ID: 969568242

View in Genome Browser
Species Human (GRCh38)
Location 4:7992761-7992783
Sequence CAGCAGGAGGAGAGGCCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 780
Summary {0: 1, 1: 0, 2: 8, 3: 82, 4: 689}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969568242_969568250 -3 Left 969568242 4:7992761-7992783 CCCCGGGGCCTCTCCTCCTGCTG 0: 1
1: 0
2: 8
3: 82
4: 689
Right 969568250 4:7992781-7992803 CTGTGTGGTCAAGAAGCTGTGGG 0: 1
1: 0
2: 2
3: 26
4: 217
969568242_969568249 -4 Left 969568242 4:7992761-7992783 CCCCGGGGCCTCTCCTCCTGCTG 0: 1
1: 0
2: 8
3: 82
4: 689
Right 969568249 4:7992780-7992802 GCTGTGTGGTCAAGAAGCTGTGG 0: 1
1: 0
2: 2
3: 25
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969568242 Original CRISPR CAGCAGGAGGAGAGGCCCCG GGG (reversed) Intronic
900097328 1:945261-945283 CAGCAGGTGGAGAGGAGCCCTGG + Intronic
900140252 1:1136834-1136856 CAGCAGGAGGGGCGGCCGGGTGG + Intergenic
900184161 1:1325160-1325182 CAGCAGGAGACGGGGCCCCACGG - Intronic
900191336 1:1353528-1353550 GAGCATCAGGAGATGCCCCGAGG + Intronic
900217856 1:1491156-1491178 CAGCAGGAGGGGTGCCTCCGAGG - Intronic
900294773 1:1943388-1943410 CAGCAGGAGGACAGGCGCCGCGG + Intronic
900461378 1:2803660-2803682 GAGCAGGAGGAGCGGCTCCCAGG - Intergenic
900534394 1:3169801-3169823 CAGCCAGGGGAGAGGGCCCGAGG - Intronic
900553687 1:3269361-3269383 CAGGAGGAGGACAGTCCCAGAGG + Intronic
900553924 1:3270399-3270421 CAGGAGGAGGACAGTCCCAGAGG + Intronic
900553979 1:3270660-3270682 CAGGAGGAGGACAGTCCCAGAGG + Intronic
900629739 1:3628001-3628023 CACCAGGAGAGGAGGCCTCGGGG + Intronic
900631932 1:3641155-3641177 CAGCAGGAAGAAAGGACCAGAGG + Intronic
900634019 1:3652926-3652948 CAGCAGGAGGAGGGCCCTCCCGG - Intronic
900648448 1:3719444-3719466 CAGAAGGAGGAGGGGCCAGGTGG - Intronic
900875665 1:5340835-5340857 CAGCAGGAGCAGTTGCCCCCCGG + Intergenic
900939156 1:5786740-5786762 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
900984002 1:6062741-6062763 CAGCAGGAATAGAAGCCCAGAGG + Intronic
901104859 1:6747228-6747250 CAGCAGCAGGAGATGCAGCGGGG + Intergenic
901252939 1:7795569-7795591 CAGCAGGCGCAGAGGCCCTGGGG + Intronic
901432369 1:9224867-9224889 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
901599602 1:10412919-10412941 CAGCAGGAGCAGAAGTCCCCAGG + Intronic
901661374 1:10799875-10799897 CAGCAGGTGCAGAGGCCCTGAGG - Intergenic
901972343 1:12918042-12918064 CAGGAGGAGGAGGGGCACCATGG + Intronic
902012836 1:13283720-13283742 CAGGAGGAGGAGGGGCACCATGG - Intronic
902837645 1:19057540-19057562 CAGCCTGAGCAGAGGCCCTGGGG + Intergenic
902933006 1:19744670-19744692 CAGCAGGTGCAAAGGCCCAGCGG - Intronic
903047400 1:20575141-20575163 CAGCAAGTGCAAAGGCCCCGAGG + Intergenic
903185708 1:21627752-21627774 CAGCAGGAGAAATGGCCCGGAGG + Intronic
903296035 1:22343629-22343651 CAGCATGTGCAAAGGCCCCGAGG + Intergenic
903386148 1:22928225-22928247 CAGCAGGAGCAAAGGCCCTGAGG + Intergenic
903785622 1:25859336-25859358 CATGAGGCGGACAGGCCCCGAGG - Exonic
904606330 1:31699845-31699867 GCGCAGGATGAGAGGCCCCTTGG + Exonic
904697867 1:32340441-32340463 CAGCAGCAGGAGAGGGCTCTGGG + Intergenic
904799929 1:33085456-33085478 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
905800480 1:40839266-40839288 CAGCAGGAGGAGGGAGCCCCTGG - Exonic
905855358 1:41307905-41307927 AAGCAAGAGCAAAGGCCCCGTGG - Intergenic
906059458 1:42938928-42938950 CAGCAGTGGGAGAGACCCCTTGG - Intronic
906128129 1:43439943-43439965 CAGCTGGAGGAGAAACTCCGAGG + Exonic
906680121 1:47720502-47720524 CTGCAGGAGGAGTGGCCCAGTGG - Intergenic
907074413 1:51565367-51565389 CAGCAGGAGCAAAGGCACAGTGG - Intergenic
907400539 1:54222338-54222360 CAGCAGGAACAAAGGCCCTGGGG + Intronic
907559679 1:55377060-55377082 CAGCAGGTGCAGAGGCTCCAAGG + Intergenic
907675018 1:56510166-56510188 CAGCAGGAGGACAGCCCGCGGGG - Intronic
908230241 1:62097514-62097536 CAGCATGTGGAGAGACCACGTGG + Intronic
908735371 1:67270896-67270918 CAGCAGGAGCAAAGACCCTGGGG - Intergenic
909367604 1:74846008-74846030 CAGCAGGAGTGCAGGCCCTGAGG - Intergenic
909489435 1:76209816-76209838 CAGCAGGAAGGGTGGCCCGGGGG - Intronic
913077354 1:115352277-115352299 CAGCAAGTGCAAAGGCCCCGAGG - Intergenic
913250687 1:116910142-116910164 GAGGAGGAGGAGAGGCGGCGGGG + Exonic
914490730 1:148148839-148148861 CAGGAGGAGGAGAGGCGCCAGGG + Intronic
915494772 1:156274142-156274164 TATCAGGACGAGAGGCCCCAGGG + Intronic
915580859 1:156812464-156812486 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
915679801 1:157570250-157570272 CAGTAGCAGCAGAGGCCCCATGG + Intergenic
915914306 1:159931826-159931848 CAACAGGAGGAGGGTCCCCTTGG + Exonic
916486747 1:165266332-165266354 TAGCAGGAGCAGAAGCCCTGAGG + Intronic
917496886 1:175548597-175548619 CAGCAGAAAGAGGGGCCCTGAGG - Intronic
917711159 1:177687000-177687022 CAGCATGAGGACAGGCCCACTGG - Intergenic
917793443 1:178514480-178514502 CAAAAGGAGCTGAGGCCCCGTGG + Intronic
918084562 1:181234825-181234847 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
919263884 1:195237282-195237304 CTGCAGTAGGAGAGGCACAGCGG + Intergenic
919516576 1:198532765-198532787 CAGCAAGTGCAGAGGCCCTGAGG + Intronic
919613329 1:199774027-199774049 CAGCAGGAGCAAAGGCTCTGAGG + Intergenic
919675354 1:200376826-200376848 CAGCATGAGCAAAGGCCCTGAGG - Intergenic
919797717 1:201331399-201331421 CAGCAGCAGGAGGGCTCCCGAGG + Exonic
919821235 1:201473502-201473524 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
920052980 1:203174653-203174675 CAGCAGGAAAAGAAGCCCCATGG - Intronic
920182886 1:204143428-204143450 GAGCAGGGAGGGAGGCCCCGGGG - Intronic
920248379 1:204605488-204605510 CAGCTGGAGGAGAAGGCCCTGGG + Intergenic
920496116 1:206455981-206456003 CAGCAGGATGACAAGCCCCAGGG + Intronic
921389807 1:214606380-214606402 GATCAGGAGGAGAGGCGCCAGGG - Intronic
922458233 1:225794336-225794358 CAGCAGGAAGAGAGGACTCTGGG - Intergenic
922547355 1:226467922-226467944 GAGCAGGAGGAGAAGACCCAAGG + Intergenic
922588477 1:226753873-226753895 CAGCCAGAGTAGAGGCCCTGAGG + Intergenic
922663774 1:227451915-227451937 CAGCAGGTGGAGGGGAGCCGAGG + Intergenic
923687967 1:236167016-236167038 CTGTGGGAGGAAAGGCCCCGAGG + Intronic
923838006 1:237635870-237635892 TAGCAGGTGCAGAGGCCCTGAGG - Intronic
924592648 1:245418212-245418234 AAGCCGGAGGAGAGGCTCTGCGG + Intronic
924616184 1:245613763-245613785 GAGTAGGAAGAGAGGCACCGAGG - Intronic
1062843077 10:686299-686321 CCGCAGGTGGAGAGGCCGTGAGG - Intronic
1062923852 10:1299720-1299742 CAGAAGGAGGCGAAGCCCAGGGG - Intronic
1063250785 10:4271727-4271749 CAGCAGAGGCAGAGGCCCCAGGG - Intergenic
1063546328 10:6985785-6985807 AAGCAGGAGGAGGTGCTCCGGGG + Intergenic
1064408355 10:15084245-15084267 CAGCAGTCCGTGAGGCCCCGTGG - Intronic
1065970682 10:30803841-30803863 CAGCAGGAGGGCAGCCCCTGAGG + Intergenic
1066650619 10:37651605-37651627 CAGGCAGAGGAGAAGCCCCGCGG + Intergenic
1067051274 10:43022784-43022806 CAGCAAGAGCACAGGCCCTGAGG + Intergenic
1067107092 10:43373703-43373725 CTGCAGGGGGAGAGGCACTGGGG - Exonic
1067767394 10:49097282-49097304 CAGCAGGAGGAGGCCCCCGGTGG - Intronic
1067794818 10:49313309-49313331 CACCATGAGCAGAGGCCCTGAGG + Intronic
1069734945 10:70647981-70648003 TAGCAGGAGAAAAGGCCCCAGGG - Intergenic
1069775897 10:70926955-70926977 CAGCAGGAGGCGAGGCCAGCTGG - Intergenic
1069873580 10:71547954-71547976 GAGCCGGAAGAGAGGCCCCGTGG + Intronic
1069890824 10:71651584-71651606 CAGCATGTGCAAAGGCCCCGTGG + Intronic
1069891189 10:71653361-71653383 GAGCAGAGGGAGAGGCCCTGTGG - Intronic
1069941734 10:71961377-71961399 CAGCAGGAAGAGAGGACTCTGGG + Intergenic
1069993712 10:72329926-72329948 CAGCATGAGCAGAGGCCCGGAGG - Intergenic
1070774750 10:79103173-79103195 CAGCAGGTGCAAAGGCCCAGGGG + Intronic
1071500825 10:86203265-86203287 CAGTGGGAGGAGGGGCCCTGAGG + Intronic
1071598727 10:86945758-86945780 CGGCAGGAGGCGAGGACCGGTGG - Intronic
1072407505 10:95168759-95168781 CAGCAGGAGGAGTGGGGCAGGGG + Intergenic
1072948983 10:99835918-99835940 CAGAATGATGAGAGGCTCCGAGG - Intronic
1073176074 10:101558578-101558600 TAGCAGCAGGAGAGGCCAAGTGG + Intergenic
1073249641 10:102114023-102114045 CAGCAGGAGTAGAGGCAGCAAGG + Intronic
1074188741 10:111117701-111117723 CAGCAGTAGCAGTGGCCCCCAGG - Intergenic
1074256081 10:111803873-111803895 CAGCAGAAGCAAAGGCCCAGTGG + Intergenic
1075091817 10:119448071-119448093 GGACAGGAGGAGAGGCCCAGGGG + Intronic
1075574913 10:123571203-123571225 CAGTGGGAAGAGAGGCCCCATGG - Intergenic
1075918669 10:126191391-126191413 CAGCAGGAGGGGAAGCCTGGAGG + Intronic
1076374343 10:129973187-129973209 CACCTGGAGGAGAGGCCTCCTGG + Intergenic
1076461008 10:130647442-130647464 CAGGAGCAGGAGTGGCCCTGTGG - Intergenic
1076651645 10:131993484-131993506 CAGCAGCAGGAGAGTGCCAGTGG + Intergenic
1076684018 10:132188566-132188588 CAGGAGGAGGAGAGGTGCAGCGG + Intronic
1076940965 10:133608201-133608223 CACCAGGAAGAGAGGACCCTGGG + Intergenic
1076998087 11:308846-308868 CAGAAGGAGGATGAGCCCCGAGG + Intronic
1076999308 11:314765-314787 CAGAAGGAGGATGAGCCCCGAGG + Intronic
1077000560 11:320135-320157 CAGAAGGAGGATGAGCCCCGAGG - Intronic
1077063353 11:627117-627139 CAGCAGCAGGAGGGGCCGGGGGG + Exonic
1077148492 11:1056637-1056659 CAGTGGGAAGAGAGGCCCCTGGG - Intergenic
1077181309 11:1218426-1218448 CAGCAGGTGCAGAGACGCCGAGG - Intergenic
1077499951 11:2904810-2904832 AGGAAGCAGGAGAGGCCCCGGGG + Intronic
1077516423 11:3004573-3004595 CAGCAGGATGAGAGGCACCTGGG - Intronic
1077538206 11:3134507-3134529 CAGCAGGAGGAGGGGCTGGGGGG - Intronic
1078013381 11:7591738-7591760 CAGCCAGAGGACAGGCCCAGGGG - Intronic
1078068456 11:8093271-8093293 CAGCAGGAGCAAGGGCCCTGTGG + Intronic
1078087842 11:8244842-8244864 CAGAAGGTGGAGAGTCCCCTGGG - Intronic
1078131383 11:8616936-8616958 AAGCAGGAGGAGAGGCCCAGAGG + Exonic
1078162945 11:8857634-8857656 CAGCATGAGCAAAGGCCCAGAGG - Intronic
1078458804 11:11497076-11497098 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1079056006 11:17207523-17207545 CAGAAGGAGGGCAGGCCCCCCGG - Intronic
1079081157 11:17414594-17414616 TTCCAGGAAGAGAGGCCCCGTGG - Exonic
1079116168 11:17641865-17641887 CAGCAGGCAGCGAGGTCCCGCGG - Exonic
1079121138 11:17686037-17686059 CAGTAGGAGGAGAGAGACCGGGG + Intergenic
1079129413 11:17738611-17738633 CAGTGGGAGGAGAGGGCCAGGGG - Intronic
1079141387 11:17812339-17812361 CAGCAGGAGGGGAGGCCCATGGG - Intronic
1079365412 11:19804905-19804927 CTGCAGGAGTAAAGGCCCAGAGG + Intronic
1081620192 11:44614825-44614847 CAGCAGGTGCAAAGGCCCCAAGG + Intronic
1081634813 11:44714076-44714098 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1081706373 11:45184148-45184170 CAGCAAGAGCAAAGGCCCTGTGG + Intronic
1081744225 11:45461805-45461827 CAGCAGGTGGGGAGGCAACGAGG + Intergenic
1081754404 11:45534473-45534495 CAGCACGGGGAGAGGCACGGAGG - Intergenic
1081796043 11:45820650-45820672 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1081986824 11:47311154-47311176 CAGAAGGAGGAGAAACCCAGTGG - Intronic
1082821688 11:57548279-57548301 CAGCAGGTGCAAGGGCCCCGAGG - Intronic
1083356312 11:62068910-62068932 CAGTAGGAGCAAAGGCCCCGAGG + Intergenic
1083755139 11:64788263-64788285 CAGCTGGAGCAAAGGCCCCATGG - Intergenic
1083935121 11:65865963-65865985 CTGCAGGAAGAGAGGCAGCGAGG - Intronic
1084195335 11:67521279-67521301 CAGCACGTGCAAAGGCCCCGAGG - Intronic
1084288807 11:68148553-68148575 TGGAAGGAGGAGAGGCCCGGGGG + Intergenic
1084368615 11:68721286-68721308 CAGCAGGTGCAAAGGCCCTGTGG - Intronic
1084671400 11:70608660-70608682 AAGCAGGGAGAGAGGCCCTGAGG - Intronic
1084691942 11:70732638-70732660 CAGCAGGTGCAAAGGCCCCATGG - Intronic
1084782058 11:71416551-71416573 TTGGAGGAGGAGAGGCCACGTGG + Intergenic
1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG + Intronic
1085282986 11:75342795-75342817 CAGCAGGAACAAAGGCCCTGAGG + Intronic
1085319474 11:75565168-75565190 CAGCAGTAGCAGTGGCCCCAAGG - Intronic
1085456519 11:76668549-76668571 CTGCAGGAGCAAAGGCCCTGTGG - Intronic
1085461379 11:76695932-76695954 CAGCAGGTGCAGAGGCACAGAGG + Intergenic
1087092104 11:94284205-94284227 GGGCAGGAGAAGAGGCCCCAAGG + Intergenic
1088484901 11:110331055-110331077 AAGCTGGAGGTGAGGCCTCGTGG - Intergenic
1088599441 11:111462025-111462047 GAGCAGCAGGTGAGGCCCAGAGG + Intergenic
1089201702 11:116728462-116728484 CAGCACGCGCAGAGGCCCGGAGG - Intergenic
1089426729 11:118383304-118383326 CAGCAGGCGGACAGGCACAGTGG + Intronic
1089608964 11:119658816-119658838 CAGCAGGAGGGGAGGAACCCAGG - Intronic
1089617893 11:119705538-119705560 CAGCAGGTGCAAAGGCCCCGTGG + Intronic
1089646657 11:119884811-119884833 CAGCAAGTGCAAAGGCCCCGAGG - Intergenic
1089757076 11:120695116-120695138 CAGCAGGAGGAGAGGGCTGGGGG - Intronic
1090185719 11:124738067-124738089 CAGCAGGAAGAAGGGCCCAGAGG + Intergenic
1090298093 11:125608263-125608285 CAGCATGAGGAGAGCTCCCACGG - Exonic
1090325905 11:125886513-125886535 AAGCAAGAGGAGAGGCCCTCAGG - Intronic
1090832342 11:130428242-130428264 CAGCAGGAGCGGAGGCCACCGGG + Exonic
1090884131 11:130861467-130861489 CGGCCGGAGCAGAGGCCGCGCGG - Intergenic
1091307184 11:134543792-134543814 CAGCATGTGCAAAGGCCCCGGGG - Intergenic
1091333981 11:134753080-134753102 CAGCAGCAGCAGAGGCCCCACGG + Intergenic
1091354037 11:134922004-134922026 CACCATGAGGAGAGGCTCCTAGG - Intergenic
1091581588 12:1793697-1793719 CAGCAGGAGTAGGGGCGGCGAGG + Exonic
1092045631 12:5430463-5430485 CCGCAGGAGGTGACGCCCCTGGG + Intergenic
1093959894 12:25260676-25260698 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1094000587 12:25690060-25690082 GAACTGGAGGAGAGGCCCCCTGG - Intergenic
1095947587 12:47762364-47762386 GAGCAGGAGGAGAGGCCTCCTGG - Intronic
1096237540 12:49939933-49939955 CTGCAGGAGGAGGAGCCCCAGGG - Intergenic
1096482444 12:51951659-51951681 CGGGAGGAGGGGAGGCGCCGGGG + Intronic
1098046311 12:66404528-66404550 GAGCAGGAGCAGAAGCCCAGAGG - Intronic
1098500515 12:71187023-71187045 AAGCAGCAGGAGAAGCCCTGTGG + Intronic
1099182793 12:79486842-79486864 CAGCAGGTGCAAAGGTCCCGAGG - Intergenic
1100863599 12:98832575-98832597 GAGCAGGGGTAGAGGCCCCAAGG - Intronic
1101431187 12:104628712-104628734 CAGCAGGTGCAAAGGCCCGGTGG - Intronic
1102100332 12:110273431-110273453 CAGCCTGAGGAGAGGTCCCAAGG + Intergenic
1102466133 12:113131779-113131801 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1102477455 12:113197876-113197898 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1102587196 12:113931698-113931720 CAGCAGGTGCAAAGGCCCTGTGG - Intronic
1102774331 12:115505584-115505606 GAGCAGGTGCAAAGGCCCCGAGG - Intergenic
1103830524 12:123775587-123775609 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1103888639 12:124221874-124221896 CAGCAAGTGCAGAGGCCCTGAGG - Intronic
1103932396 12:124457688-124457710 GAGGAGGCGGGGAGGCCCCGGGG - Intronic
1103937557 12:124484614-124484636 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1103941267 12:124502545-124502567 CAGCAGGTGCAAAGGCCCAGAGG + Intronic
1103968466 12:124654872-124654894 CAGCAGGTGCAAAAGCCCCGAGG - Intergenic
1104005587 12:124890035-124890057 CAGCAGGAGGTGGGGTCCCTGGG - Intergenic
1104034845 12:125091179-125091201 CAGAGGGAGGAGAGCCCACGGGG + Intronic
1104051331 12:125195813-125195835 CAGCAGGTGTAAAGGCCCTGAGG + Intronic
1104647604 12:130508453-130508475 CAGCAGGTGCAGGGGCCCCGGGG - Intronic
1104738862 12:131157967-131157989 CAGCATGTGCAAAGGCCCCGAGG - Intergenic
1104743654 12:131196395-131196417 CAGCAGGAGCAAAGGCGCTGGGG - Intergenic
1105800972 13:23903315-23903337 GAGCAGGAGCAGAGGCCACGCGG + Intergenic
1106717945 13:32410265-32410287 CAGAAGGATGACAGGCCCTGCGG - Intronic
1107880654 13:44829445-44829467 CAGTAGGAGGGAAGGCCCAGGGG - Intergenic
1108518359 13:51222892-51222914 CTACAGGAGGAAAGTCCCCGAGG - Intronic
1108637637 13:52351545-52351567 CAGCATGTGCAGAGGCCCTGAGG + Intergenic
1108747470 13:53409656-53409678 CTGCAGGAGGAGTGGCTCCCTGG + Intergenic
1109610772 13:64762226-64762248 CTGCAAGAGGCCAGGCCCCGTGG - Intergenic
1111995281 13:95159507-95159529 CAGCATGAGGAGAAGCCCACAGG + Intronic
1113373946 13:109746471-109746493 CAGCAGGTGCAAAGGCCCCGGGG - Intergenic
1113414374 13:110116902-110116924 CAGCAGGGAGAGAGGCTCAGAGG + Intergenic
1113777813 13:112958708-112958730 CTGCATGAGGAGAGGCCCCAGGG - Intronic
1113910311 13:113838482-113838504 GAGCAGGAGGAGGGGACCCCGGG + Intronic
1113910374 13:113838644-113838666 CAGCAGGAGGAAGGGACCCCGGG + Intronic
1113949496 13:114064205-114064227 CTGCAGGAGCAGAGGCTGCGAGG + Intronic
1114631768 14:24163875-24163897 CAGGAGGAGGAGGGGGCCAGTGG + Exonic
1115053093 14:29089094-29089116 TATCAGGTGGAGAGGTCCCGAGG - Intergenic
1115819454 14:37198197-37198219 GAGAAGGAGAAGGGGCCCCGCGG + Intronic
1116661558 14:47717095-47717117 CAGGAGGAGGACAGGCTCCTGGG - Intergenic
1118400851 14:65378312-65378334 CACCAGGAGCAGAGGGCCAGTGG + Intergenic
1118890442 14:69903938-69903960 CTGGAGGAGGAGAGGTCACGTGG + Intronic
1119099722 14:71868768-71868790 CAGTAGGACGAGAGGCCAAGGGG - Intergenic
1120298550 14:82676701-82676723 CTGCAGGAGGAGAGGCCATGTGG + Intergenic
1121014047 14:90537623-90537645 CAGCAGGTGCAAAGGCCCAGAGG - Exonic
1121274501 14:92658328-92658350 CCGCAGGAGCAAAGGCCCCGGGG + Intronic
1121587447 14:95072020-95072042 CTGCTGGAGGCGGGGCCCCGGGG + Intergenic
1121960081 14:98251488-98251510 CAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1122113266 14:99515837-99515859 CAGCAAGCTGAGAGGCCCGGGGG + Intronic
1122341519 14:101031430-101031452 GAGCCGGAGAAGAGCCCCCGGGG - Intergenic
1122475953 14:102009105-102009127 CAGCTGTCGGAGAGGCCCCAGGG + Intronic
1122643253 14:103174847-103174869 CAGCAGGAAGAGAGGACTCTGGG + Intergenic
1122659922 14:103288235-103288257 CAGCCCCAGGAGATGCCCCGAGG - Intergenic
1122685895 14:103506148-103506170 CAGCACGGGGAGAGGCCCCGGGG + Intergenic
1122695144 14:103548783-103548805 CAGCAGGAGCAGAGCCCAGGGGG - Intergenic
1122779809 14:104138845-104138867 CAGCAGGAGGCCCGGCCCCCAGG - Intronic
1122826846 14:104374697-104374719 GCCCAGGAGGAGAGGCCCCTGGG + Intergenic
1122885526 14:104708763-104708785 CAGGTGGAGGCGAGGCTCCGTGG - Intronic
1122904316 14:104795094-104795116 CAGCCGGCGGAGGTGCCCCGGGG - Intronic
1123040694 14:105489097-105489119 CAGCAGGCCGAGAGGCCTGGGGG + Intronic
1123987664 15:25659366-25659388 CTGCAGGAGTAGAGGCTCCTGGG - Intergenic
1124221506 15:27853807-27853829 CAGCAGGAGGAGAGCACCAATGG + Intronic
1124291238 15:28455659-28455681 CAGGAGAAGGAGAGGCGCCAGGG - Intergenic
1124341148 15:28889712-28889734 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1124373279 15:29115403-29115425 CAGGAGGAGGAGGGGCCAGGCGG + Intronic
1124492309 15:30165537-30165559 CAGCATGTGCAAAGGCCCCGAGG - Intergenic
1124721122 15:32111501-32111523 CTGCAGGAGGAGAAGGCTCGGGG + Intronic
1124751226 15:32372780-32372802 CAGCATGTGCAAAGGCCCCGAGG + Intergenic
1125469711 15:39990894-39990916 CAGCATAAGCAGAGGCCCCGGGG + Intronic
1125814891 15:42575754-42575776 CAGCAAGAGGTGAGTCTCCGCGG + Exonic
1127281460 15:57497064-57497086 CAGCAGGATGTGGGGCCTCGGGG - Intronic
1127458798 15:59179133-59179155 GAGCAGGGGCAGAGGCGCCGAGG - Intronic
1127983830 15:64053002-64053024 CAGCAGCAGGCGAGGCCTCCTGG + Intronic
1128183373 15:65624210-65624232 CACAATGAGGAAAGGCCCCGGGG - Exonic
1128249037 15:66152045-66152067 AAGTAGGAGGAGAGGCGCCGAGG - Intronic
1129320809 15:74773650-74773672 AAGCAGGAAAAGAGGCCCTGGGG - Intergenic
1129470684 15:75751778-75751800 CAGCAGGAGGCCAGGGCCCTGGG + Intergenic
1129605246 15:77021777-77021799 CAGCAGGAGCAAAGGCCCAGAGG - Intronic
1129683054 15:77669137-77669159 CAGCAGAGGCAGAGGCCCAGTGG - Intronic
1129774692 15:78228803-78228825 CAGCATGTGCAAAGGCCCCGAGG - Intronic
1130053356 15:80502460-80502482 CAGGAGGAGGAGAGACCCAGAGG + Intronic
1130094241 15:80844270-80844292 GCGCAGGCAGAGAGGCCCCGAGG - Intronic
1130174167 15:81550233-81550255 CAGCAGCAGGAGGGGGCCTGTGG + Intergenic
1130334375 15:82946477-82946499 CAGCAGGTGTAAAGGCCCTGAGG - Intronic
1130994739 15:88897509-88897531 CAGCAGGAGGTGGGGCCACAGGG - Intergenic
1131047342 15:89324510-89324532 CAGCGGGAGGACAGGACCCAAGG + Intronic
1131171947 15:90185022-90185044 CTCCAGGAAGAGCGGCCCCGCGG + Intronic
1132579283 16:677723-677745 CTGCAGGCTGAGAGGCCCCCCGG - Intronic
1132582887 16:693612-693634 AAGGAGGAGGAGAGGCCGCGTGG + Exonic
1132651641 16:1023849-1023871 CAGCAGGAGGAGGGCCCTCGGGG + Intergenic
1132872409 16:2121796-2121818 TGGCAGGAGGTGAGGCCTCGGGG - Intronic
1132884889 16:2178325-2178347 CAGCAGGTGGGGAGGACCCGCGG + Exonic
1133316088 16:4884979-4885001 CCTCAGGAGGCGAGGCCCCCAGG - Exonic
1133400926 16:5486369-5486391 GAGCAAGAGGAGAGGAGCCGAGG + Intergenic
1133638762 16:7696876-7696898 CAGCAGGTGCAGAGACCCTGTGG + Intronic
1133743936 16:8673591-8673613 CAGCAGGAGGAGAGACCTCAGGG + Intergenic
1133815875 16:9196998-9197020 CAGCATGAGCAAAGGCCCCAGGG + Intergenic
1133989164 16:10691518-10691540 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1134036131 16:11032755-11032777 CAGCATGTACAGAGGCCCCGGGG + Intronic
1134084291 16:11345881-11345903 CCGCAGGGGCAGAGGCCCGGAGG - Intronic
1134104467 16:11476071-11476093 CAGCAGGTGCAAAGGCCCTGGGG + Intronic
1134107116 16:11493087-11493109 CAGGAGCAGGTGAGGCCCAGAGG + Intronic
1134174831 16:11997241-11997263 CAGCAAGGGGAGAGGCTCGGAGG - Intronic
1134777992 16:16869580-16869602 CAGAAGGAAGAGAGACCCCCTGG - Intergenic
1134791891 16:16996673-16996695 CAGCAGGTGCAAAGGCCCCTGGG + Intergenic
1135164262 16:20124771-20124793 CAGCACGTGCAAAGGCCCCGAGG - Intergenic
1135641318 16:24122213-24122235 CAGCAGGTGCAAAGGCCCTGGGG + Intronic
1135641452 16:24123254-24123276 CAGCAGGTGCAAAGGCCCTGTGG + Intronic
1135913949 16:26586735-26586757 CAGCAGGGGCAAAGGCCCTGGGG + Intergenic
1136061064 16:27726803-27726825 CAGCAGGAGCAAAGGCCCTGCGG + Intronic
1136089963 16:27911624-27911646 CAGCAGGTGCACAGGCCCTGAGG - Intronic
1136614994 16:31393236-31393258 CAGCAGGAAGAGGGGCACAGTGG - Intergenic
1138337663 16:56265956-56265978 CAGCAAGAGCAAAGGCCCCGGGG - Intronic
1138573697 16:57892744-57892766 CAGCATGTGCAGAGGCCCTGGGG - Intronic
1138606663 16:58094230-58094252 CAGCATGTGCAGAGGCCCTGGGG - Intergenic
1139449143 16:67016321-67016343 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
1139450452 16:67024849-67024871 CAGAAGGGGGAGATGCCCCTGGG + Intergenic
1140412947 16:74752476-74752498 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1141108780 16:81255029-81255051 CAGCAGTTTGAGAGGCCCAGAGG - Intronic
1141376439 16:83535183-83535205 CAGCATGTGCAGAGGCCCTGGGG + Intronic
1141440225 16:84025337-84025359 CAGCAGTAGCAAAGGCCCTGAGG - Intronic
1141462107 16:84183710-84183732 CAGCATGGGGAGAGGCCCAGGGG + Exonic
1141590826 16:85067446-85067468 GAGCAGGAGGCGAGTCCCCTTGG - Intronic
1141619257 16:85228106-85228128 CAGCACGGGCAGAGGCCCCGAGG + Intergenic
1141661113 16:85442083-85442105 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1141674576 16:85510824-85510846 CGGCAGGTGCAGAGGCCCTGAGG - Intergenic
1141797797 16:86286626-86286648 CAGCGGGAGGAGGGGCCGCAGGG + Intergenic
1142338238 16:89504232-89504254 CAGCAGGAGGAGTCGCCGTGGGG + Intronic
1142490850 17:278495-278517 CAGCAGGTGCAAAGGCCCCGAGG - Intronic
1142690670 17:1604726-1604748 CAGCAGGAGGTGAGGGCAGGGGG - Intronic
1142744675 17:1949935-1949957 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1142850547 17:2702599-2702621 CAACAGGCGGACAGGCCCTGGGG + Intronic
1142903503 17:3027497-3027519 CAGCATGTGGAAAGGCCCAGAGG + Intronic
1143011951 17:3870836-3870858 TAGCAGGAAGAGAGGCACCAGGG + Intronic
1143337926 17:6187418-6187440 CTGCAGGAGGAGAGGCCCTGTGG - Intergenic
1143683361 17:8494147-8494169 ACGCAGGAGGGGAGGCCTCGGGG - Intronic
1143946804 17:10600260-10600282 CAGCAAGTGCAGAGGCCCTGGGG + Intergenic
1144779053 17:17798815-17798837 CAGCATGGGGAGGGGCCCAGTGG - Intronic
1144784109 17:17822515-17822537 CAGCTGGGGGAGAGGGCCCTTGG - Intronic
1144825421 17:18103101-18103123 CAGCAGGAGGAGAGGACCTGAGG - Intronic
1145191311 17:20843435-20843457 CAGGAGGAGGAAAGGCGCCAGGG + Intronic
1145236299 17:21210581-21210603 CAGATGGAGCACAGGCCCCGGGG - Intronic
1145795387 17:27652552-27652574 CAGCAGGTACAAAGGCCCCGGGG - Intergenic
1145809821 17:27757883-27757905 CAGCAGGTACAAAGGCCCCGGGG - Intronic
1145811003 17:27764198-27764220 CAGCAGGTAGCGAGGCCCCCAGG + Intronic
1145863771 17:28227526-28227548 CCGCAGGGGGAGAGCCCCAGGGG - Intergenic
1146163076 17:30570342-30570364 GGGCAGGAAGAGAGGCCCCCAGG - Intergenic
1146281003 17:31544465-31544487 CTGAAGGTTGAGAGGCCCCGAGG - Intergenic
1146803488 17:35845772-35845794 CAGCAGGTGGACAGGCACAGTGG - Intronic
1147345237 17:39787950-39787972 CAGCAAGAGCAAAGGCCCTGGGG - Intronic
1147586936 17:41658214-41658236 CAGCAGGAGGGTCGGCCCTGGGG + Intergenic
1147910638 17:43853937-43853959 CTGCAGGAGGAGAGGTCGCTGGG - Exonic
1148198126 17:45729437-45729459 CAGCAGGAGGAAAGCCAACGTGG + Intergenic
1148683469 17:49487535-49487557 GAGCAGGAGCAGAGGCCATGTGG + Intergenic
1148910308 17:50938993-50939015 CAGCAGGTGCAAAGGCCCCAAGG + Intergenic
1148910658 17:50940644-50940666 CAGCAAGTGCAGAGGCCCTGTGG - Intergenic
1149280421 17:55098582-55098604 CAGCAAGTGGAAAGGCCCTGAGG + Intronic
1149447003 17:56720955-56720977 CAGCAGAGGTAGAGGCCCCCCGG + Intergenic
1150428179 17:65093872-65093894 CAGAAGGAGGCCAGGCGCCGTGG - Intergenic
1151321008 17:73352381-73352403 CGGAAGGAGGAGAGGCACCAGGG - Intronic
1151453273 17:74212233-74212255 GGCCACGAGGAGAGGCCCCGAGG + Intergenic
1151524908 17:74658401-74658423 CAGGAGGAGGAGACGCCAAGGGG - Intergenic
1151568632 17:74915010-74915032 CAGCAGGATGAGGGGCTCCATGG - Intergenic
1151581090 17:74979455-74979477 TAGCAGGAAGAGAGGCACCAAGG - Intergenic
1152417016 17:80169251-80169273 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1152463598 17:80454006-80454028 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1152551690 17:81033599-81033621 CAGCCGGAGGAGAGGAGGCGCGG + Intergenic
1152630317 17:81408074-81408096 CAGCAGGAGGAAGGGGGCCGGGG - Intronic
1152679201 17:81656937-81656959 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1152813779 17:82394994-82395016 CAGCAAGGGGAGAGGCCGTGGGG - Intronic
1153171471 18:2320836-2320858 CAATAGGTGGAGAGGCCCTGAGG + Intergenic
1154343260 18:13522257-13522279 TAGCAGGAGGAGAGGTCCTTTGG - Intronic
1155071774 18:22323149-22323171 CAGGAGGAGGAGAGGGCTGGGGG + Intergenic
1156192699 18:34738108-34738130 CAGCAGAAGCAAAGGCCCTGAGG + Intronic
1156242618 18:35268071-35268093 CAGCAGGAGGAGGAGCGCCACGG + Intronic
1156498506 18:37541736-37541758 CAGCAGGTGCAAAGGCCCGGAGG - Intronic
1156899868 18:42288102-42288124 CAGAAGGAGGCTAGGCCCAGTGG - Intergenic
1157414314 18:47489391-47489413 GAGCAGGAGGGGAGCCCCCAAGG - Intergenic
1158330703 18:56358987-56359009 GAGCTGGAGGAGAGGCCCAGTGG + Intergenic
1160864593 19:1251151-1251173 CGGCCCGAGGAGAGGCCCTGGGG - Intronic
1160907772 19:1459897-1459919 CAACAGGTGCAGAGGCCCAGTGG + Intronic
1160927660 19:1554617-1554639 CACCAGGAGGGGAGACCCCGGGG - Intergenic
1160994889 19:1877987-1878009 CAGGAGGAGGAGAGGCGCCAGGG - Intronic
1161016863 19:1987527-1987549 CAGCAGGTGGAGAGTCGCTGGGG - Exonic
1161393514 19:4033196-4033218 CGGCCGCAGGAGAGGCCTCGAGG - Intronic
1161622114 19:5303528-5303550 CAGCACGTGTAAAGGCCCCGAGG + Intronic
1161659291 19:5536260-5536282 CGGCAGGAGCAGAGGCTCCGAGG + Intergenic
1161795050 19:6381553-6381575 CAGCAGGAGGAGGGGCCCAAGGG - Exonic
1162080378 19:8214445-8214467 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1162085636 19:8247338-8247360 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1162101883 19:8343638-8343660 CAGCATGTGCAGAGGCCCTGCGG - Intronic
1162360710 19:10218535-10218557 CAGCAGGTGCAAAGGCCCTGGGG + Intronic
1162733746 19:12734398-12734420 CGGCAGGAGGAGCCGCCCCCGGG - Exonic
1163186259 19:15641465-15641487 CAGCAGCAGGAGCAGCCACGGGG - Exonic
1163218453 19:15897540-15897562 CAGCAGGAGGAGCAGCCAAGGGG + Exonic
1163438896 19:17311656-17311678 CAGCAGGTGTAAAGGCCCTGGGG - Intronic
1163520167 19:17787468-17787490 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1163679878 19:18675069-18675091 CAGCAGGAGGCAAGAACCCGTGG - Intergenic
1163703510 19:18798995-18799017 CAGCAGGGGCAAAGGCCCAGAGG + Intergenic
1164402139 19:27909847-27909869 CAGCGGGAGGAGGCGGCCCGCGG - Intergenic
1164558918 19:29275190-29275212 TAGCAGGAGTAGAGGCCTCCTGG - Intergenic
1164658156 19:29939774-29939796 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1164712429 19:30366985-30367007 CAGCAGGTGTAAAGGCCCCAGGG + Intronic
1165309136 19:35020015-35020037 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1165334804 19:35162245-35162267 GAGGAGGAAGAGAGGCCCTGGGG - Intronic
1165394346 19:35556202-35556224 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1165862672 19:38917466-38917488 CAGCAGGAGGAAAGGGGCCCGGG + Intronic
1165895052 19:39136421-39136443 CAGCAAGAACAAAGGCCCCGGGG - Intronic
1165996616 19:39848469-39848491 CTCCAGGAGGACAGGACCCGGGG - Intergenic
1166563697 19:43750293-43750315 CAGCAAGCGCAGAGGCCCTGAGG - Intronic
1166643878 19:44516891-44516913 CAGCATCAGGAAAGGCCCCTCGG + Intronic
1166813689 19:45528846-45528868 CAGGAGGCGGAGAGTCCCAGTGG + Exonic
1166817712 19:45556900-45556922 CAGCAGGTGGCGGAGCCCCGGGG - Intronic
1166918288 19:46211157-46211179 AGGCTGGAGGAGAGGCCCCAGGG - Intergenic
1166920527 19:46226381-46226403 GGGCTGGAGGAGAGGCCCCAGGG - Intergenic
1166939353 19:46353438-46353460 GAGCAGGTGCAGAGGCCCAGAGG - Intronic
1167041637 19:47026325-47026347 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1167297720 19:48661726-48661748 CAGCAGGAGGAGCGCGCCGGAGG - Exonic
1167606222 19:50482293-50482315 CAGCAGAAAGGGAGGCCCCTGGG - Exonic
1167607879 19:50491232-50491254 CTGCAGCTGCAGAGGCCCCGAGG - Intergenic
1167640060 19:50676429-50676451 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1167726835 19:51220496-51220518 CAGAAGGAGGCGAGGCCATGTGG - Intergenic
1167743910 19:51340115-51340137 CAGCAGGAGGCGCGACCCCGCGG + Exonic
1167960016 19:53097906-53097928 CAGCAGGAGGATGGGCGCCTTGG - Intronic
1168073549 19:53965918-53965940 TAGCAGGCGCAGAGGCCCTGAGG + Intronic
1168076621 19:53983781-53983803 CAGCACGTGCAAAGGCCCCGGGG + Exonic
1168324070 19:55529451-55529473 CAGCAAGTGCAGAGGCCCTGGGG + Intergenic
1168344264 19:55642710-55642732 CAGCTGGAGGAGGAGCCCCGGGG + Exonic
1168651537 19:58095559-58095581 GAGCAGGAGGAGAGGGGCTGGGG - Intronic
925027303 2:620190-620212 CCGCAGGAGGAGACGCTCTGCGG + Intergenic
925209185 2:2032551-2032573 CCGCAGGATGAGAGGCACTGGGG - Intronic
926121494 2:10243480-10243502 CATCAGGAGGGGAGGGCCCGAGG + Intergenic
926196449 2:10766214-10766236 CAGCAGGGGCAGAGGCTCCGGGG + Intronic
926207468 2:10844268-10844290 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
926218451 2:10919836-10919858 CAGCCCCAGGAGAGGCCCCACGG + Intergenic
926251839 2:11159305-11159327 TGGCAGGAGGAGAGTCCCTGCGG + Intronic
926796475 2:16623523-16623545 CAGTAGGAGGAGAGGTCCTTTGG - Intronic
927193701 2:20533813-20533835 TAGCAGGAGGAGAAGTCCCTGGG - Intergenic
928021499 2:27708552-27708574 CAGCAGGAACAAAGGCCCCGGGG - Intronic
928407328 2:31024493-31024515 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
929660000 2:43774474-43774496 CACCAGGAGGGGAGGCCCCTGGG - Intronic
930092102 2:47538428-47538450 CAGCACGAGCAAAGGCCCTGAGG + Intronic
930124167 2:47783344-47783366 CTGGGGAAGGAGAGGCCCCGGGG - Exonic
931196388 2:60055874-60055896 CAGCAGGTGTAAAGGCCCTGAGG + Intergenic
931201395 2:60100668-60100690 CAGAAGGAGGAGAGGGCACATGG + Intergenic
932271934 2:70418678-70418700 TTGCTGGAGGAGAGGCCTCGTGG - Intergenic
934555543 2:95285271-95285293 TGGCAGGAGGACAGGCCCAGGGG - Intronic
935199045 2:100840077-100840099 CAGTATGAGCAAAGGCCCCGGGG - Intronic
935329125 2:101963359-101963381 GAGTGGGAGGAGAGGCCCCCGGG - Intergenic
935344563 2:102093892-102093914 CTGCAGGAGGACTGGTCCCGCGG - Intronic
936061596 2:109298568-109298590 CTGCAGGAGGATGAGCCCCGGGG + Intronic
936433044 2:112481318-112481340 CAGGAAGGGGAGAGGCCCCAGGG + Intergenic
936525706 2:113240222-113240244 CAGCATGGGGAGAGGGCCTGGGG - Intronic
937072160 2:119072771-119072793 CAGCAGGTGCACAGGCCCTGAGG - Intergenic
937829033 2:126399853-126399875 AAGCAGCAGGAGAATCCCCGTGG - Intergenic
938090309 2:128426833-128426855 CAGCAGGAGGAGAGGATGGGGGG + Intergenic
938140795 2:128793422-128793444 GAGAAGGAGGACAGGCCACGTGG + Intergenic
938316607 2:130333660-130333682 CAGGAGAAGGAGAGGACACGTGG + Intergenic
938317130 2:130337634-130337656 CAGGAGGAGGTGCGACCCCGTGG - Intergenic
938377572 2:130818909-130818931 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
938392308 2:130915802-130915824 AAGCAGGCGGCGAGGCCTCGAGG + Intronic
938462947 2:131509771-131509793 CTGCGGGAGGAGCGGGCCCGGGG - Intergenic
940328471 2:152450700-152450722 CAGCAGGAGGAGATGCCACATGG - Intronic
941029259 2:160493241-160493263 CGGCCGGAGGAGGGGGCCCGGGG - Intronic
942302305 2:174573649-174573671 CAGCAGGTGCAGAGGCCCTGAGG + Intronic
946146585 2:217735585-217735607 CAGCAGGAGCAAAGGCCCTGAGG - Intronic
946162312 2:217842821-217842843 CAACAAGTGCAGAGGCCCCGAGG - Intronic
946166536 2:217867723-217867745 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
947321362 2:228922769-228922791 CAGCAGGAGGTGAGCCACTGTGG - Intronic
947933695 2:233985169-233985191 CAGCATGGGCAAAGGCCCCGTGG - Intronic
948290633 2:236821718-236821740 AAGCAGGAGGAGAGGCTCATGGG - Intergenic
948506948 2:238434935-238434957 CAGCTGGCGGAGGAGCCCCGAGG + Intronic
948677087 2:239603014-239603036 GGGCAGGGGCAGAGGCCCCGTGG + Intergenic
948803597 2:240443633-240443655 CAGTGGGAGGTGAGGCCCAGCGG + Intronic
1168761514 20:353220-353242 CAGCAGAAGCAGGGTCCCCGAGG - Exonic
1168876378 20:1174851-1174873 CAGCATGAGCAGAGGCTCAGAGG - Intronic
1168908411 20:1425415-1425437 CAGCAAGTGCAGAGGCCCTGGGG - Intergenic
1169118915 20:3083816-3083838 CAGGAGGAAGAGAGGCTGCGGGG + Intronic
1170456984 20:16542617-16542639 CAGCAGGTGTAAAGGCCCTGAGG + Intronic
1170572462 20:17640349-17640371 GAGCAAGAGGAGAGCCCCAGAGG + Intronic
1170663451 20:18364358-18364380 CTGCAAGAGGAGAGGTCACGTGG + Intergenic
1170846849 20:19969378-19969400 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1170871817 20:20212982-20213004 CATCAGGAGGAGAGCCCGGGAGG + Intronic
1171067022 20:22027125-22027147 AAGCAGCAGGAAAAGCCCCGTGG - Intergenic
1171100537 20:22379625-22379647 CTGGAGGATGAGAGGCCCTGGGG - Intergenic
1171457202 20:25278779-25278801 CAGCCGGAGGGGAGGAGCCGTGG - Intronic
1172114673 20:32566593-32566615 CAGCAAGTGCAAAGGCCCCGAGG - Intronic
1172192112 20:33068445-33068467 CAGCTGGAGGAGCAGCCACGTGG + Intronic
1172288521 20:33758318-33758340 CAGCAGGTGCAAAGGCCCGGAGG + Intronic
1172582006 20:36055718-36055740 CAGCATGTGGAAAGGCCCTGAGG - Intergenic
1172767333 20:37357870-37357892 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1172831375 20:37838131-37838153 CAGCAAGTGCAGAAGCCCCGAGG + Intronic
1172938832 20:38640731-38640753 CAGCAAGTGCAGAGGCCCCAGGG - Intronic
1172962771 20:38810188-38810210 CAGCATGTGCAGAGGCACCGAGG + Intronic
1173817266 20:45997813-45997835 AAGCTGGAGGAGGGGCCCAGAGG + Intergenic
1173850367 20:46214121-46214143 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1173857937 20:46262879-46262901 GAGCAGGAGCAAAGGCCCAGAGG - Intronic
1173919434 20:46732895-46732917 CAGCAAGAGCAAAGGCCCGGAGG + Intronic
1173920208 20:46738802-46738824 CAGCACGTGCAGAGGCCCCAAGG + Intergenic
1173923087 20:46760563-46760585 CAGCAGGTGCAAAGGCCCCCAGG + Intergenic
1173943907 20:46934771-46934793 CAGCATGAGCAAAGGCCCAGAGG + Intronic
1174082122 20:47977973-47977995 CAGCAGGAGGGGTGACCCGGTGG + Intergenic
1174082795 20:47983021-47983043 CAGCAGGTGCACAGGCCCCGGGG + Intergenic
1174087375 20:48018766-48018788 CAGCAGGTGCACAGGCCCTGGGG - Intergenic
1174128913 20:48328204-48328226 CAGCAGGTGCACAGGCCCTGGGG + Intergenic
1174133160 20:48359961-48359983 CAGCAGGTGCACAGGCCCCGGGG - Intergenic
1174194149 20:48761178-48761200 CAGCCGGGGCAAAGGCCCCGAGG + Intronic
1174295702 20:49543595-49543617 CAGCAGGTGCAAAGGCCCAGAGG - Intronic
1174317624 20:49714582-49714604 CAGCAGGTGTAAAGGCCCTGAGG + Intergenic
1174478025 20:50811059-50811081 CAGCAGGTGCAAAGGCCCTGCGG + Intronic
1174514824 20:51083643-51083665 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1174557622 20:51407067-51407089 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1175097546 20:56553391-56553413 CACCAGGAGGAGGGGCTCCTGGG + Intergenic
1175379193 20:58551016-58551038 GAGCTGGAGGACAGGCACCGGGG + Intergenic
1175503828 20:59468349-59468371 AGGCAGGAGGAGAGGGCCCCAGG + Intergenic
1175523830 20:59619932-59619954 CCGCAGGAGGAGTGGCCTGGAGG + Intronic
1175540278 20:59743801-59743823 CAGGAAGAAGAGAGGCCCAGAGG - Intronic
1175741499 20:61422851-61422873 CAGCAGCAGGAGAAGCACTGAGG - Intronic
1175777583 20:61662970-61662992 GGGGAGGAGGAGAGGCCCTGAGG - Intronic
1175808566 20:61845191-61845213 GAGCAGCATGAGGGGCCCCGAGG - Intronic
1175858105 20:62133570-62133592 CAGGAAGAAGAGAGGCCCAGAGG + Intronic
1176031753 20:63016220-63016242 CAGCATGGAGAGAGGCCACGTGG + Intergenic
1176168138 20:63685249-63685271 TGGCGGGAGGAGAGGCCCCTCGG + Intronic
1176191000 20:63809496-63809518 CAGCAGGTGGAGAGGACTCCGGG + Intronic
1176207284 20:63895665-63895687 CCGCAGGAGAGGAGACCCCGGGG - Intronic
1176284655 21:5012941-5012963 GGGCAGGAGGTGAGCCCCCGAGG - Intergenic
1177394082 21:20510831-20510853 CTGCAGGGGCAGAGGCCCCATGG - Intergenic
1177522098 21:22239241-22239263 CAGCAGGAGTGGAGCCCTCGTGG + Intergenic
1178308307 21:31509014-31509036 CAGCAAGAGGTGAGACCCCCTGG + Intronic
1178664379 21:34533878-34533900 CAGCAGGTGTGGAGGCCCTGAGG + Intronic
1178889434 21:36508991-36509013 CAGCAGGAAGAAAGGGCCAGCGG - Intronic
1179540612 21:42081234-42081256 GACCAGGCGAAGAGGCCCCGAGG + Intronic
1179872526 21:44250534-44250556 GGGCAGGAGGTGAGCCCCCGAGG + Intronic
1179950971 21:44708678-44708700 CAGCTGGTGGAGAGACCCCAGGG - Intronic
1179993093 21:44958724-44958746 CAGCTGGAGCAGAGGCCGCCTGG - Intronic
1180127568 21:45802682-45802704 CATGGGGAGGAGAGGCCCTGAGG + Intronic
1180184263 21:46131685-46131707 CAGCAGGTGGACAGGGCCTGGGG + Intronic
1180230956 21:46426570-46426592 TGGCAGGAGGAGAGGCCCTGGGG - Intronic
1180613739 22:17114221-17114243 CAGAGTGAGGGGAGGCCCCGTGG - Exonic
1180617049 22:17135200-17135222 AAGCAGCAGGTGAGGTCCCGGGG + Intergenic
1180740853 22:18052400-18052422 CAGCAGCAGCAGAGGCACCGGGG + Intergenic
1180907700 22:19426406-19426428 CATCAGGAGAAAAGGCCCAGAGG - Intronic
1180956795 22:19744849-19744871 CAGCAGGTGGGCTGGCCCCGGGG - Intergenic
1181047676 22:20223341-20223363 CTGCAGGAGGAGGGGCTCCCGGG - Intergenic
1181120947 22:20668521-20668543 CAGGAGGAGGAGAGGTGCCAGGG - Intergenic
1181333913 22:22115547-22115569 CAGGAGGAGAAGAGGCGCCAGGG - Intergenic
1181461394 22:23088254-23088276 CAGCAGGAGGAAACGCACTGGGG - Intronic
1181524000 22:23468285-23468307 CAGCAGGAGGCCAGGACCAGAGG - Intergenic
1181529892 22:23511472-23511494 CAGCAGGAGGAGAGGGCTCTGGG - Intergenic
1181530318 22:23513618-23513640 CAGCAGAAGCAAAGGCCCAGTGG + Intergenic
1181971722 22:26695666-26695688 CAGCAGGAGCAAAGGCCCTGAGG + Intergenic
1182053003 22:27327649-27327671 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1182356163 22:29723116-29723138 CAACATGAGGGGAGGCCCTGCGG + Intronic
1182718179 22:32376680-32376702 CAGCAGGAGGACAGGAGCCATGG - Intronic
1183076687 22:35431821-35431843 CTGGAGGAGGAGAGGCACAGAGG - Intergenic
1183298098 22:37043937-37043959 CAGCAGGGGCAGAGTCCACGGGG + Intergenic
1183376437 22:37468039-37468061 AAGGAGGAGGAGAGATCCCGAGG - Intergenic
1183587126 22:38759321-38759343 CAGGAGTAGGAGAGGCCTTGGGG - Intronic
1183593274 22:38794054-38794076 CAGGAGCAGGTGAGGCCCCGGGG - Exonic
1183668058 22:39256463-39256485 CAGCCTCAGCAGAGGCCCCGGGG + Intergenic
1183669546 22:39264451-39264473 CAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1183702594 22:39458283-39458305 CAGCAGGAAGGGATGCCGCGCGG + Intronic
1184381410 22:44147064-44147086 CAGCAGGAGCAAAGGCTCTGAGG + Intronic
1184406260 22:44302653-44302675 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406274 22:44302693-44302715 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406288 22:44302733-44302755 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406302 22:44302773-44302795 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406316 22:44302813-44302835 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406330 22:44302853-44302875 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406344 22:44302893-44302915 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184407513 22:44308455-44308477 CAGCATGAGTAAAGGCCCAGAGG - Intronic
1184479744 22:44739315-44739337 GGGCAGGAGGGGAGGCCCCTGGG + Intronic
1184529893 22:45048744-45048766 GAGCAGGGAGAGAGGCCACGAGG - Intergenic
1184539095 22:45107878-45107900 CAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1184744058 22:46445950-46445972 CGGCAGGAGCAGGGGCCGCGAGG - Intronic
1184901232 22:47447858-47447880 CAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1185174173 22:49310535-49310557 CAGCAGGAGCAGAGTCTCCCTGG + Intergenic
1185281064 22:49970119-49970141 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
949150943 3:766261-766283 CACCAGAAGGAGAGGCAGCGTGG + Intergenic
949529043 3:4935534-4935556 CAGCAGGAGCAAAGGCCCAGAGG - Intergenic
950109936 3:10412496-10412518 CAGCAGGAGCAAAGGCCTGGGGG - Intronic
950404285 3:12794987-12795009 CAGCAGGTGCAAAGGTCCCGAGG - Intergenic
950427373 3:12931745-12931767 CAGCAGGTGGATGGGACCCGAGG + Intronic
950566195 3:13771078-13771100 CAGCAGGGGCAAAGGCCCTGAGG - Intergenic
950576397 3:13834624-13834646 CAGCAGGTGCAAAGGCCCAGAGG - Intronic
950796192 3:15512306-15512328 CAGCTGAAGGAGAGGCCTCGTGG - Intronic
951463633 3:22977952-22977974 CAGCAGGAGCTAAGGCCCAGTGG - Intergenic
952961041 3:38589221-38589243 CAGCAAGTGCAAAGGCCCCGAGG - Intronic
953019733 3:39105888-39105910 CAGCTTGTGCAGAGGCCCCGAGG - Intronic
953168695 3:40488099-40488121 CAGCAGGAAGAAAGGCACAGAGG - Exonic
953718433 3:45335336-45335358 GAGCAGGAGCAAAGGCCCTGAGG + Intergenic
954199716 3:49017064-49017086 CAGCAGGTGCAGAGGCTCTGGGG - Intronic
954417448 3:50400275-50400297 CAGCAGCAGCAGAGGCCCACAGG - Intronic
954610400 3:51941976-51941998 CAGTAGGAGGCGGGGCCCGGCGG - Intergenic
954632986 3:52056852-52056874 CTGCGGGAAGAGAGGCCCTGGGG + Intergenic
954635628 3:52069333-52069355 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
954681253 3:52347250-52347272 CAGCATGGGCAGAGGCACCGAGG + Intronic
959715829 3:109431623-109431645 CAGCAGCAGGAAAAGCCCTGTGG - Intergenic
959788411 3:110329054-110329076 CTGCAGGAGAAGAGCCCCCATGG + Intergenic
961171458 3:124800644-124800666 CAGCAGGAGCTGAGACCCAGTGG - Intronic
961517329 3:127446086-127446108 CAGCAGGATGCAAGGCCCTGAGG + Intergenic
961594544 3:128006413-128006435 AGGCGGGAGGAGAGGCCCCCAGG + Intergenic
961652854 3:128425933-128425955 CAGCAGGTGCCAAGGCCCCGAGG + Intergenic
961667844 3:128504658-128504680 CAGCAGGAGGGCAGTCCCCGAGG - Intergenic
962028230 3:131571606-131571628 CAGCAGCAGGAGAGGTACTGTGG - Intronic
962346279 3:134620961-134620983 AAGCTGGAGGAGAGGTCCTGAGG + Intronic
962740616 3:138360554-138360576 CAGCAGGAGGAGTGGCGATGAGG - Intronic
963228805 3:142889209-142889231 CGGCAGGAGGGGCGGCTCCGAGG + Intergenic
964159681 3:153632014-153632036 CAGCAGGTAGAGAGGACCAGTGG + Intergenic
964323869 3:155525974-155525996 CAGCAGGGGGTAAGGCCCAGGGG + Intronic
965619561 3:170629354-170629376 CAGCAGGAGCAAAGGCTCTGAGG + Intronic
967188658 3:186966740-186966762 CCCCAGGAGGTGAGGCCCAGTGG + Intronic
967730985 3:192906485-192906507 CAGCAGGTGTAAAGGCCCTGAGG - Intronic
967856304 3:194120033-194120055 CAGCAGGTGCAGAGGCTCTGAGG - Intergenic
967968724 3:194984125-194984147 CAGCAGGGCGACAGGCCCAGTGG - Intergenic
967984235 3:195083449-195083471 AAGCCTGAGGAGAGGCCCCAGGG - Intronic
968089637 3:195892254-195892276 CAGCCGCAGGAGAGGCCACTTGG + Intronic
968441001 4:624399-624421 CAGCACGAGGCCAGGCCCCGGGG - Intergenic
968506881 4:974811-974833 AAGCCGGAGCAGAGGCCCTGTGG + Intronic
968664626 4:1814392-1814414 CAGCAGGAGGACAGGTGCCCAGG + Exonic
968912832 4:3484665-3484687 CAGCAGCAGGAGGGCCCCCAGGG - Intronic
968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG + Intergenic
969317794 4:6392554-6392576 CAGCACGAGCAAAGGCCCTGAGG + Intronic
969568242 4:7992761-7992783 CAGCAGGAGGAGAGGCCCCGGGG - Intronic
969586672 4:8097874-8097896 CTGCAGGAGGAGAGAGCCTGTGG + Intronic
969632412 4:8346358-8346380 CAGCGGGAGGTGAGGAGCCGCGG + Intergenic
970008949 4:11437612-11437634 CAGCAGTAGGAAAGTCCCCATGG + Intergenic
970404800 4:15752690-15752712 GAGCAGAAGCAAAGGCCCCGTGG + Intergenic
971481361 4:27117618-27117640 CAGCAGCAGAAGAGTCCCAGAGG - Intergenic
973266482 4:48216131-48216153 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
973643991 4:52931950-52931972 CAGCTGCAGCAGAGGCCCCAGGG + Intronic
976356399 4:84122671-84122693 CCGCAGGAGGAGAGGCCCTGAGG - Intergenic
976608030 4:87001084-87001106 CTGTAGGAGGAGAGTCCCCGGGG - Intronic
977660459 4:99579411-99579433 CAGCAAGTGCAAAGGCCCCGAGG - Intronic
977874457 4:102132078-102132100 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
980875611 4:138659234-138659256 TAGCAGGAGCAGAGACCCTGAGG + Intergenic
985085586 4:186309258-186309280 CAGCAGCAGCAGAGGCGCCTGGG - Intergenic
985641540 5:1065584-1065606 CAGCAGGAGGGAAGGCCCGAAGG + Intronic
985669716 5:1201147-1201169 CAGCGGGAGCAGGGGCCCTGGGG - Intergenic
985851072 5:2389490-2389512 CAGCAGAAGGAGGGGGCCAGAGG - Intergenic
985855164 5:2418635-2418657 CAGCAGGACGGGAGACGCCGCGG - Intergenic
988893953 5:35651391-35651413 CAGCAGGAGGAGAAGGCCTGGGG + Intronic
991478281 5:67047405-67047427 CAGCAAGAGCAGAGGCCCTGAGG - Intronic
992178916 5:74177805-74177827 CAGCAAGTGCAGAGGCCCTGTGG - Intergenic
992494199 5:77276237-77276259 CAGCAGGCGCAAAGGCCCTGAGG - Intronic
992527938 5:77630066-77630088 CAGGCGGAGGGGAGGCCTCGCGG + Exonic
992970094 5:82047651-82047673 CAGCAAGGACAGAGGCCCCGAGG - Intronic
994072965 5:95621419-95621441 GAGGACGAGGAGGGGCCCCGGGG + Exonic
996863314 5:128089233-128089255 CAGCTGGAGGACAGGCACCATGG + Intronic
997458806 5:134038321-134038343 CAGCAGGTTCAGAGGCCCCTGGG + Intergenic
998182503 5:139955345-139955367 CAGCAGCGGCAGAGGCCCAGAGG + Intronic
998532858 5:142901578-142901600 CAGCAGGTGGTGAGGCCCACAGG + Intronic
998533918 5:142911377-142911399 GAGCAGGTGGACAGGCCCTGGGG - Intronic
998885721 5:146691819-146691841 CAGCAAGTGCAAAGGCCCCGAGG - Intronic
999250809 5:150181199-150181221 CAGCAAGTGCAAAGGCCCCGAGG - Intronic
999266178 5:150268352-150268374 CAGCAGGTACAGAGGCCCTGAGG - Intronic
999452240 5:151687000-151687022 CAGGAGGAGGAGGGACCACGGGG - Exonic
1001197004 5:169682365-169682387 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1001397296 5:171426508-171426530 CAGCAGGTCAGGAGGCCCCGTGG + Intronic
1001422400 5:171597725-171597747 CAGCAGGTGCAAAGGCCCTGTGG - Intergenic
1001771807 5:174302494-174302516 CAGCAGGTGCAAAAGCCCCGAGG - Intergenic
1001917049 5:175570499-175570521 CAGCATGTGCAAAGGCCCCGAGG + Intergenic
1002364570 5:178700056-178700078 CAGAAGCAGCAAAGGCCCCGAGG - Intergenic
1002448845 5:179307725-179307747 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1002591414 5:180293323-180293345 AAGCAGGAAGAGAGGCACTGAGG + Intergenic
1002617226 5:180463532-180463554 CAGGAGGAGGAGATGCCCCATGG - Intergenic
1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG + Intergenic
1003403678 6:5811018-5811040 CAGCAGGTGCAAAGGCCCCGGGG + Intergenic
1003586131 6:7390653-7390675 CAGCAAGAGCAAAGGCCCCGAGG + Intronic
1005360199 6:25024141-25024163 CAGCAGGAGGGGGTGTCCCGCGG - Intronic
1005734151 6:28730039-28730061 CGGCTGGTGGAGAAGCCCCGAGG - Intergenic
1006153072 6:31999527-31999549 CAGCAGGACGTGGGGCCCCTCGG - Exonic
1006159380 6:32032264-32032286 CAGCAGGACGTGGGGCCCCTCGG - Exonic
1006797360 6:36740319-36740341 CAGCAGGCGCAAAGGCCCTGTGG - Intergenic
1006913303 6:37578304-37578326 CAGCCGGAGCAAAGGCCCTGGGG + Intergenic
1007186672 6:39977743-39977765 CTCCAGGAGGAGAAGCCCTGAGG - Intergenic
1007511845 6:42380126-42380148 CAGCAAGTGCAAAGGCCCCGAGG + Intronic
1007768176 6:44173407-44173429 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1010002026 6:70957280-70957302 GAGCGGGAGGAGCGTCCCCGCGG + Intergenic
1010594573 6:77748252-77748274 CTGCAGGGGGAGAGGCCTCATGG - Intronic
1010766190 6:79778988-79779010 CTGCAGAAGGAGAGGCCAGGTGG + Intergenic
1011554918 6:88564147-88564169 CAGCCGGAGCAAAGGCCCTGAGG - Intergenic
1011715056 6:90096759-90096781 CAGCAGGAGAAGAGGGCCAAGGG - Intronic
1013276925 6:108594466-108594488 CAGCAGGAGGAGAGTTCCCAGGG + Intronic
1013803323 6:113970929-113970951 CAGCAGGAGGAGGAGCCCGGTGG - Exonic
1015547315 6:134374666-134374688 CAGCAGGAGCAATGGCCCTGAGG - Intergenic
1015569228 6:134604525-134604547 CATCAGCAGCAGCGGCCCCGAGG + Intergenic
1015579155 6:134704588-134704610 CAGCAGGGGGAGAGGCCATGAGG + Intergenic
1016335544 6:143001124-143001146 CAAAAGGTGGAGAGGCCCCTTGG - Intergenic
1016370239 6:143366157-143366179 AAGAAGGAGGAGAGTCCCTGAGG - Intergenic
1017044774 6:150337277-150337299 CAGCATGAGGAAAGGCCCTGTGG + Intergenic
1017558949 6:155606347-155606369 GAGCAAGAGCAGAGGCCCTGAGG + Intergenic
1017658266 6:156650210-156650232 CAGCAGGAGGAGGAGGCCCCAGG - Intergenic
1017718700 6:157229879-157229901 CAGCAGGTGCAGAGGCCCCGCGG + Intergenic
1017878241 6:158541465-158541487 CAGCAGGTGGAGACACCCTGGGG + Intronic
1018057757 6:160067209-160067231 CAGCATGAGCAAAGGGCCCGAGG - Intronic
1018630403 6:165817118-165817140 CAGGAGATGGAGAGGCACCGTGG - Intronic
1018736396 6:166689938-166689960 CAGCAGGACCAGAGGCCTCCTGG - Intronic
1019057619 6:169234734-169234756 CAACAAGAGGAGCTGCCCCGTGG - Exonic
1019212588 6:170418593-170418615 GAGCAGGAGCACAGGCCACGGGG - Intergenic
1019314128 7:376767-376789 CAGCAGGAGAGCAGGCACCGGGG + Intergenic
1019324086 7:429539-429561 GTGCAGGAGGGGAGGCCCCAGGG - Intergenic
1019427195 7:983306-983328 CGGCAGCGGGCGAGGCCCCGGGG - Exonic
1019427567 7:984647-984669 CAGCAGCGGGAGAGGCTCCCAGG + Intronic
1019708411 7:2507338-2507360 CGGCAGGTGCAAAGGCCCCGGGG - Intergenic
1020279498 7:6643122-6643144 CAGCAGGTGCCGAGGCCCCGGGG - Intronic
1021934337 7:25615125-25615147 CAGAGGGAGGAGAGGGCCCTTGG - Intergenic
1022530386 7:31063287-31063309 CAGCAGGAGGAGAGCAGCCAGGG - Exonic
1022967081 7:35483779-35483801 CAGCAGGTGCAAAGGCCCCAAGG + Intergenic
1024723154 7:52161213-52161235 CAGCAGAAGGCCAGGCGCCGTGG + Intergenic
1025227894 7:57179855-57179877 CTGCAGGAGGTGAGGACTCGGGG - Intergenic
1026322809 7:69282313-69282335 CTGCAGGAGGAGGGTCCCCAGGG - Intergenic
1026444123 7:70469426-70469448 CAGCAAGAGCAAAGGCCCTGAGG + Intronic
1027141158 7:75658626-75658648 CAGCAGGAGGCCAGGCGCCGTGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028508794 7:91598995-91599017 CAGCTGGTGCAGAGGCCCCAAGG + Intergenic
1029598244 7:101548975-101548997 CAGCCGGTGGAGAGGACCCTGGG + Intronic
1030309941 7:108059023-108059045 CAGCAGTACGACAGGCCTCGGGG - Intronic
1030997789 7:116379379-116379401 GGGCAGGAGGAGAGGCCTCATGG - Intronic
1032096034 7:128938946-128938968 CAGCAGGAGGAGAGGTCCAGAGG + Intronic
1032273486 7:130432948-130432970 CAGGTGGAGGAGAGGCACCTGGG + Intronic
1032353873 7:131191130-131191152 CAGCTGGAGGTGAGCCCCCGTGG + Intronic
1033146831 7:138878340-138878362 CAGTGAGAGGAGAGGCCCCTGGG + Intronic
1034386086 7:150742462-150742484 AAGCAGGACGTGGGGCCCCGGGG - Exonic
1035057239 7:156043782-156043804 CAGCAGAAGCAGGTGCCCCGAGG + Intergenic
1035282688 7:157787524-157787546 AAGCAGGACGTGAGGCCCAGGGG - Intronic
1035468374 7:159094230-159094252 CAGCAGAGGAAGAGGCCACGGGG + Intronic
1035735022 8:1881550-1881572 CAGGAGCAGGGGAGCCCCCGGGG + Intronic
1037761590 8:21745306-21745328 CAGCAGGAGGAGGGACCACAGGG + Intronic
1038749722 8:30284301-30284323 CAGGAAAAGGAGAGGCCCCTAGG - Intergenic
1038797512 8:30722933-30722955 CAGCAGTTGGAGAGGCCTAGGGG - Intronic
1039923390 8:41908394-41908416 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1040566806 8:48574750-48574772 AAGCAGGATGAGAAGCCCCAAGG + Intergenic
1041566896 8:59288858-59288880 CAGCAGAAGGAGAGGCAATGTGG - Intergenic
1041952450 8:63518711-63518733 CTGGAGGAAGAGAGGCCACGTGG + Intergenic
1042690992 8:71498681-71498703 CAGCAGCAGAAGAGGTCCTGAGG - Intronic
1045325142 8:101112362-101112384 CAGCAGGAGCGGAGGCCAGGAGG + Intergenic
1045426242 8:102068427-102068449 CAGCAGGTGCAGAGGCCGTGAGG - Intronic
1045884044 8:107075317-107075339 CAGCAGCAGAAGAGGCCACTTGG + Intergenic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1046760127 8:118011992-118012014 CAGCAGCAGGAGGAGCCCCAGGG + Intronic
1048335284 8:133497947-133497969 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1048455046 8:134570113-134570135 CAGCAGGTGCAGAGGCCCGGAGG - Intronic
1049034318 8:140062462-140062484 CAGCTGGAGTAAAGGCCCTGGGG - Intronic
1049097542 8:140557862-140557884 CAGAAGGACGAGAGGGCCTGTGG - Intronic
1049229970 8:141476877-141476899 CAGCGGGTGCAAAGGCCCCGAGG - Intergenic
1049256186 8:141615177-141615199 CAGGAGGACGGGAGACCCCGTGG - Intergenic
1049317741 8:141978236-141978258 CAGACGGAGGAGAGGACCCGGGG - Intergenic
1049629823 8:143647655-143647677 CAGCAGGAGTCCAGGCCCAGTGG + Intronic
1049719042 8:144107178-144107200 CAGCAGCTGGGGAGGCCCCAGGG - Exonic
1049741096 8:144241389-144241411 AAGCAGCAGGCGAGGCCCTGGGG - Exonic
1049741522 8:144243219-144243241 CAGCAGGAGAAGAGTCCTCCGGG - Intronic
1049803211 8:144527601-144527623 CCGCAGTAGGAGAGGCGCGGAGG + Exonic
1053463063 9:38285435-38285457 CAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1054783363 9:69186747-69186769 CAGCTGGAGGAAGGGACCCGTGG + Intronic
1055584400 9:77742970-77742992 CAGCAGGAGGCTGGGCGCCGTGG + Intronic
1056481775 9:87013033-87013055 CAGCAGCAGATGAGACCCCGAGG + Intergenic
1056676887 9:88683456-88683478 CCGCGGGAGGAGAGGCTCTGCGG - Intergenic
1056738069 9:89226465-89226487 AAGCAGCAGGAGATGCCCGGTGG - Intergenic
1056749578 9:89337960-89337982 CTGGATGAGGAGAGGCCCAGGGG + Intronic
1057031441 9:91778539-91778561 GAGCAAGAGAAGAGGCCACGTGG + Intronic
1057228044 9:93302766-93302788 CAGCAGGTGGACAGACCCCTAGG + Intronic
1059713083 9:116887479-116887501 CAGCAGGTGCAAAGGCCCAGGGG + Intronic
1060201388 9:121653592-121653614 GTGCAGAAGGAGAGGCCCCAGGG - Intronic
1060741834 9:126103867-126103889 CTGCAGGAGGAGCGGCCACGTGG + Intergenic
1060814424 9:126627169-126627191 CAGCAGGAAGAGAGACCCCCCGG + Intronic
1060993255 9:127860984-127861006 CAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1061009391 9:127946201-127946223 CAGCATCGGCAGAGGCCCCGAGG + Intronic
1061011782 9:127960237-127960259 CAGCAAGTGCAGAGGCCCTGAGG + Intronic
1061012099 9:127961808-127961830 CAGCAAGTGCAAAGGCCCCGGGG + Intronic
1061178714 9:129011915-129011937 CAGGAGGTGGAGGGGCCCTGGGG + Intronic
1061372829 9:130207406-130207428 CAGCAGGGGCAGAGGCTCTGAGG - Intronic
1061475418 9:130862527-130862549 CAGCAGGTACAGAGGCCCTGAGG + Intronic
1061499249 9:130992795-130992817 CAGCAAGTGCAAAGGCCCCGAGG + Intergenic
1061579121 9:131526057-131526079 CAGCAGGAGGGGCGGCCCTGGGG + Intronic
1061904299 9:133688709-133688731 CAGCAGGTGCAAAGGCCCCGTGG - Intronic
1062008065 9:134251491-134251513 GAGGAGGAGCAGAAGCCCCGCGG - Intergenic
1062272865 9:135717782-135717804 CTTCAAGAGGAGAGGCCCCCAGG - Intronic
1062349359 9:136131554-136131576 CAGCAGGACCAGCGGCCCGGGGG - Intergenic
1062359734 9:136182054-136182076 CAGAATCAGGAGAGGCCCCGAGG - Intergenic
1062528874 9:136991106-136991128 CAGCATGTGCAGAGGCCCAGGGG + Intergenic
1062561142 9:137142611-137142633 CCTCAGGACGAGAGGGCCCGTGG + Intronic
1062688571 9:137828859-137828881 AAGCAGGAGGGGAGGCACAGAGG - Intronic
1186477058 X:9865845-9865867 CAGCAGGAGGCCAGGCGCGGTGG - Intronic
1187013386 X:15302565-15302587 CAGGAGGAGGAGAGGCAGTGAGG + Intronic
1187367994 X:18680193-18680215 CAGCAGCAGCAAAGGCCCCGAGG - Intronic
1187507213 X:19887512-19887534 CAGCAGCAGGAGTCGCCCCGGGG - Exonic
1190321813 X:49184269-49184291 CAGCAGGAGGATAGGACGCTGGG + Intronic
1190738346 X:53270412-53270434 CCGCAGGTGTAAAGGCCCCGAGG - Intronic
1192795441 X:74421447-74421469 GAGGAGGAGGAGAGGGCTCGAGG + Exonic
1195533247 X:105982059-105982081 CAGCAGCAGTAGAGGCACCATGG + Intergenic
1195795355 X:108641717-108641739 AAGCAGCAGGAAAGGCCCTGGGG + Intronic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198286265 X:135194772-135194794 AAGCAGGAGGCGAGTCCCTGAGG - Intergenic
1200003680 X:153074321-153074343 GAGGAGGAGAGGAGGCCCCGGGG - Exonic
1200004043 X:153075688-153075710 GAGGAGGAGAGGAGGCCCCGGGG + Intergenic
1200045233 X:153397411-153397433 CAGCTGGAGAAGAGGCCACCTGG - Intergenic
1201519472 Y:14857636-14857658 CAGTTGGAGGAGAGGCCTAGTGG + Intergenic