ID: 969569403

View in Genome Browser
Species Human (GRCh38)
Location 4:7999857-7999879
Sequence ACCCCGCCAGGCCTGCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 204}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969569389_969569403 22 Left 969569389 4:7999812-7999834 CCGCCTCCCCTCCATGAAGCCTG 0: 1
1: 0
2: 3
3: 58
4: 493
Right 969569403 4:7999857-7999879 ACCCCGCCAGGCCTGCTCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 204
969569395_969569403 3 Left 969569395 4:7999831-7999853 CCTGCCATAGCCACCTTGCCCTC 0: 1
1: 0
2: 0
3: 15
4: 224
Right 969569403 4:7999857-7999879 ACCCCGCCAGGCCTGCTCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 204
969569396_969569403 -1 Left 969569396 4:7999835-7999857 CCATAGCCACCTTGCCCTCAGCA 0: 1
1: 0
2: 1
3: 16
4: 293
Right 969569403 4:7999857-7999879 ACCCCGCCAGGCCTGCTCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 204
969569392_969569403 15 Left 969569392 4:7999819-7999841 CCCTCCATGAAGCCTGCCATAGC 0: 1
1: 0
2: 2
3: 7
4: 142
Right 969569403 4:7999857-7999879 ACCCCGCCAGGCCTGCTCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 204
969569398_969569403 -10 Left 969569398 4:7999844-7999866 CCTTGCCCTCAGCACCCCGCCAG 0: 1
1: 0
2: 1
3: 36
4: 474
Right 969569403 4:7999857-7999879 ACCCCGCCAGGCCTGCTCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 204
969569390_969569403 19 Left 969569390 4:7999815-7999837 CCTCCCCTCCATGAAGCCTGCCA No data
Right 969569403 4:7999857-7999879 ACCCCGCCAGGCCTGCTCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 204
969569394_969569403 11 Left 969569394 4:7999823-7999845 CCATGAAGCCTGCCATAGCCACC 0: 1
1: 0
2: 0
3: 18
4: 238
Right 969569403 4:7999857-7999879 ACCCCGCCAGGCCTGCTCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 204
969569388_969569403 27 Left 969569388 4:7999807-7999829 CCTGGCCGCCTCCCCTCCATGAA 0: 1
1: 0
2: 1
3: 32
4: 238
Right 969569403 4:7999857-7999879 ACCCCGCCAGGCCTGCTCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 204
969569397_969569403 -7 Left 969569397 4:7999841-7999863 CCACCTTGCCCTCAGCACCCCGC 0: 1
1: 0
2: 2
3: 42
4: 451
Right 969569403 4:7999857-7999879 ACCCCGCCAGGCCTGCTCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 204
969569391_969569403 16 Left 969569391 4:7999818-7999840 CCCCTCCATGAAGCCTGCCATAG No data
Right 969569403 4:7999857-7999879 ACCCCGCCAGGCCTGCTCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 204
969569393_969569403 14 Left 969569393 4:7999820-7999842 CCTCCATGAAGCCTGCCATAGCC 0: 1
1: 1
2: 2
3: 32
4: 288
Right 969569403 4:7999857-7999879 ACCCCGCCAGGCCTGCTCTTGGG 0: 1
1: 0
2: 2
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969569403 Original CRISPR ACCCCGCCAGGCCTGCTCTT GGG Intronic