ID: 969571337

View in Genome Browser
Species Human (GRCh38)
Location 4:8010423-8010445
Sequence TTCTTACCTGCAGCGGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 95}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969571325_969571337 19 Left 969571325 4:8010381-8010403 CCACGAAGACCCAGGCCTCAGGA 0: 1
1: 0
2: 1
3: 28
4: 246
Right 969571337 4:8010423-8010445 TTCTTACCTGCAGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 95
969571322_969571337 23 Left 969571322 4:8010377-8010399 CCCGCCACGAAGACCCAGGCCTC 0: 1
1: 0
2: 2
3: 19
4: 184
Right 969571337 4:8010423-8010445 TTCTTACCTGCAGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 95
969571330_969571337 4 Left 969571330 4:8010396-8010418 CCTCAGGAAGGACACGCCGAGGT 0: 1
1: 0
2: 0
3: 4
4: 86
Right 969571337 4:8010423-8010445 TTCTTACCTGCAGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 95
969571327_969571337 10 Left 969571327 4:8010390-8010412 CCCAGGCCTCAGGAAGGACACGC 0: 1
1: 0
2: 0
3: 19
4: 182
Right 969571337 4:8010423-8010445 TTCTTACCTGCAGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 95
969571319_969571337 28 Left 969571319 4:8010372-8010394 CCCAGCCCGCCACGAAGACCCAG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 969571337 4:8010423-8010445 TTCTTACCTGCAGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 95
969571320_969571337 27 Left 969571320 4:8010373-8010395 CCAGCCCGCCACGAAGACCCAGG 0: 1
1: 0
2: 0
3: 18
4: 131
Right 969571337 4:8010423-8010445 TTCTTACCTGCAGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 95
969571323_969571337 22 Left 969571323 4:8010378-8010400 CCGCCACGAAGACCCAGGCCTCA 0: 1
1: 0
2: 1
3: 12
4: 157
Right 969571337 4:8010423-8010445 TTCTTACCTGCAGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 95
969571318_969571337 29 Left 969571318 4:8010371-8010393 CCCCAGCCCGCCACGAAGACCCA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 969571337 4:8010423-8010445 TTCTTACCTGCAGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 95
969571328_969571337 9 Left 969571328 4:8010391-8010413 CCAGGCCTCAGGAAGGACACGCC 0: 1
1: 0
2: 1
3: 20
4: 182
Right 969571337 4:8010423-8010445 TTCTTACCTGCAGCGGGCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969571337 Original CRISPR TTCTTACCTGCAGCGGGCGG CGG Intronic
902697763 1:18151714-18151736 TCCTTAACTGCAGGGGGCTGTGG + Intronic
907294211 1:53439332-53439354 TTCTCGCCTGCAGCGCTCGGCGG + Intergenic
915756629 1:158267353-158267375 CTCTTACGTGCAGCGGCCGCAGG - Intergenic
920556667 1:206909455-206909477 AGCTTACCTGCAGCGGGGCGGGG + Exonic
921782949 1:219190158-219190180 ATCATACATGCAGTGGGCGGGGG - Intronic
924227716 1:241935728-241935750 TTCTTATCTGCTGGGCGCGGTGG - Intergenic
1068941035 10:62681578-62681600 CTCTCACTTGCAGCGGGCTGAGG - Intergenic
1069317323 10:67122486-67122508 TTATTATCTGCATGGGGCGGGGG + Intronic
1070667968 10:78358753-78358775 TTCTTCCCTGCAGAAGGTGGTGG + Intergenic
1073724478 10:106213843-106213865 TTCTTACCTTGAGTGGGGGGTGG + Intergenic
1074130119 10:110566804-110566826 TTGTCTCCAGCAGCGGGCGGGGG + Intergenic
1075683504 10:124348675-124348697 ATATTACCTGCAGAGGGCTGGGG - Intergenic
1076844475 10:133062354-133062376 TTCTTCCCAGGAGCGGACGGTGG - Intergenic
1083968409 11:66057346-66057368 TTCTCATCTCCAGGGGGCGGTGG - Exonic
1087094665 11:94307408-94307430 TTCTTCCCTGCAGGGGATGGAGG - Exonic
1088889928 11:114036327-114036349 TTCTGGCCTCCAGCGGACGGAGG + Intergenic
1096771380 12:53938219-53938241 TTCTTTCCAGCCGCGAGCGGAGG + Intergenic
1102133850 12:110555952-110555974 TTCTTCCCTGAAGCAGGCAGTGG - Intronic
1104639539 12:130458538-130458560 GCCTTGCCTGCAGCGGGCAGTGG - Intronic
1108712046 13:53043249-53043271 TGCTTACCTGGAGTGGGAGGAGG - Exonic
1110618829 13:77572137-77572159 TTGTAACCTGGAGGGGGCGGTGG - Exonic
1113509940 13:110845527-110845549 TTCTTATCTGCAGAAGGCAGTGG + Intergenic
1113834072 13:113317304-113317326 GTCTTTCCTGCTGAGGGCGGAGG - Intronic
1122049546 14:99046436-99046458 TTCTTTCCTGCATCAGCCGGAGG - Intergenic
1122900179 14:104779164-104779186 TCCTTACCTGTAGCGGGGGCAGG - Intronic
1125061963 15:35436177-35436199 TTCTTTCCTGCTGGGCGCGGTGG + Intronic
1127368154 15:58310484-58310506 TGCTTAGCTGCAGAGGGCGTTGG - Intronic
1129158038 15:73731055-73731077 TTCTGACCTGCAGGGGGTGAGGG - Intergenic
1132249579 15:100325186-100325208 TTCTTACCTGCACCATGGGGTGG - Intronic
1137502910 16:49025049-49025071 TTCTCACATGCAGCGGGCAGGGG - Intergenic
1138415977 16:56871520-56871542 TTCTGACCTGCAGCTGTCAGAGG + Intronic
1143641413 17:8200328-8200350 TTCTTCCCTTGAGCGGGCTGTGG - Intergenic
1146638796 17:34525251-34525273 TTCTTAACTGCAGGGGTAGGGGG - Intergenic
1149317658 17:55453702-55453724 TTCCTACCTGCAGGGGTGGGAGG - Intergenic
1152211022 17:79003391-79003413 CTCTTGCCTGCAGCAGGCGCCGG - Intronic
1155763452 18:29597252-29597274 TGGTTACCTGGAGCTGGCGGGGG + Intergenic
1161703112 19:5805436-5805458 TGCTTACCTGCTGTGGGCGCCGG - Intergenic
1162396355 19:10420092-10420114 GCGGTACCTGCAGCGGGCGGCGG - Intronic
1166902686 19:46077789-46077811 TTCTTGCCTGCAGGGGTCGCAGG + Intergenic
1168332516 19:55578636-55578658 TTCTTGCCCGCCGCGGGCAGCGG + Exonic
926096093 2:10081050-10081072 TTCTTTCCTGTGGCGGGGGGAGG - Intergenic
926714740 2:15915243-15915265 TTCTTTCCTGCAGCTGTCAGGGG - Intergenic
927970912 2:27306067-27306089 TTCTTCCCTGCAGCAGGCCAAGG + Exonic
928033372 2:27799887-27799909 TTCTTGCCTGCAGGAGGCTGAGG + Intronic
928724031 2:34150380-34150402 TTCTTACCAGCAGCGTGCAAGGG - Intergenic
930034301 2:47075952-47075974 TTCTTCCCTGCAGCTGAAGGTGG - Exonic
933723129 2:85410608-85410630 CTGTGACCTGCAGCGGGCTGAGG - Intronic
937394620 2:121524092-121524114 TTCATACCTGGGGTGGGCGGTGG - Intronic
944746326 2:202660358-202660380 ATCTTACCTTCAGTGGGCTGTGG + Intronic
945085694 2:206129877-206129899 TTATTACCTGCCGGGTGCGGTGG - Intronic
947552664 2:231057387-231057409 TTCTTGCCCGCAGGGGGCCGGGG + Intronic
948990470 2:241551462-241551484 TTCCTACCTGCAGTGAGCGATGG - Intergenic
1171122428 20:22578503-22578525 TCCCTACCTGCGGCGGCCGGCGG + Intergenic
1172066791 20:32227078-32227100 TTCTTCCCTCCAGCTGGAGGGGG - Intronic
1172287189 20:33749057-33749079 TTCTTACCTGCACAGGTGGGGGG - Exonic
1174039435 20:47688571-47688593 CTCATCCCTGCAGCGGGTGGAGG - Intronic
1176652231 21:9560543-9560565 TTATTACCAGCAGCGTACGGAGG + Intergenic
1180135834 21:45861208-45861230 TTCTCACCTGCTGTGTGCGGTGG - Intronic
1182144429 22:27988573-27988595 TTCTTTCCTGCCGGGTGCGGTGG - Intronic
1184744450 22:46448139-46448161 GGCTTACCTGCTGCAGGCGGGGG + Intronic
952449837 3:33421289-33421311 TTTTTTCTTGCAGGGGGCGGGGG + Intronic
953306781 3:41838902-41838924 TGCTTACCTGAAGCTGGGGGTGG + Intronic
957346925 3:78972877-78972899 TTCCTACCTGGAGCTGGCAGGGG + Intronic
966941223 3:184748720-184748742 TTCTCACCTGCAGGGGGAGAGGG - Intergenic
969571337 4:8010423-8010445 TTCTTACCTGCAGCGGGCGGCGG + Intronic
970654728 4:18218614-18218636 TTCTTACCTGTAGTAGGCAGAGG + Intergenic
977140312 4:93362927-93362949 TCCTTACCTGCAGCGGGGCACGG + Intronic
984146379 4:176066064-176066086 TTCTTACCTGGAGGAGGAGGCGG - Exonic
984349214 4:178569658-178569680 TTCTTACCTGCACTGGTCTGGGG + Intergenic
984973519 4:185210240-185210262 TACTTACCCCCGGCGGGCGGCGG - Intronic
984995703 4:185427796-185427818 TTCTTACCAGCCGGGCGCGGTGG + Intronic
985714165 5:1446239-1446261 TTCTTCCATTCAGCGCGCGGAGG + Intergenic
990944474 5:61235498-61235520 TGCTTACCTGCAGGGAGAGGGGG + Intergenic
996878221 5:128263343-128263365 CTCTTCCCTGCAGTGGGGGGTGG + Intronic
1002330043 5:178434850-178434872 TGCCTTCCTGCAGCGGGCAGAGG - Intronic
1002791006 6:437469-437491 TTTTTACGTGCAGAGGTCGGTGG + Intergenic
1005840838 6:29743766-29743788 TCCTCACCTGCAGCAGGAGGAGG + Intergenic
1005850181 6:29814985-29815007 TCCTCACCTGCAGCAGGAGGAGG + Intergenic
1006543023 6:34756102-34756124 TTATTACCTGCCGGGCGCGGTGG + Intergenic
1014542471 6:122693305-122693327 TTCTCACTAGCAGGGGGCGGTGG - Intronic
1016936356 6:149451473-149451495 TTCTTGCCTGAAAGGGGCGGGGG + Exonic
1019167873 6:170110853-170110875 TTCTCACCTGCAGAAGGAGGCGG + Intergenic
1019416382 7:928738-928760 TTCCCACCAGCAGCGTGCGGGGG - Intronic
1022413304 7:30156119-30156141 TTCTTGCCTGCACCAGGAGGTGG + Intronic
1024513491 7:50221617-50221639 TTCATACCTGCATGGGGCAGGGG + Intergenic
1029600352 7:101559653-101559675 TTCTTACCTCCAGAGGGTGAGGG + Intergenic
1039604253 8:38867685-38867707 TTGTTACCTGGAGGGGGTGGCGG + Intergenic
1040006099 8:42622179-42622201 TACTTACCTGCAGCTGGCCTGGG + Intergenic
1041659139 8:60384073-60384095 TTCTTACCTTCAGTGGCAGGAGG - Intergenic
1043930364 8:86083742-86083764 TTCTTACCTGCACCCAGAGGTGG + Intronic
1047934644 8:129764873-129764895 TTCTTCCCTGCTGCAGGTGGGGG + Intronic
1049237503 8:141519415-141519437 TTGTCACCTGCAGAGGGAGGTGG - Intergenic
1058875917 9:109244709-109244731 TTCTGGCCTGCAGAGGGCAGTGG + Intronic
1061039524 9:128131858-128131880 ATCTCACCAGCAGCTGGCGGTGG - Intergenic
1061149681 9:128821617-128821639 TTCTGGCCTGCAGAGGGCTGGGG + Exonic
1203629960 Un_KI270750v1:64088-64110 TTATTACCAGCAGCGTACGGAGG + Intergenic
1185860347 X:3572648-3572670 TTCATACCTGAAGTGGGTGGAGG + Intergenic