ID: 969569582

View in Genome Browser
Species Human (GRCh38)
Location 4:8000753-8000775
Sequence GGCTGCTGCCTGGGAACGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 8, 3: 37, 4: 380}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969569571_969569582 24 Left 969569571 4:8000706-8000728 CCCGGAGGCTTTGGGAAGATGCG 0: 1
1: 0
2: 2
3: 12
4: 170
Right 969569582 4:8000753-8000775 GGCTGCTGCCTGGGAACGGGAGG 0: 1
1: 0
2: 8
3: 37
4: 380
969569572_969569582 23 Left 969569572 4:8000707-8000729 CCGGAGGCTTTGGGAAGATGCGG 0: 1
1: 0
2: 1
3: 20
4: 305
Right 969569582 4:8000753-8000775 GGCTGCTGCCTGGGAACGGGAGG 0: 1
1: 0
2: 8
3: 37
4: 380
969569570_969569582 25 Left 969569570 4:8000705-8000727 CCCCGGAGGCTTTGGGAAGATGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 969569582 4:8000753-8000775 GGCTGCTGCCTGGGAACGGGAGG 0: 1
1: 0
2: 8
3: 37
4: 380
969569576_969569582 0 Left 969569576 4:8000730-8000752 CCAATCACAAGCACGGATGGCGA 0: 1
1: 0
2: 0
3: 1
4: 44
Right 969569582 4:8000753-8000775 GGCTGCTGCCTGGGAACGGGAGG 0: 1
1: 0
2: 8
3: 37
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969569582 Original CRISPR GGCTGCTGCCTGGGAACGGG AGG Intronic
900101616 1:964489-964511 GGCTGGAGCCTGGGAAAGCGTGG + Exonic
900179570 1:1305312-1305334 GGCTGCAGGCTGGGCACTGGCGG - Intronic
900296773 1:1955892-1955914 GGCAGCTGACTGGGAAAAGGAGG - Intronic
900335265 1:2159795-2159817 GGCTGCTGTCTGGAAAAGGTGGG - Intronic
900524226 1:3120620-3120642 GGCAGCCCCCTGGGAGCGGGAGG + Intronic
900604476 1:3517667-3517689 GGCTGTGGCCTGGGTAGGGGTGG - Intronic
900998272 1:6134460-6134482 GAGCCCTGCCTGGGAACGGGGGG - Intronic
901507116 1:9691793-9691815 TGCTGCTGCCTGGGAAAAGAAGG + Intronic
902140596 1:14350483-14350505 GTTTGCTGCCTGGGAACATGTGG + Intergenic
902919242 1:19656635-19656657 GGCTGCTGGTGGGGAATGGGTGG + Intronic
903907167 1:26695809-26695831 GGCTGCTGCGCGGCAGCGGGCGG - Intergenic
904212792 1:28897035-28897057 AGCTGCTGCCTGGGAAACTGAGG - Intronic
904330518 1:29755395-29755417 GGCTGCAGCCTGTGAACTGCAGG + Intergenic
904416159 1:30362199-30362221 GGCTGCAGCCTGTGAACTGCAGG - Intergenic
904599884 1:31667482-31667504 GGCAGCAGCCTGTGAAGGGGAGG - Intronic
904779761 1:32936923-32936945 GGCTGCAGTATGGGAGCGGGGGG + Exonic
905455610 1:38086007-38086029 GGCTGCTGGCTGGGGCGGGGTGG + Intergenic
905882625 1:41474662-41474684 GACTGCAGGCTGGGAACTGGGGG - Intergenic
906242332 1:44249621-44249643 AGCTGTGGCCTGGGAAAGGGTGG - Intronic
907051056 1:51330285-51330307 GGCGGCTGCCAGGGGCCGGGCGG + Intronic
907221720 1:52911843-52911865 GGCTGCGGGCTGGGGACTGGAGG + Intronic
907422055 1:54354262-54354284 GGCAGGTGCCTGGGAAAGGCTGG - Intronic
912254776 1:108047527-108047549 GGATGATGCCTGGGTACTGGTGG + Intergenic
912385378 1:109268769-109268791 GGCTGGTGCCTGGGTTGGGGAGG + Intronic
913199572 1:116484925-116484947 GCCTGCTGTCTGGGGACAGGGGG + Intergenic
914703074 1:150150786-150150808 GGCTGCGGCCGGGGGGCGGGGGG - Intronic
915339625 1:155169491-155169513 AGCTGCTGCCTGGTACAGGGTGG + Exonic
915476127 1:156153884-156153906 GGGAGCTGCCTGGGCAGGGGTGG - Intronic
916187734 1:162149084-162149106 GCCTGATGCCTGGGAATTGGAGG - Intronic
917041601 1:170811150-170811172 GGCTGCAGCCTGGCAGGGGGAGG + Intergenic
917925625 1:179786983-179787005 GCCTGCTGCCAGGAAAAGGGAGG + Intronic
921045338 1:211472882-211472904 GGCTACTGCCAAGGAAAGGGAGG + Intergenic
922466334 1:225847618-225847640 GGCTGGAGCCTGGGATTGGGAGG - Intronic
1062857309 10:785683-785705 GGCAGCTGCCTGAGCACGTGGGG + Intergenic
1065157038 10:22881056-22881078 GGCTGCAGCCTGGTGAGGGGAGG + Intergenic
1066749449 10:38637764-38637786 GGCTGCTGCATGGTAACCTGGGG - Intergenic
1066967197 10:42280028-42280050 GGCTGCTGCATGGTAACCTGGGG + Intergenic
1067404587 10:46010082-46010104 GGCTGGAGCCTCGGAAGGGGAGG + Intronic
1067848388 10:49740172-49740194 GGCATCTGCCTGGGGGCGGGGGG + Intronic
1068704070 10:60053636-60053658 GGTTGCTGCATGGAAACAGGTGG + Intronic
1069554750 10:69390343-69390365 GCCTGGTGCCAGGAAACGGGCGG - Intronic
1069605535 10:69736753-69736775 GGCTGGGGCCTGGGAGAGGGAGG - Intergenic
1070716362 10:78725024-78725046 GACTGCGGCCGGGGAATGGGTGG - Intergenic
1070962294 10:80507489-80507511 GGCCCCTGCCTGGGAGCAGGAGG + Intronic
1073029708 10:100515899-100515921 TGCTGCTGACTGGAAAGGGGGGG + Intronic
1073249183 10:102111369-102111391 GGATCCTGCCTGGAAAGGGGAGG - Intronic
1074087628 10:110220543-110220565 TTCTGCTGCCTGGAAAAGGGTGG + Intronic
1074543730 10:114386618-114386640 GGCTGCTGCCTGGGTAGGGCAGG - Intronic
1075258931 10:120946282-120946304 CGCTGCTGCCTGGAAATGGGTGG + Intergenic
1075589847 10:123683592-123683614 GGCTGCTGGGTGGGAATGTGAGG + Intronic
1076555545 10:131318955-131318977 GGCTGCTCCTTGGCCACGGGGGG - Intergenic
1076767866 10:132646451-132646473 GGGTCCTGCCTGGGAAGAGGGGG + Intronic
1077228237 11:1447559-1447581 GGCTGCTGACTGGGGACGCAGGG + Intronic
1078132642 11:8625259-8625281 GGCTGCTAGCTGGGAATGGAGGG + Intronic
1079021081 11:16909525-16909547 GGCTGCTGCCTTGGAGAGTGTGG - Intronic
1079126677 11:17722248-17722270 GCCTGCTGCCTGGGGAAGGAAGG + Intergenic
1079653987 11:22965626-22965648 GGCTGCAGCCTGGCAGGGGGAGG - Intergenic
1081534556 11:43987542-43987564 AGCTGCTGTCTGGGAATGGAGGG + Intergenic
1082929004 11:58579546-58579568 GGCTGCTGCCCGGGGACGTCGGG - Exonic
1083365354 11:62138775-62138797 GACGGCTGCCTGGGGAAGGGAGG + Intronic
1083776264 11:64895607-64895629 GGCAGGTGCCTAGGAAGGGGAGG - Intronic
1084636831 11:70398544-70398566 GCCTGGTGCCTGGGAGCGGCTGG + Exonic
1084671948 11:70612118-70612140 GACTCCTGCCTGGGAACCAGGGG + Intronic
1084952405 11:72673973-72673995 GGCTGCAGTCTGGCAACGCGGGG + Intronic
1085156596 11:74301049-74301071 CGCTGCTACCTGGGCAAGGGTGG + Intronic
1085309770 11:75509238-75509260 GGTTGCAGCCAGGGAAGGGGCGG + Intronic
1085474840 11:76783287-76783309 GGCTGCGGGCGGGGACCGGGGGG + Intronic
1085725892 11:78954207-78954229 GGGGGCTGCCTGGGGAAGGGTGG + Intronic
1085914543 11:80869542-80869564 GGCTGCAGTCTAGGAAAGGGGGG + Intergenic
1090662155 11:128890413-128890435 GGCTGCTGTCTGGGGAGGGCCGG - Intergenic
1090730989 11:129573361-129573383 GGCTGCAGCCTGGGAGGGGCCGG + Intergenic
1091712718 12:2753168-2753190 GGCTGGCGCCTGGGAGCGCGAGG + Intergenic
1094125946 12:27022475-27022497 GGCTGCGTCCTTGGAACGGGTGG - Intergenic
1096777660 12:53973930-53973952 AGCAGCGGCCGGGGAACGGGCGG + Intronic
1098154481 12:67583214-67583236 GGCTGCTGCCTGCCAAATGGAGG - Intergenic
1098176022 12:67792347-67792369 GGCTGCAGCCTGGCAGGGGGAGG - Intergenic
1101365207 12:104064488-104064510 GGCTGCTCCCTGGGGAGGGCGGG - Exonic
1101566541 12:105911096-105911118 GGCTACTGCCTGGGAACTTTAGG + Intergenic
1101707357 12:107232914-107232936 GGCTGCTGCGTGAGAACAGAAGG - Intergenic
1101862776 12:108496553-108496575 GGCTGCTGCCTTGTAGTGGGGGG + Intergenic
1102215136 12:111155713-111155735 GGCTGGTGCCTGAGAGCGTGTGG - Intronic
1102723235 12:115035709-115035731 GGCTGCTTCCTGGGAAGGGGTGG + Intergenic
1103339215 12:120212271-120212293 GGATGCTGGCTGGGGAAGGGGGG + Exonic
1103511346 12:121476737-121476759 GGCAGCAGCCAGGGAAAGGGAGG - Intronic
1104206333 12:126642435-126642457 GGCTGCAGCCTGGCACGGGGAGG - Intergenic
1104300376 12:127559520-127559542 TGCTGGTGGCTGGGAACAGGTGG + Intergenic
1104725923 12:131075696-131075718 TGCTGCTTCCTGGGAAAGGAGGG + Intronic
1104859779 12:131917999-131918021 GGGTTCTGCCTGGGGAGGGGTGG + Intronic
1104903067 12:132199410-132199432 GTGGGCTGCCTGGGAAGGGGTGG + Intronic
1104910110 12:132236259-132236281 GGCGGCTGGCGGGGAGCGGGTGG + Intronic
1105257829 13:18756427-18756449 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1105258213 13:18759308-18759330 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1105260489 13:18775736-18775758 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1105260870 13:18778608-18778630 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1105262257 13:18788473-18788495 GGCTTCTGCCTGGAAACAGTAGG - Intergenic
1105263181 13:18795199-18795221 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1105295424 13:19085154-19085176 GGCTGATGTCTGGGCAGGGGTGG - Intergenic
1106335221 13:28777762-28777784 GCCTTCTCCCTGGGAACAGGAGG - Intergenic
1106391414 13:29338825-29338847 GCCTTCTCCCTGGGAACAGGAGG - Intronic
1106614930 13:31317636-31317658 GGCTACGGCCTGGGCACTGGTGG + Exonic
1109824198 13:67696882-67696904 GGCTGCTGCCAGGCAATGGGAGG - Intergenic
1113357946 13:109601140-109601162 GGATGCTGGCTGGGCACGGCTGG - Intergenic
1113479617 13:110610880-110610902 CGCTGGAGCCTGGGAAGGGGAGG + Intergenic
1113627970 13:111860401-111860423 GGCTGCAGTCTGGGAACAGGAGG + Intergenic
1113784856 13:112997068-112997090 GGCTGCTTCCCGTGAACGGAGGG + Intronic
1115843668 14:37502025-37502047 GGCTGCAGCCTGGCAGGGGGAGG + Intronic
1116792741 14:49356994-49357016 GGCTGCAGCCTGGCAGGGGGAGG + Intergenic
1117875803 14:60249328-60249350 GGCTGTTGCTCCGGAACGGGTGG + Intronic
1117892661 14:60443450-60443472 GGCTGCAGCCTGGCAGGGGGAGG + Intronic
1119653337 14:76399063-76399085 GGCTGCAGCCAGGGGACAGGTGG - Intronic
1120310854 14:82826649-82826671 GGGTGATGCCTGGAAACTGGAGG + Intergenic
1121026626 14:90621055-90621077 AGCTGCTGCCTAGGTACGGCTGG + Intronic
1122033614 14:98931782-98931804 GCCTGTTGCCTGGGAACGCTGGG - Intergenic
1122324200 14:100873114-100873136 GGGTGATGCATGGGAAGGGGAGG - Intergenic
1122348156 14:101073122-101073144 GGCTCCTGCCTTGGAACGGGGGG - Intergenic
1122638102 14:103139495-103139517 GGCTGCTTCCAGGGACAGGGAGG + Intergenic
1122830665 14:104394054-104394076 GGCTGCTGCCTGGGCACGAGTGG + Intergenic
1202833829 14_GL000009v2_random:63058-63080 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1202922648 14_KI270724v1_random:1179-1201 GGGTGCTGCAGGGGCACGGGCGG + Intergenic
1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG + Intronic
1125920092 15:43520283-43520305 TGGTGCTGCCTGGGGATGGGGGG - Intronic
1126362559 15:47861319-47861341 GGCTGCAGCCTGTGAATGGATGG - Intergenic
1126473811 15:49046092-49046114 AGCTGCTGCCTGGGACTTGGGGG - Intronic
1127047536 15:55043101-55043123 GCATGCTGCCTGGGAACCTGAGG - Intergenic
1127509694 15:59628190-59628212 GGCTGCTGACTGGTCAAGGGTGG + Intronic
1128321984 15:66701064-66701086 GGCTCCTGCCCGGAAAGGGGCGG + Intergenic
1128360800 15:66960275-66960297 GGCTTCTGACTGGGAACTGGGGG - Intergenic
1128565837 15:68699989-68700011 CGCTGCAGCCTGGGAGGGGGTGG + Intronic
1129274201 15:74434508-74434530 GGCTGCTGGCTGGGAAAGGGAGG - Intergenic
1132507844 16:321212-321234 GGCTCCTGCCTGGGTATGGAAGG - Intronic
1132598055 16:762141-762163 CGCTGCTGGGTGGGAAGGGGCGG + Intronic
1132668986 16:1095047-1095069 AGCTTCTGCCTGGGCACGGACGG + Intronic
1132688747 16:1172971-1172993 GGGTGCTGCCTGGGAGGGAGGGG + Intronic
1133127645 16:3656756-3656778 GGGTGCTGCCTGGGCCAGGGTGG + Intronic
1134022891 16:10933656-10933678 GGTTTCTACCTGGGAACAGGTGG - Intronic
1134185301 16:12080323-12080345 GGCTGCTGCGTGGGAACGGCTGG + Intronic
1135574022 16:23571246-23571268 TGCTGCTGCCTGTGAACGCACGG + Exonic
1136317240 16:29461552-29461574 GACTGCCGCCTGGGAGAGGGTGG - Intronic
1136427809 16:30180907-30180929 GGCTGCAGCAGGGGAAGGGGTGG - Intergenic
1136431815 16:30200895-30200917 GACTGCCGCCTGGGAGAGGGTGG - Intronic
1136501177 16:30670265-30670287 GGCTTCTCCCTGGGAAGGTGGGG + Exonic
1139015473 16:62684297-62684319 GGCTCCTGGGTGGGAAGGGGTGG + Intergenic
1140895164 16:79318225-79318247 GGATGCAACCTGGGAACAGGTGG - Intergenic
1141605570 16:85151660-85151682 GCCTGCTGCCTGGGCAGGAGCGG - Intergenic
1142220283 16:88850937-88850959 GGCTGGCGTCTGGGAACAGGAGG - Intronic
1143631407 17:8142450-8142472 GGCTGCTGCCTGTGAAGTGGGGG + Exonic
1144686515 17:17229525-17229547 GGCAGCTGCCGGGGACTGGGAGG + Intronic
1145069068 17:19787852-19787874 AGCTGCTGCCAGGGGAGGGGCGG - Intronic
1148753970 17:49962926-49962948 AGCTGCTGCCTGGAAAAGGCTGG - Intergenic
1148844987 17:50524589-50524611 TGCTGCTGCCTGGGGCCTGGTGG - Intronic
1149255428 17:54821055-54821077 GGCTGCAGCCTGGCAGGGGGAGG + Intergenic
1150025850 17:61673452-61673474 GGCTGCAGCCTGGCTAGGGGAGG + Intergenic
1150285056 17:63949750-63949772 GGCTGATGCCTGGGAAGGGACGG + Intronic
1150846054 17:68659204-68659226 GGCTGCTGGGTGTGAACTGGTGG + Intergenic
1151764008 17:76122748-76122770 GGCTGCTGGCTGGGGGCGGGAGG + Intergenic
1151963765 17:77420678-77420700 GGCTGCTGCAGGGGAGAGGGTGG - Intronic
1152610054 17:81310996-81311018 GGCTGCTTCCAGGGGAAGGGCGG - Intergenic
1154425145 18:14266183-14266205 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1154425526 18:14269059-14269081 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1154427863 18:14285584-14285606 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1154428258 18:14288645-14288667 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1154429184 18:14295240-14295262 GGCTTCTGCCTGGAAACAGTAGG + Intergenic
1154431458 18:14311585-14311607 GGCTTCTGCCTGGAAACAGTAGG + Intergenic
1154432837 18:14321423-14321445 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1154433224 18:14324300-14324322 GGCTTCTGCCTGGGAACAGTGGG + Intergenic
1154434137 18:14330889-14330911 GGCTACTGCCTGGAAACAGTGGG + Intergenic
1154434565 18:14333962-14333984 GGCTGCTGCCTGGAAACAGTGGG + Intergenic
1157358167 18:46954123-46954145 GTCTTCTGCCTGGGTAGGGGAGG + Intronic
1157910722 18:51615267-51615289 GGCTTCTGCCAGGAAACAGGTGG + Intergenic
1158665572 18:59429722-59429744 AGCTGCTGTCTGGGAAAGGCTGG + Intergenic
1159115084 18:64104853-64104875 GGCTGCATCCTGGGACCCGGAGG + Intergenic
1160592196 18:79951160-79951182 GGCCCCTGCCTGGGACGGGGGGG + Intronic
1160899851 19:1422174-1422196 GGCTGCTGTCTGAGAAAGGCTGG - Intronic
1161448297 19:4329914-4329936 GGCTGCAGGATGGGGACGGGAGG - Intronic
1161689165 19:5720836-5720858 GGGTGCTGCCGGGGGTCGGGAGG + Intronic
1162399421 19:10435873-10435895 AACTGCTGCCTGGGAGCTGGTGG - Intronic
1162464567 19:10832156-10832178 GGCTGCTGCCTGGTGAAGCGGGG + Intronic
1164729609 19:30493235-30493257 GGCTGGTGACTGGGCAGGGGAGG - Intronic
1165152674 19:33770254-33770276 GGCTGCTGCCTGCGGGAGGGGGG - Intronic
1165158594 19:33802929-33802951 GGCTGCTGCCTGAGAGCAGGAGG + Intronic
1167035271 19:46991531-46991553 TGCAGCAGCCTGGGAAAGGGTGG + Intronic
1167569863 19:50280332-50280354 GGCAGCTGCCAGGGAACGGGCGG + Exonic
1167684976 19:50950429-50950451 GGCTGGAGCCTGGGGATGGGAGG + Intronic
1168294128 19:55370410-55370432 GGCCGCGGCCTGGGGAGGGGAGG + Intronic
1202638846 1_KI270706v1_random:64634-64656 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
925313791 2:2906761-2906783 GGCTGCGGGCTGGGAAGAGGGGG - Intergenic
925802661 2:7616828-7616850 GGCTCCTCCATGTGAACGGGAGG + Intergenic
926204958 2:10829283-10829305 GGGAGCTGCCTGGGGGCGGGAGG - Intronic
927001091 2:18794598-18794620 ACCTGCTGCCTGGGAACCTGAGG - Intergenic
927063029 2:19442130-19442152 GGCAGCTGCCTGGGAACTGCAGG - Intergenic
927846378 2:26474470-26474492 GGCTGAGGCCTGGGGACTGGAGG - Intronic
927911334 2:26902013-26902035 GGGTGCTGCCTGGGGCAGGGAGG - Intronic
928287855 2:30008976-30008998 GGCTGGGGCCTGGGAGCAGGTGG - Intergenic
929456371 2:42068978-42069000 TGCTGCTGCCTGGGCTCTGGAGG - Intergenic
929511432 2:42568626-42568648 CGCTGCTGCCTCGCCACGGGGGG - Intronic
929861677 2:45683612-45683634 GACTGCTGCATGGGAGCTGGGGG + Intronic
930018451 2:46986536-46986558 GGGTGCTGCCTGGGGTGGGGTGG + Intronic
930762520 2:55050856-55050878 GGCTGCTGGCTGGGAGGGGTCGG + Intronic
931321951 2:61180530-61180552 GGCTGCTGCCTGGCAGTGGCTGG - Intronic
931834282 2:66082559-66082581 GGCTTTTGCGTGGGAATGGGAGG + Intergenic
932539977 2:72641490-72641512 GGCAGCAACCTGGCAACGGGAGG + Intronic
934312447 2:91879882-91879904 GGCTGCTGCATGGTAACCTGGGG - Intergenic
934491522 2:94764526-94764548 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
934492557 2:94771631-94771653 GGCTTCTGCCTGGTAACAGTGGG - Intergenic
934494308 2:94784158-94784180 GGCTGCTGCTTGGAAACAGTGGG - Intergenic
936412832 2:112275695-112275717 GGCTGTGGCGTGGGAGCGGGCGG - Exonic
937441127 2:121917225-121917247 GGCTGCAGTCTGGGAACGCTTGG + Intergenic
938012700 2:127841562-127841584 GGCTGCTGCCTGGGGACATCGGG + Intergenic
938279514 2:130054089-130054111 GGCTTCTGCCTGGAAACAGTAGG - Intergenic
938330461 2:130444799-130444821 GGCTTCTGCCTGGAAACAGTAGG - Intergenic
938359484 2:130676704-130676726 GGCTTCTGCCTGGAAACAGTAGG + Intergenic
938435883 2:131283353-131283375 GGCTTCTGCCTGGAAACAGTAGG + Intronic
940976201 2:159947808-159947830 GGGTGCTGCCTGGGTGAGGGTGG + Intronic
941295413 2:163733449-163733471 GGCTGCTGCCTGTGATGAGGAGG - Intronic
942147781 2:173043445-173043467 GGCCGCTGTCTGGGAGCGGGAGG + Intronic
942218985 2:173750689-173750711 GGCTGCAGGCTGGGAGCAGGAGG - Intergenic
942463821 2:176188451-176188473 GGGGGCTGCCTGGGCAAGGGCGG - Intergenic
944679636 2:202065307-202065329 GGCTGCTGGCTGGGAAAATGGGG + Intergenic
945039324 2:205730911-205730933 GGCTGCTGCCTGGCTAGGGGAGG - Intronic
946179942 2:217943020-217943042 TTCTCCAGCCTGGGAACGGGTGG + Intronic
946199832 2:218065063-218065085 TTCTCCAGCCTGGGAACGGGTGG + Intronic
946292169 2:218753672-218753694 GAGTGCTGCCTGGGCAAGGGAGG + Intronic
948233641 2:236370561-236370583 TGGTGCTTCCTGGGAACTGGGGG + Intronic
948884131 2:240874534-240874556 AGCTGCAGCCTGGCAACTGGAGG + Intronic
1168997800 20:2145842-2145864 GGCTGCAGCCAGGGAGAGGGGGG - Exonic
1171458550 20:25285579-25285601 GGCTGCCTCCTGTGAACGGCTGG - Intronic
1171883630 20:30635872-30635894 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1171885446 20:30648761-30648783 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1171968721 20:31549960-31549982 TGCTGCTGCCTGGGATCTGAGGG - Intronic
1172011226 20:31846983-31847005 AGCTGCAGCCTGGGGTCGGGAGG + Intergenic
1172118572 20:32585024-32585046 GGCTGCTGGATGGGCGCGGGCGG + Intronic
1172633250 20:36393025-36393047 GGCTGAGGACTGGGAAAGGGAGG + Intronic
1172649200 20:36491106-36491128 GGCTGAGGCCTGGGAAGTGGAGG + Intronic
1172800799 20:37574730-37574752 GGGTGCTGCCTGGAGAAGGGAGG - Intergenic
1174164261 20:48573687-48573709 GGCTGCTCCCTGGGAGATGGAGG + Intergenic
1175226839 20:57449628-57449650 GGCTGCTGCCTTGGAAAGGGAGG - Intergenic
1175429315 20:58891110-58891132 GGCTGCTGCCCGAGCCCGGGGGG + Intronic
1175579821 20:60089648-60089670 GGCTGCTGACTGGGGAAGGAAGG - Intergenic
1175776780 20:61658766-61658788 TGTTGCTGCCTGGGAGTGGGGGG - Intronic
1176020350 20:62959463-62959485 GGCGGCTGCGTGGTAACGGTGGG + Intronic
1176110163 20:63407436-63407458 GGCTGCTCCCAGGAAATGGGGGG + Intronic
1176110202 20:63407548-63407570 GGCTGCTCCCAGGAAATGGGGGG + Intronic
1176121122 20:63455028-63455050 GGCCGCTGCCTGGGCAGGAGGGG - Intronic
1176128537 20:63486731-63486753 GGCTGCAGGCTGGGAGCTGGGGG + Intergenic
1176239759 20:64070441-64070463 GGCTGCTCCCTCGGAGCGGTGGG + Intronic
1176842473 21:13851744-13851766 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1176844212 21:13864332-13864354 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1176845588 21:13874183-13874205 GGCTTCTGCCTGGAAACAGTAGG - Intergenic
1176846498 21:13880777-13880799 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1176846899 21:13883839-13883861 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1177262581 21:18749939-18749961 GGCTCCTGGGTGGGAAGGGGTGG + Intergenic
1179308174 21:40173739-40173761 AGCTGCTGCCCCGGAATGGGAGG + Intronic
1179798605 21:43799849-43799871 GGCTGGGGCCTGGGAAAGTGGGG + Intronic
1179961181 21:44767685-44767707 GTCTGCTTCCTGGGATGGGGAGG - Intergenic
1180064126 21:45404572-45404594 GGCCGCGCCCTGGGAACAGGGGG + Intergenic
1180363116 22:11917255-11917277 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1182766249 22:32760197-32760219 GGCTGTTGGCTGGGGGCGGGTGG - Intronic
1183244754 22:36685297-36685319 GGAAGCTGCCTGGGCGCGGGCGG - Intronic
1183541486 22:38431618-38431640 GGCTGCTCCATGGGGAAGGGTGG - Intronic
1184090371 22:42290089-42290111 GGCTGCTGCTTGGGGAGCGGGGG + Intronic
1184711306 22:46250840-46250862 GGCTGGTGCCTGGGGGCGAGGGG - Intergenic
1185005936 22:48277047-48277069 GGCTGCAGGCTGGGAGTGGGTGG - Intergenic
1185105561 22:48867578-48867600 GGCCGGGGCCTGGGAACGGTGGG + Intergenic
1185351706 22:50343129-50343151 GACTGCTGCCTTGGAGTGGGTGG - Intergenic
1185415939 22:50710306-50710328 GGCTGGTGCCTGGAAAATGGAGG + Intergenic
951050728 3:18089987-18090009 GGCTGCCCCCTAGGAAGGGGTGG - Intronic
952988002 3:38804318-38804340 GGCTGCTGTTTGGGAAAGGATGG - Intergenic
953383935 3:42494006-42494028 GGCTGCTGCCTGGTGAGGTGAGG - Intronic
953726949 3:45408072-45408094 GGTTATTGCCTGGGGACGGGGGG - Intronic
954419360 3:50410465-50410487 GGGTGCTCCCTGGGATGGGGGGG + Intronic
955146677 3:56326758-56326780 TGCTGCTCCCTGGGAATGAGAGG - Intronic
955380646 3:58435219-58435241 GGTTGCTGACTGGGAATGGGAGG + Intergenic
955856498 3:63278571-63278593 GGCGGCTGGCTGGGAGCAGGGGG + Intronic
956373241 3:68586859-68586881 GGCTGCAGCCTGGCAGGGGGAGG - Intergenic
962675189 3:137751099-137751121 GGCTGCAGCCTGGCTAGGGGAGG + Intergenic
963059499 3:141213552-141213574 GGCTACTGCCTGTGATCAGGTGG - Intergenic
963820495 3:149887118-149887140 GGTTGCTGCCGGGAAGCGGGCGG - Intronic
965256970 3:166425693-166425715 GGCTGCTGCCAGGGAATGGGAGG - Intergenic
965376668 3:167932722-167932744 GGCTTCTGCCTGGGAGCTTGAGG + Intergenic
965757236 3:172039698-172039720 GGCTGCCGGCTGGGAAGGCGTGG + Intronic
967241665 3:187445541-187445563 GGCTGCTGCTGGTGAAAGGGTGG + Intergenic
967390194 3:188947776-188947798 GGCTCCTGGCTGGGAAGGGCTGG - Intronic
968190059 3:196660972-196660994 GCCAGCTGCCTCGGACCGGGTGG + Exonic
968350472 3:198048289-198048311 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
968519675 4:1029769-1029791 GTCTGCTGCCAGGGACAGGGTGG + Intergenic
968867816 4:3225091-3225113 GGCTGGTGCCCGGGAATTGGGGG + Intronic
969569582 4:8000753-8000775 GGCTGCTGCCTGGGAACGGGAGG + Intronic
969950589 4:10831336-10831358 GGCTTCTGCCTGGAAAATGGGGG - Intergenic
970917479 4:21352554-21352576 GGCTGCAGCCTGGCAGGGGGAGG + Intronic
973218887 4:47703226-47703248 GGCTGCTGCATGGGAGCTGGTGG - Intronic
973367285 4:49218142-49218164 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
973774294 4:54230866-54230888 GGCTGCGCCCAGGGAGCGGGCGG + Intronic
976118816 4:81757941-81757963 GGCTGCTGCTTGGGAAGGAAAGG - Intronic
977167016 4:93711754-93711776 GGCTGCTGCTGGGGCATGGGCGG + Intronic
979659576 4:123238104-123238126 GGCTGCAGCCTGGCAGGGGGAGG + Intronic
980558723 4:134442863-134442885 GGCTGCAGCCTGGCAGGGGGAGG - Intergenic
981045129 4:140257795-140257817 GGCTGCCACATGGAAACGGGAGG - Intronic
1202766193 4_GL000008v2_random:150493-150515 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
985640817 5:1062750-1062772 GGCTGCTGCAGGGGCACAGGTGG + Intronic
985746589 5:1651833-1651855 GGATGATGCCTGGGGAGGGGTGG + Intergenic
985892286 5:2724963-2724985 TGCTGCTGCCTGAGGAGGGGAGG + Intergenic
986127085 5:4893288-4893310 GGCTGCAGCCTGGTAGGGGGAGG - Intergenic
986402737 5:7395929-7395951 GGCTGCAGGCTGGGGACGGCGGG - Intergenic
986799208 5:11242012-11242034 GACGGCTGTCTGGGAACAGGGGG + Intronic
991663502 5:68973782-68973804 AGCTGATGCCTGGGATGGGGAGG - Intergenic
992077664 5:73206012-73206034 GGCTGCTCTCTGAGAAGGGGTGG + Intergenic
992106625 5:73453407-73453429 GGCTGCTGACCTGGAACAGGAGG - Intergenic
995403775 5:111770652-111770674 GGCTTCAGCCTGGGAGGGGGAGG - Intronic
997529474 5:134573036-134573058 GGCTGCAGGCTGGGCACAGGTGG + Intronic
997820877 5:137064563-137064585 GGCTGCTGACAGGTAAGGGGAGG + Intronic
998193001 5:140042803-140042825 GGCTGCGGCTCGCGAACGGGCGG + Exonic
998353746 5:141517598-141517620 GGCTGCTACCTTTGAAGGGGTGG - Intronic
998725333 5:145006511-145006533 AGATGCTGTCTGGGAAGGGGAGG - Intergenic
999155059 5:149452013-149452035 AGCTGCTGACTGGGATCGGAGGG - Intergenic
999737830 5:154526107-154526129 GGCTGCTTCCTGGAAACCTGTGG + Intergenic
1002951872 6:1821364-1821386 GGCTGGTGGGTGGGGACGGGGGG + Intronic
1003328736 6:5112123-5112145 GGCTGCAGGCAGCGAACGGGTGG - Intronic
1004435209 6:15585813-15585835 GGCAGCTGCCTGGTAACTGGAGG - Intronic
1005279534 6:24258259-24258281 TGCTGCTGGCTGGGGGCGGGGGG + Intronic
1005400146 6:25423614-25423636 GACTGCTGCCTGGGGAAGAGCGG + Intronic
1006474870 6:34247221-34247243 TGCCCCTGCCTGGGAAAGGGAGG - Intronic
1011359832 6:86511433-86511455 GGCTGCTGCCTGGGGATTGGGGG + Intergenic
1011574712 6:88783368-88783390 GGTGGCTGCCTGGAAACGGAAGG + Intronic
1012170764 6:96015325-96015347 AGCTGTTGCCTGGGCAGGGGTGG - Intergenic
1012427723 6:99132212-99132234 GGCCGCTGACTGGGAAGGGCTGG - Intergenic
1013281545 6:108642170-108642192 TGCTTGAGCCTGGGAACGGGAGG - Intronic
1016697461 6:147014736-147014758 AGTTGTTGCCTGGGAACAGGAGG + Intergenic
1017412720 6:154186458-154186480 GGCTGCTGCCTGTGTTCAGGTGG - Intronic
1018668168 6:166158525-166158547 GGCTGCTGCCTGGGAGCCCGGGG + Exonic
1019016921 6:168886511-168886533 GCCTGCGGCCTGGGGACGGAGGG - Intergenic
1019587752 7:1814237-1814259 GGCTGCTGGCGGTGAAAGGGTGG + Intergenic
1020005609 7:4782490-4782512 CGCTGCAGGCTGGGAACGGAGGG - Intronic
1021306625 7:19039964-19039986 GGCTGCAGCCTGGCAGGGGGAGG - Intronic
1022088368 7:27090723-27090745 GGCTGTTGAGTGGGAAAGGGGGG - Intergenic
1022321402 7:29291284-29291306 AGCTGGTGCCAGGGAACGGCTGG - Intronic
1024980934 7:55157063-55157085 GGCAGCTGGCTGGGGCCGGGCGG - Intronic
1025819340 7:64947714-64947736 GGGTGCGGCCTGGGCGCGGGTGG + Intergenic
1026941216 7:74289213-74289235 AGCTGCGGCCTGGGAAGGGAAGG + Intergenic
1027221459 7:76216823-76216845 GGCTGTTGCCTAGCAACGAGAGG + Intronic
1027970995 7:85081549-85081571 GCCTGCTGCAAAGGAACGGGTGG - Exonic
1029238626 7:99143481-99143503 GGCAGGTGCGGGGGAACGGGAGG + Intronic
1029253131 7:99251034-99251056 GGCTGCTGCCTGGGAGCCCAGGG - Intergenic
1029580798 7:101435657-101435679 GGCTGCTGGCTGGGACGGGCTGG + Intronic
1031468699 7:122144310-122144332 GGCTGCTGATTGGCTACGGGAGG - Intergenic
1031607315 7:123785146-123785168 GGCTGCAGCCTGGAAAGTGGAGG - Intergenic
1032281637 7:130507742-130507764 TGCTGCTGCTTGGGAAGAGGTGG - Exonic
1033262803 7:139858181-139858203 GGCTGCTGCCTTGGAACAGATGG - Intronic
1033426075 7:141245292-141245314 GGCTGCCTCCTGGGAAAGGGAGG + Intronic
1034164422 7:149014559-149014581 GGCTGCTTCATGGGGAGGGGAGG - Intronic
1034302442 7:150028644-150028666 AGCTGCTGTCTGGGAAGAGGAGG + Intergenic
1034414103 7:150955882-150955904 GGCCGCTGGCTGGGCACCGGCGG - Intronic
1034489835 7:151387306-151387328 GCCGGCTGCCAGGGAACAGGAGG - Intronic
1034531157 7:151697173-151697195 AGCAGCTGCTGGGGAACGGGGGG + Intronic
1034803618 7:154068673-154068695 AGCTGCTGTCTGGGAAGAGGAGG - Intronic
1034936056 7:155201716-155201738 GCCTGGTGCCTGGGAGTGGGAGG + Intergenic
1035105675 7:156440189-156440211 GGCTGCTCCCTGGGAATGGATGG + Intergenic
1035329398 7:158086243-158086265 GGCTTCAGCCTGGGAGCGGTGGG - Intronic
1035607425 8:939047-939069 GGCCCCTGCCTGGGAGTGGGAGG + Intergenic
1036936082 8:13003941-13003963 GGCTGCTGCCAGGGAGTTGGAGG - Intronic
1039343020 8:36672117-36672139 GGCTGCAGCCTGGCAGAGGGAGG - Intergenic
1039926028 8:41933121-41933143 GGCTGCTGCTGGGGAGGGGGTGG + Exonic
1040598835 8:48864969-48864991 GGCTCCTGCCTGTGGACAGGAGG - Intergenic
1045299304 8:100897329-100897351 GGTTGCTGCCTGGGGTTGGGGGG + Intergenic
1048295967 8:133213292-133213314 GGGTCCTTCCTGGGAAGGGGAGG + Intronic
1049109499 8:140634803-140634825 GGCTGTCGCCTGGAAAGGGGAGG - Intronic
1049195503 8:141313581-141313603 GGCTGCTCCTGGGGAAGGGGCGG - Intergenic
1049740787 8:144239958-144239980 GGGTGCTTCCTGGGAGCAGGTGG + Intronic
1051109890 9:13624103-13624125 GGTAGCTGCCTGGGGATGGGGGG + Intergenic
1052644190 9:31211276-31211298 GGTTCCTGCGTGGGAAGGGGCGG - Intergenic
1052877618 9:33579035-33579057 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1052878067 9:33582092-33582114 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1052878933 9:33588273-33588295 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1052879811 9:33594467-33594489 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1053381221 9:37650934-37650956 GGCTGCAGCCTCGGCGCGGGAGG + Intronic
1053496169 9:38549762-38549784 GGCTTCTGCCTGGAAACAGTGGG - Intronic
1053497041 9:38555946-38555968 GGCTTCTGCCTGGAAACAGTGGG - Intronic
1053498370 9:38565173-38565195 GGCTTCTGCCTGGAAACAGTGGG - Intronic
1053662814 9:40296208-40296230 GGCTGCTGCCTGGAAACAGTGGG + Intronic
1053664201 9:40306044-40306066 GGCTGCTGCCTGGAAACAGTGGG + Intronic
1053665168 9:40312249-40312271 GGCTGCTGCCTGGAAACAGTGGG + Intronic
1053666480 9:40321342-40321364 GGCTTCTGCCTGGAAACAGTGGG + Intronic
1053913261 9:42926383-42926405 GGCTGCTGCCTGGAAACAGTGGG + Intergenic
1053914747 9:42937296-42937318 GGCTGCTGCCTGGAAACAGTGGG + Intergenic
1053916065 9:42946388-42946410 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1054374943 9:64442432-64442454 GGCTGCTGCCTGGAAACAGTGGG + Intergenic
1054376325 9:64452280-64452302 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1054377632 9:64461370-64461392 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1054518129 9:66054941-66054963 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1054519449 9:66064035-66064057 GGCTGCTGCCTGGAAACAGTGGG - Intergenic
1054520415 9:66070241-66070263 GGCTGCTGCCTGGAAACAGTGGG - Intergenic
1054521799 9:66080076-66080098 GGCTGCTGCCTGGAAACAGTGGG - Intergenic
1056585821 9:87926525-87926547 GGCTTCTGCCTGGCAACAGTGGG - Intergenic
1056586281 9:87929576-87929598 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1056610601 9:88123367-88123389 GGCTTCTGCCTGGAAACAGTGGG + Intergenic
1056611061 9:88126418-88126440 GGCTTCTGCCTGGCAACAGTGGG + Intergenic
1056668085 9:88597722-88597744 GGCTGCAGCCTGGCAGGGGGAGG + Intergenic
1057161536 9:92892082-92892104 GGCTTCTGCCTGGAAACGGTGGG - Intergenic
1057653599 9:96936354-96936376 GGCTGCTGCCTGGTCCTGGGGGG + Intronic
1057675642 9:97134228-97134250 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1057676091 9:97137300-97137322 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1057676945 9:97143501-97143523 GGCTTCTGCATGGAAACGGGGGG - Intergenic
1057677386 9:97146606-97146628 GGCTTCTGCCTGGAAACAGCAGG - Intergenic
1057677833 9:97149660-97149682 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1058458510 9:105160638-105160660 GGCTGCTGTCCTGGAACAGGAGG - Intergenic
1060818416 9:126647937-126647959 GGCAGCTCCCTGGGGACAGGAGG - Intronic
1061135167 9:128729628-128729650 GGCTGCAGGCTGGGGACAGGTGG - Intergenic
1061257450 9:129460792-129460814 GGCCGCTGCCTGGGTTCTGGTGG + Intergenic
1061573600 9:131492606-131492628 GGCTGCATCCTGGCAAGGGGAGG + Intronic
1061762561 9:132860532-132860554 GGCTGCTGCTGGGGAGCTGGAGG + Intronic
1061896345 9:133650220-133650242 GGCCGCTGCTTGGGAGCGAGAGG + Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062429323 9:136519981-136520003 GGCTGCTGGCTGGGGCAGGGTGG + Intronic
1062537444 9:137027205-137027227 GGCTCCAGCCTGGGAAGGGAAGG - Intronic
1203778078 EBV:85270-85292 GGCCTCTGCCGGGGAACGGGTGG - Intergenic
1203778100 EBV:85330-85352 GGCCTCTGCCGGGGAACGGGCGG - Intergenic
1203546941 Un_KI270743v1:135382-135404 GGCTTCTGCCTGGAAACAGTGGG - Intergenic
1188589749 X:31819539-31819561 GGCTGCTGCCTGAGAGTGGAAGG - Intronic
1190522887 X:51298377-51298399 GGCTGCTGCCAGGGTGTGGGAGG - Intergenic
1198167234 X:134070061-134070083 AGCTGCTGCCTGGGCAAGGAGGG + Intergenic
1198707783 X:139467780-139467802 GGCTGTTACCGGGGCACGGGTGG - Intergenic
1199681042 X:150224925-150224947 GTCTCCTGCGTGGGAACAGGGGG - Intergenic
1199698497 X:150360517-150360539 GGCTGCTGGCTGGTACCCGGGGG + Intergenic
1200118760 X:153780818-153780840 GGCTGCTGCTTGGGGACCAGGGG - Intronic
1200839086 Y:7761968-7761990 GGCTGCAGCCTGGCAAGGGGAGG + Intergenic
1201180407 Y:11337373-11337395 GGCTGCTGCATGGTAACCTGGGG - Intergenic
1201288973 Y:12403995-12404017 TGCTGCTGTCTGGGACTGGGGGG + Intergenic