ID: 969569047

View in Genome Browser
Species Human (GRCh38)
Location 4:7997681-7997703
Sequence GTCTCCTGCTGCTGCTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969569037_969569047 30 Left 969569037 4:7997628-7997650 CCTTTTCAGTTTCAAAAGTATCT 0: 1
1: 0
2: 13
3: 93
4: 701
Right 969569047 4:7997681-7997703 GTCTCCTGCTGCTGCTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969569047 Original CRISPR GTCTCCTGCTGCTGCTGGGT GGG Intronic
No off target data available for this crispr