAATTGTCATGG + Intergenic
1022773914 7:33504347-33504369 AAACAGCCCTCAGAGTGTCTCGG - Intronic
1023118037 7:36881966-36881988 GACCAGCCCCAAGCTTGTCTTGG - Intronic
1023550398 7:41364145-41364167 CCTCAGCCTCCAGAGTGTCTGGG - Intergenic
1028694835 7:93697239-93697261 ACTCAGCCTCCTGATTATCTAGG - Intronic
1030008600 7:105143000-105143022 AATCAGCCCCCATGTTGACCTGG + Intronic
1031952632 7:127908122-127908144 AATGAACCCCCAGTTTGTCTAGG + Intronic
1034829233 7:154294831-154294853 AACAAGCCCACAGATTGTCGGGG - Intronic
1037352142 8:17971857-17971879 CCTCAGCCCCCTGAGTGTCTAGG + Intronic
1038433491 8:27518631-27518653 AAACAGCCCCCAGGTTGGCTGGG + Intronic
1038964747 8:32559133-32559155 ATTCACCCCCCAAATTGTCTTGG + Intronic
1041134193 8:54738394-54738416 AATCAGCACCCATATTCTGTGGG + Intergenic
1045404922 8:101856286-101856308 CTTCAGCCCCCAGAGTGACTTGG + Intronic
1045675272 8:104600634-104600656 AATCAGCCTCCCGAGTATCTGGG - Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1047710664 8:127548927-127548949 GATGAGCCCCCATATTTTCTAGG + Intergenic
1051106490 9:13586891-13586913 AAGCAGAGCCCAGGTTGTCTGGG + Intergenic
1056623822 9:88237559-88237581 AATCAGTCCCCAGAATGAGTAGG - Intergenic
1061388793 9:130305910-130305932 AATCAGCCTCCATGTTGCCTGGG + Intronic
1186236584 X:7517451-7517473 ACTCAGCCTCCAGAGTATCTGGG - Intergenic
1186662792 X:11686006-11686028 AATCAGCCTCCAGAATAGCTGGG + Intergenic
1188122936 X:26332771-26332793 AATCTGTAACCAGATTGTCTTGG - Intergenic
1189282734 X:39830358-39830380 AGGCAGCCCCCAAATTGACTAGG + Intergenic
1189604868 X:42666281-42666303 ATTCAGCAGGCAGATTGTCTGGG - Intergenic
1194411816 X:93566735-93566757 CATGAGCCCCAAGTTTGTCTTGG - Intergenic
1195777596 X:108424894-108424916 CCTCAGCCCCCAGAGTGGCTGGG - Intronic
1198460241 X:136856285-136856307 ACTCAGCCCCCTGAGTGGCTGGG - Intronic