ID: 969571753

View in Genome Browser
Species Human (GRCh38)
Location 4:8012901-8012923
Sequence AAGGGTGAACAGAGGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 490}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969571753 Original CRISPR AAGGGTGAACAGAGGGTAGA TGG (reversed) Intronic
900078233 1:835127-835149 GTGGGTGAACAGGGGGTGGAGGG - Intergenic
902380255 1:16049306-16049328 AGGGGTGTACACAGGGGAGAAGG - Intronic
902408181 1:16197949-16197971 AAGGGTGACCAGGGGGCAGGGGG - Intronic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
903074239 1:20750094-20750116 TAGGGTGGATGGAGGGTAGATGG - Intronic
904849055 1:33443486-33443508 CAGGGAGAACAGCAGGTAGAGGG + Intergenic
904982309 1:34516833-34516855 GAGGGTGAAGAGTGGGAAGAGGG - Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
908421305 1:63961083-63961105 AAGGATGAATGGAGGGAAGAAGG - Intronic
909462003 1:75927511-75927533 AAGGGTGAACAGAGGTTGGGAGG + Intronic
909564655 1:77040979-77041001 AAGAGTTGACAGAGGGTTGATGG - Intronic
910491145 1:87773039-87773061 AAGGGAGAAAAAAGGGGAGAAGG + Intergenic
910682680 1:89883412-89883434 AAGCATGACCAGAGGGTAAAGGG + Intronic
911445387 1:97985638-97985660 AACGGTGAGCAGAAGGAAGATGG - Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
912007477 1:104922250-104922272 AAGAGTGAACTGATTGTAGAAGG - Intergenic
912681936 1:111734310-111734332 AAAGGTGGTCAGAGGGAAGAGGG - Intronic
913361917 1:117990043-117990065 AAGGGTGACCACAGAGTATAGGG + Intronic
914702208 1:150145080-150145102 AAGGGTTATCAGAGCCTAGAGGG + Exonic
914860532 1:151382123-151382145 TAGGGTGGACTGAGGGGAGAGGG - Intergenic
915074782 1:153299087-153299109 AGGGGTGAGCATGGGGTAGAGGG - Intronic
915615336 1:157033461-157033483 AAGGGTGGAGAGAGGGAAGATGG - Intronic
915919303 1:159962210-159962232 AAGGGAAAACATGGGGTAGAGGG + Intergenic
915921897 1:159981984-159982006 AAGGATGAAGAGCGGGCAGAAGG - Intergenic
915937997 1:160100021-160100043 AAGGGGGATGAGAGGGGAGAGGG - Intergenic
916150938 1:161789343-161789365 AATCATGAACATAGGGTAGAAGG - Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916921674 1:169475631-169475653 GAGAGTCAACAGAGGGTTGATGG - Intronic
917312838 1:173694706-173694728 AAGGGGGAAGAGTGGGTAGGAGG - Intergenic
918105973 1:181415511-181415533 GAGGGTAACCAGAGGGTATAGGG + Intronic
919091079 1:192979579-192979601 AAGGAGGAACGGAGGGTGGAAGG + Intergenic
919201882 1:194365694-194365716 ATGGGGAAACAAAGGGTAGAAGG - Intergenic
920372298 1:205486792-205486814 AAGGGAGGACAGAGAGTTGAGGG - Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
922344178 1:224682387-224682409 AAGAGGCAACACAGGGTAGATGG - Intronic
922598824 1:226834497-226834519 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
922792946 1:228320421-228320443 AATGGTGAATAGATGATAGATGG - Intronic
924860984 1:247921838-247921860 AGGGGTGAACATAGTATAGAAGG - Exonic
924890443 1:248272972-248272994 AGGGGTGAACATAGTATAGAAGG + Exonic
924892093 1:248294736-248294758 AGGGGTGAACATAGTATAGAAGG + Exonic
1062812569 10:477544-477566 AAGGGGGAAAGGAAGGTAGATGG + Intronic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063094096 10:2894021-2894043 AAAGGTGAAAAGAGGGGAAAAGG + Intergenic
1063250011 10:4264037-4264059 AAGGGTCAAGAGAGGGAAGCAGG - Intergenic
1063690211 10:8280079-8280101 AAGGAAGAAGAGAGGGTGGAAGG + Intergenic
1063886545 10:10585375-10585397 AAAGGTGTACAGAGGACAGAAGG - Intergenic
1065169832 10:23015725-23015747 ATGGGTAAAAAGAGGGTAGTGGG - Intronic
1065223770 10:23522401-23522423 AAGGGAGAACAGAGGAGCGAGGG - Intergenic
1066190010 10:33047486-33047508 AAGGGAGAGAAGAGGGTGGATGG + Intergenic
1067502397 10:46816757-46816779 AAAGGCAAACCGAGGGTAGATGG - Intergenic
1068200427 10:53776797-53776819 AAGGGAGAACACATGGTATATGG - Intergenic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1069190414 10:65480211-65480233 AAGGGGGAAAAGAGGGAAGTAGG + Intergenic
1069667388 10:70172009-70172031 CAGGATGAGCGGAGGGTAGAGGG - Intergenic
1069724366 10:70567668-70567690 AAGGGTGCACTGAGGGTGGTGGG + Exonic
1070219891 10:74430356-74430378 ATAGGTGAACAGAGGGAAGTGGG - Intronic
1070630726 10:78082598-78082620 AAGGCTGGACAGAGAGGAGAGGG - Intergenic
1071187087 10:83058393-83058415 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071897875 10:90085490-90085512 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1072806630 10:98427545-98427567 AATGGTGGTCAGGGGGTAGAGGG + Intronic
1073378736 10:103060773-103060795 AAGGTTGAAAACAGGGTGGAAGG + Intronic
1073494534 10:103879471-103879493 AAGGCTGGAAAGAGGGCAGAGGG + Intergenic
1073730465 10:106281482-106281504 GAGTGAGAAGAGAGGGTAGAAGG + Intergenic
1074543208 10:114383373-114383395 AAGGGTGAAGGGAGGGAAGGAGG + Intronic
1074740631 10:116481907-116481929 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1074846127 10:117399630-117399652 AAGGGTGCACAGAAGAAAGATGG - Intergenic
1075518199 10:123126484-123126506 AAGGCTGGACAGAGGGCAGGAGG - Intergenic
1075955424 10:126519162-126519184 AAAGGTGAACAGAGTGGAGAGGG + Intronic
1076570957 10:131432538-131432560 GAGAGTGCACAGAGGGGAGAGGG + Intergenic
1077298161 11:1835603-1835625 GTGGGTGAACAGAGGTGAGAAGG + Intronic
1077498723 11:2899248-2899270 AAGGGTGTACAGTGGGGTGACGG - Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1079865925 11:25733667-25733689 AAGGGGGAAAAAAGAGTAGAAGG + Intergenic
1080127527 11:28754454-28754476 AGGGAGGAACAGAGGGAAGAAGG + Intergenic
1080272805 11:30468532-30468554 AAGGGGAAAAAGAGGGTAAAAGG + Intronic
1080275957 11:30503719-30503741 ATGGGAGAATAGAGGGGAGAGGG - Intronic
1081786853 11:45753810-45753832 GAGGGTGGACGGAGGGGAGAGGG + Intergenic
1081896063 11:46587657-46587679 AAGGGCTGACAGAGGGAAGAAGG - Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082711454 11:56558648-56558670 AAGGGTGGAAAGAGGTTAGCTGG + Intergenic
1083221839 11:61257879-61257901 AAGGGTGGAGGGAGGGTAGAGGG + Intergenic
1083347184 11:62001673-62001695 AGGGGTGAATAGAGGGGTGAGGG + Intergenic
1083446374 11:62710298-62710320 AAGGGTGCACAGAGGCGAGATGG + Intronic
1084486579 11:69451682-69451704 AAGGAAGAAAAGAGGGAAGATGG + Intergenic
1084785708 11:71440573-71440595 ATGGGTGATGGGAGGGTAGATGG + Intronic
1085016194 11:73175608-73175630 AAGGCCGCACAGATGGTAGATGG + Intergenic
1086571318 11:88287692-88287714 AATGGTTAACAGAGGCTGGAAGG - Intergenic
1086957263 11:92946225-92946247 GTGGGGCAACAGAGGGTAGAAGG + Intergenic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1087729540 11:101762684-101762706 AAGGGTGGAGAGTGGGAAGAGGG - Intronic
1088598680 11:111457520-111457542 AAGGGTGGAAAGAGGGTCGTGGG - Intronic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089166403 11:116480622-116480644 ATGGATGAACAGTGGGAAGATGG + Intergenic
1089777453 11:120848278-120848300 AAAGGTGAACAGAGCATAGGAGG - Intronic
1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG + Intronic
1091633517 12:2180128-2180150 AAGGTTGAGCACACGGTAGATGG + Intronic
1092139629 12:6173950-6173972 GAGGGTGAACAGATGCTAAATGG + Intergenic
1093027224 12:14255953-14255975 AAGCTTGACCAGAGGGTAGGAGG + Intergenic
1093071366 12:14709586-14709608 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1093220995 12:16420553-16420575 AAGGGAGGAGAAAGGGTAGAAGG + Intronic
1093322131 12:17724737-17724759 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1093990934 12:25589779-25589801 TAGGCTGAAGAGAGTGTAGATGG + Intronic
1094019574 12:25899990-25900012 AAGGGGGAAGAAAGGGTAAAGGG - Intergenic
1096815793 12:54200993-54201015 AAGGCTGAACAAAGGGAAGTTGG - Intergenic
1097373669 12:58815330-58815352 AGTGGGGAACAGAGGGCAGATGG + Intergenic
1097542345 12:60956446-60956468 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1097808176 12:63988421-63988443 AAGGGAGATCTCAGGGTAGAGGG + Intronic
1097888472 12:64754160-64754182 AGTGGTGGACAGAGGATAGATGG + Intronic
1098009050 12:66031120-66031142 AAGGGGGAGCAGAGGGGAAATGG - Intergenic
1098098801 12:66990478-66990500 AAGAGAGAAAAGAGGGAAGAAGG + Intergenic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1099076075 12:78111019-78111041 AAGGATGAATGGAGGGTAGGAGG + Intronic
1099279716 12:80628814-80628836 AAAGTAGAACAGAGGGAAGAAGG + Intronic
1099292238 12:80787528-80787550 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1100224077 12:92538809-92538831 AACAGTGAATACAGGGTAGAGGG - Intergenic
1100740801 12:97590025-97590047 AGGGGTGAACACAAGGTAGGTGG + Intergenic
1101410568 12:104464443-104464465 AAGGGGGAGCAGGTGGTAGAGGG - Intronic
1101719652 12:107340467-107340489 AAGGGGGAAGAGATGGGAGAAGG - Intronic
1101720413 12:107345813-107345835 AAGAGGAAACAGTGGGTAGAAGG + Intronic
1101861351 12:108484928-108484950 AGGGAGGAAGAGAGGGTAGAGGG + Intergenic
1103004404 12:117409538-117409560 AGGGGTGGATAGAGGGTAGATGG + Intronic
1106057216 13:26249663-26249685 ATGGGTGAATAGATGATAGATGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1108144302 13:47460723-47460745 AGTGGTGGACAGAGGGTAAAAGG + Intergenic
1108147526 13:47495274-47495296 AAGGATGAAGGGAGGGAAGAAGG + Intergenic
1108775350 13:53759099-53759121 AAGAATGAAAAGAGGGAAGAAGG - Intergenic
1109038966 13:57306038-57306060 AAGGGGAAACAGAGGGGAGTAGG - Intergenic
1109311911 13:60705116-60705138 AAGGCCTATCAGAGGGTAGAAGG + Intergenic
1109525361 13:63567293-63567315 AAGGGTGAGCAGAGTGGTGAGGG - Intergenic
1110223574 13:73097018-73097040 AAGGGAGATCAGATGGTATATGG + Intergenic
1111448326 13:88379948-88379970 AAGGGTGGATAGAGGGTGGGAGG - Intergenic
1111899181 13:94180106-94180128 AAGGGAGTAGAGAGGGTACAAGG + Intronic
1112142895 13:96665535-96665557 AAGGATGAATAGAGTTTAGAAGG + Intronic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114937341 14:27557238-27557260 AAGGGTGAAGTGTGGGTGGAAGG + Intergenic
1116676611 14:47914209-47914231 AAGAGTGGAAAGAGGGTAAATGG + Intergenic
1116743659 14:48790524-48790546 AAGGATGAAAGGAGGGAAGAAGG + Intergenic
1117814969 14:59588075-59588097 AAGAATGAAGAAAGGGTAGAGGG - Intergenic
1117863427 14:60118516-60118538 AAGGGTGAAAAGAGGGAGTAAGG - Exonic
1118054424 14:62064611-62064633 ATGGGGAAACAGATGGTAGAGGG + Intronic
1118436281 14:65773615-65773637 AAGAGGTGACAGAGGGTAGATGG - Intergenic
1118561272 14:67086295-67086317 AAGGAAGAGCAGTGGGTAGAGGG + Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119065634 14:71523422-71523444 AAAGGTGGGCAAAGGGTAGATGG - Intronic
1119316973 14:73704400-73704422 AAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1119483865 14:74975889-74975911 AAGGGGGCACAGAGGGGAGATGG - Intergenic
1119546287 14:75474253-75474275 AAGGGTGGAAAGAGGTTAGCTGG + Intergenic
1120146029 14:80979354-80979376 AAGGCTGTGCAGAGGGTAGGGGG + Intronic
1120251541 14:82065542-82065564 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1120336101 14:83157065-83157087 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1120389870 14:83892431-83892453 AAAGATTAACAGAGAGTAGAGGG + Intergenic
1120768619 14:88354926-88354948 ATGGGTGAAGGAAGGGTAGATGG - Intergenic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1122102069 14:99420621-99420643 AAGAGGGAACATAGGATAGAAGG - Intronic
1122507479 14:102240870-102240892 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1126735670 15:51729886-51729908 AGTGTTGAACAGAGGGTAGGTGG - Intronic
1128773637 15:70302259-70302281 AAGGATGGACAGAGGGTAGATGG + Intergenic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1129047187 15:72746123-72746145 AAGGATGAACAGAGCACAGAGGG + Intergenic
1129181802 15:73882413-73882435 AAGGGTGAACCAAGGACAGAGGG - Intronic
1130154325 15:81336608-81336630 AAGGTTGCCCAGATGGTAGAAGG - Exonic
1130288308 15:82573407-82573429 AAGGGTGAACATAGAGAAGCAGG - Intronic
1131164707 15:90134038-90134060 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1131447586 15:92512766-92512788 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1132149893 15:99451903-99451925 AAGGATGGACAGAGGGGAGATGG - Intergenic
1132262864 15:100441534-100441556 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1132712021 16:1273085-1273107 ATGGGTAGACAGATGGTAGATGG + Intergenic
1134216948 16:12323531-12323553 AATGGTGAACAAAGGTTAGCAGG + Intronic
1134632535 16:15767179-15767201 AAGGATGAGTAGAGGATAGATGG + Intronic
1135484944 16:22856041-22856063 AAGGATGAATAGTTGGTAGATGG + Intronic
1136848869 16:33598080-33598102 AAAGGAGAACAGAGGTTAGCTGG - Intergenic
1137935369 16:52630153-52630175 GAGAGTGAACAGAGGGGAGGAGG + Intergenic
1138544215 16:57706383-57706405 ATGGGAGAACAGTGGGTAGGAGG - Intronic
1138544324 16:57706741-57706763 ATGGGAGAACAGTGGGTAGGAGG - Intronic
1139039551 16:62984224-62984246 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039568 16:62984285-62984307 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039585 16:62984346-62984368 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039602 16:62984407-62984429 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139039651 16:62984593-62984615 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1139265569 16:65635463-65635485 CAGGGGGAACACAGGGTAGGTGG - Intergenic
1139369482 16:66457903-66457925 AATGGTGAACAGAGGGAAAATGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140310613 16:73844810-73844832 ATGGGTAGACAGATGGTAGACGG + Intergenic
1141337018 16:83165573-83165595 AAGAGTGGACAGTGGGTACAGGG + Intronic
1141619594 16:85229873-85229895 CAGGGTGAGAAGGGGGTAGAGGG + Intergenic
1141980728 16:87548294-87548316 AGGGGTGGAGAGAGGGGAGAAGG + Intergenic
1142152421 16:88518559-88518581 AAGGATGGATAGTGGGTAGATGG + Intronic
1142152506 16:88518904-88518926 AAGGATGGATAGTGGGTAGATGG + Intronic
1203110576 16_KI270728v1_random:1446730-1446752 AAAGGAGAACAGAGGTTAGCTGG - Intergenic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1143757246 17:9075971-9075993 AAGGGTGAACCTGGGGTTGAGGG - Intronic
1143900388 17:10170137-10170159 AGGGGGGAGCAGAGGGTAGAAGG - Intronic
1144048029 17:11470825-11470847 AAGGGTGAGCATAGGTTAGGGGG + Intronic
1146919542 17:36701247-36701269 ATTGTTGAACAGATGGTAGAGGG + Intergenic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147396758 17:40149445-40149467 AAGGCTGAAGAGATGGTAGTTGG + Intronic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1148160811 17:45449275-45449297 ATGGGTGGACGGTGGGTAGATGG - Intronic
1148701475 17:49589549-49589571 TTGGGTAAATAGAGGGTAGACGG + Intergenic
1149914066 17:60592271-60592293 AAGGGGGAAGAGGGGGTGGAGGG + Intergenic
1150909023 17:69369037-69369059 AACTGTGAACAGTGGGAAGATGG - Intergenic
1151246172 17:72796562-72796584 AAAGGAGAACAGAGGGGAAAGGG + Intronic
1152395723 17:80031633-80031655 AAGGGTGCACAAATGGCAGATGG - Intronic
1152531157 17:80920037-80920059 AAGGGTGAACAGAGAGGGCACGG - Intronic
1153380654 18:4435489-4435511 AAGGGGGAAGAGAGGGGAAACGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157085207 18:44573436-44573458 AAGGGAGAATGGAGGGTAGAAGG + Intergenic
1157221586 18:45832071-45832093 GAGTGTGAACAGAGGGTGGTGGG - Intronic
1157852166 18:51065311-51065333 AAGGGTAAAGGGAGGGGAGATGG - Intronic
1157903493 18:51543627-51543649 AAGACTGAACAGAAAGTAGAAGG + Intergenic
1158187226 18:54784443-54784465 AATGGGGAACAGAGGGTGGAGGG - Intronic
1158576848 18:58645435-58645457 AAGGGAGAATGGAGGGTGGAAGG + Intergenic
1159164275 18:64682687-64682709 AAGGGTGAAGAAGGGGTTGAGGG - Intergenic
1159726995 18:71973563-71973585 AAGAGAGAACAGAGGGAAAAGGG + Intergenic
1161026427 19:2039350-2039372 GAAGGTGAGCAGAGGGTAGGTGG - Exonic
1163383581 19:16985433-16985455 AAGGAGGGAGAGAGGGTAGATGG + Intronic
1163395806 19:17060399-17060421 AAAGGTGGAAAGAGAGTAGAGGG - Intronic
1163779934 19:19240735-19240757 AAGGGTAAACTGAGGCCAGATGG - Intronic
1164202644 19:23031268-23031290 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1164258613 19:23550495-23550517 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1165146604 19:33734917-33734939 CAAGCTGAACAGAGGGTAAACGG + Intronic
1166318373 19:42001635-42001657 AAGGCTCAACAAAGGGTGGAGGG - Intronic
1166976902 19:46610108-46610130 AAGGGTGGGGAGAGGGAAGATGG + Exonic
1167376272 19:49114110-49114132 AAGGATGGACAGGGGATAGACGG + Intergenic
1168184755 19:54692577-54692599 AAGGGTGGGAAGAGGGGAGAGGG + Intronic
1168433798 19:56302294-56302316 GAGGGAGAAAAGAGGGAAGAAGG - Intronic
1168442312 19:56380528-56380550 AAGGGAGCATAGAGGGTATAGGG - Intronic
1168490699 19:56806420-56806442 AAGGGGGAGGAGAGAGTAGAAGG + Intronic
926341489 2:11908364-11908386 AAGAGGAAACTGAGGGTAGAGGG + Intergenic
926869673 2:17400156-17400178 AAGCATGAATATAGGGTAGAAGG - Intergenic
927285138 2:21349543-21349565 AATTTTGGACAGAGGGTAGAGGG - Intergenic
927291131 2:21406000-21406022 AAGGGGGAACAGGGTTTAGACGG + Intergenic
927374294 2:22395559-22395581 CAGGGTGAACAAAAGATAGAAGG + Intergenic
927612671 2:24557540-24557562 AAGGGGGAAGGGAGGGGAGAAGG - Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928840123 2:35595955-35595977 AAGGATGAACTGATGGTAGTTGG - Intergenic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
929878732 2:45818571-45818593 GAGGATGAAAGGAGGGTAGAAGG - Intronic
930325615 2:49913659-49913681 AAGGGTGTAAAGAGGTAAGAGGG + Intergenic
930460704 2:51671074-51671096 AATGGTGAAGAGAAGGTATAGGG - Intergenic
930539477 2:52687158-52687180 AAGGGTGTACAGGTGGTAGGAGG + Intergenic
931037273 2:58257636-58257658 AACTGTGAACTGAGGGGAGAGGG + Intergenic
931322252 2:61182495-61182517 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
932801867 2:74748144-74748166 AGGGGTGCACAGAGGGGAGTAGG - Intergenic
932887690 2:75561706-75561728 AAGCTTGGACAGAGGGAAGACGG + Intronic
933232086 2:79819618-79819640 AAAAGTCAACAGAGGCTAGAAGG + Intronic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
936403657 2:112184271-112184293 ACGGGAGAAGAGAGGGCAGAGGG + Intronic
938201428 2:129376026-129376048 AAGGCTGAACACAGGGCTGAGGG - Intergenic
938555674 2:132421827-132421849 GAGAGAGAAGAGAGGGTAGAGGG + Intronic
938731102 2:134148459-134148481 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
939307262 2:140427394-140427416 AAGGACGAACGGAGGGTGGAAGG - Intronic
940927071 2:159376071-159376093 AAGCATGAACAGAAGGTACACGG + Intronic
941139679 2:161763816-161763838 AAGGGTTAATAGAGGATATATGG + Intronic
941498906 2:166243850-166243872 AAGGGTGAATAGAGAGGAGTAGG + Intronic
941521472 2:166549920-166549942 AATCATGAACAGAGAGTAGAAGG - Intergenic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
943357358 2:186873588-186873610 AAATGTGAAAAGAGGGTATAGGG - Intergenic
943489396 2:188531629-188531651 AATGGTGAAAAGATAGTAGAGGG + Intronic
943835004 2:192507301-192507323 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
944226608 2:197354923-197354945 AAGCATGATCAGAGGGTAGAGGG + Intergenic
944318979 2:198313594-198313616 AAGGGGAAACAGAGGAGAGAAGG - Intronic
946869330 2:224071783-224071805 AAGGCTGCACAGTGGGAAGAAGG - Intergenic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
948430122 2:237913522-237913544 AGGGGGGAACAGAGGAGAGAAGG - Intergenic
948458403 2:238117888-238117910 GAGGGTGGACAGAGGAGAGATGG + Intronic
1168975589 20:1963144-1963166 AGGGGTGGATAGAGGGAAGAAGG + Intergenic
1169003665 20:2189032-2189054 TATTGTGAACAGAGTGTAGAGGG - Intergenic
1169508108 20:6234637-6234659 AATGGTGAACAGAGGAGACAAGG - Intergenic
1171108705 20:22460554-22460576 AAGGATGCAGGGAGGGTAGAGGG - Intergenic
1171943967 20:31359286-31359308 AAGGCAGAACAAAGGGAAGAAGG + Intergenic
1172224836 20:33298467-33298489 AAGGGCGACCAGAGAGGAGAAGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173845638 20:46186709-46186731 AAGGGTGAGGAGGGGATAGAGGG + Intronic
1174298500 20:49565891-49565913 AAGGGTCAACAGTGGGTAGTGGG - Intronic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1175781016 20:61682132-61682154 ATGGGTGGATAGAGGGTAGATGG + Intronic
1175798956 20:61790121-61790143 ATGGGTGGACAGAGGATGGATGG - Intronic
1176033099 20:63023319-63023341 AAGGGTGTGAAGAGGGAAGAGGG - Intergenic
1176370426 21:6058879-6058901 AAGGGTGAGCAGAGGTCCGAGGG + Intergenic
1177126349 21:17198035-17198057 AAGAGGGAACAGTGGGCAGATGG - Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177259190 21:18706936-18706958 AAGGGGGAAGAGGGGGAAGACGG - Intergenic
1178267806 21:31160300-31160322 AAGGGTATCCAGAGGGTAAAAGG + Intronic
1179753093 21:43479662-43479684 AAGGGTGAGCAGAGGTCCGAGGG - Intergenic
1179874838 21:44262358-44262380 AAGGGTGAAGAAAGGGATGAGGG + Intergenic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1181656008 22:24299442-24299464 AACGGTGAACAGGGGGTATTTGG + Intronic
1181821068 22:25476080-25476102 AAGGCTGAGCAGTGGGTACAAGG - Intergenic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1182711857 22:32328170-32328192 ATGGGGGAACTGAGGGCAGAAGG - Intergenic
1183174844 22:36215616-36215638 AAGGGAGAACAGTGGGCAGGAGG - Intergenic
1183298065 22:37043743-37043765 AGGGGGGATCAAAGGGTAGAAGG + Intergenic
1183991037 22:41597178-41597200 AAGGGTGAACCGAGGCTTGGAGG + Intergenic
1184414668 22:44345394-44345416 ATGAGTGAACAGATGGTAGATGG + Intergenic
1184880738 22:47302849-47302871 ATGGATGAATAGAAGGTAGACGG - Intergenic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950427868 3:12934417-12934439 AAGAGAGAACAGGGGGCAGACGG + Intronic
950980936 3:17303766-17303788 AAGGGAGATAGGAGGGTAGAGGG - Intronic
951067675 3:18286404-18286426 AAGGGTAAACAGAGCATAGAAGG + Intronic
952036972 3:29214562-29214584 AACAGTAAATAGAGGGTAGATGG + Intergenic
952663604 3:35878801-35878823 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
952873802 3:37925102-37925124 AAGGATGGACAGAGGGGACAGGG - Intronic
953384632 3:42499610-42499632 ATGGGGGAACAGAGAGTAGGAGG + Intronic
953438278 3:42897010-42897032 AAGAGAGAACAGAGGAGAGAAGG - Intronic
953599582 3:44349458-44349480 AAGGAGGAATGGAGGGTAGAAGG + Intronic
954367410 3:50154056-50154078 GAGGGAGAAGAGAGGGGAGAAGG + Intergenic
955843370 3:63135739-63135761 CAGGGACAAAAGAGGGTAGAGGG + Intergenic
956780073 3:72596718-72596740 AGGGGTGAACAGAGTGTCTAGGG - Intergenic
958421809 3:93939013-93939035 AAGGGGGAATAGAGGGTGGAAGG - Intronic
959443459 3:106408003-106408025 AAGGGGGAAAAGTGGGTAGAAGG - Intergenic
959543854 3:107571123-107571145 AAGGGGGAATGGAGGGTGGAAGG + Intronic
960432211 3:117582884-117582906 ATTGGTGAAGAGAGGGTAGTGGG + Intergenic
960681786 3:120255710-120255732 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961431465 3:126886910-126886932 AGGGGTGAAGGGAGGGTGGAAGG - Intronic
962202719 3:133414442-133414464 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962202833 3:133414916-133414938 AGGGGTGAGCAGAGGGGACAGGG - Intronic
962202843 3:133414951-133414973 AGGGGTGAGTAGAGGGGAGATGG - Intronic
962202850 3:133414975-133414997 AAGGGTGAGTAGAGGAGAGATGG - Intronic
962203048 3:133415742-133415764 AGGGATGAATAGAGGGGAGATGG - Intronic
962203062 3:133415802-133415824 AGGGGTGAATAGAGGGGAGGTGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203077 3:133415850-133415872 GAGGGTGAGTAGAGGGGAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962203201 3:133416374-133416396 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203255 3:133416605-133416627 AGGGGTGAGTAGAGGGGAGATGG - Intronic
962203303 3:133416796-133416818 AGGGGTGAATAGAAGGGAGAGGG - Intronic
962203330 3:133416903-133416925 ACGGGTGAGTAGAGGGGAGAGGG - Intronic
962203375 3:133417090-133417112 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962203478 3:133417468-133417490 AGGGGTGAGTAGAGGGGAGAGGG - Intronic
962203538 3:133417717-133417739 ACGGGTGAGTAGAGGGGAGATGG - Intronic
962203583 3:133417917-133417939 ACGGGTGAGTAGAGGGGAGATGG - Intronic
962203630 3:133418107-133418129 AGGGGTGAGTAGAAGGTAGAGGG - Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963485188 3:145927009-145927031 AAGGGAGACCTGAGAGTAGATGG + Intergenic
963694299 3:148545561-148545583 AAAGGAGAACAGAGGGGATAAGG - Intergenic
965023136 3:163261165-163261187 AAGTGATAACAGATGGTAGAAGG - Intergenic
965110063 3:164409621-164409643 AAGGAGGAACAGAGGGAAGGAGG - Intergenic
965984528 3:174735921-174735943 AAGGGTGAACAGAGTGGTGAGGG + Intronic
966398596 3:179525390-179525412 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
969185400 4:5470660-5470682 AAGGGAGGACTGTGGGTAGATGG - Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
970189637 4:13501473-13501495 AAGGAAGAACATAGGGCAGATGG - Intergenic
972153227 4:36122603-36122625 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
973750975 4:54021058-54021080 AAGGGGGAATGGAGGGTGGAAGG - Intronic
974570176 4:63635629-63635651 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
974878492 4:67725271-67725293 AAGGGTGAAGAGATGAAAGAAGG - Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976332280 4:83846370-83846392 AAGGATGAACACAGGGTGGCAGG - Intergenic
977736935 4:100428002-100428024 CAGGGTGATCACAGAGTAGATGG - Intronic
978132536 4:105216014-105216036 AGGGGAGAACAAAGAGTAGAAGG - Intronic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
979931191 4:126632961-126632983 AAGGGAGAAAAGAAGGGAGAGGG + Intergenic
981040110 4:140214826-140214848 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
981482867 4:145256000-145256022 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982718759 4:158837853-158837875 AAGGGAGCACAGATGGTGGAGGG + Intronic
983406403 4:167336260-167336282 AAGGGAGACCAGTGAGTAGAAGG - Intergenic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
984124359 4:175788021-175788043 AAGGATGAGAAGAGTGTAGATGG - Intronic
984277568 4:177628215-177628237 AAGGGTGGAAAGTGGGAAGAGGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985358886 4:189151141-189151163 AAGGGGGAACAAAGGAAAGAAGG - Intergenic
986190483 5:5492344-5492366 AATGGTCAACAGAGTGTGGACGG + Intergenic
986919733 5:12666990-12667012 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
987452198 5:18099681-18099703 CAGGATGAACAGAGGTTAGTGGG + Intergenic
987600851 5:20068455-20068477 ACTGGTGAACATAGGGTATATGG + Intronic
988707407 5:33739809-33739831 AAGGGTGTAAAGAAGGCAGAAGG + Intronic
989154701 5:38333035-38333057 AAGTGAGAACATAGGGTAGTTGG + Intronic
989478007 5:41896431-41896453 AAGAGGGAACAGAGGCCAGAAGG + Intergenic
990295660 5:54399031-54399053 AATAGTGAACAGAGGGAGGAAGG - Intergenic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
992452200 5:76885204-76885226 AAGGAGGAATGGAGGGTAGAAGG + Intronic
992489127 5:77223969-77223991 ATGGATGAACAAAGGGAAGATGG - Intronic
994496554 5:100520288-100520310 AAGAGACAACAAAGGGTAGAAGG + Intergenic
995078225 5:108013480-108013502 ATGGGAGAACAGAGAGGAGAAGG - Intronic
995745503 5:115398421-115398443 AAGGGTGGAGAGTGGGAAGAGGG - Intergenic
996139664 5:119890712-119890734 AAGAATGAACAGAGGGAATATGG - Intergenic
996575161 5:124971079-124971101 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
997746213 5:136302378-136302400 AAGGGTGAAGAAGGGGTTGAGGG - Intronic
997859775 5:137405910-137405932 ATGGGTGAACAGAGGAGAGGTGG - Intronic
998506617 5:142677633-142677655 AAGGGACAACAGAGGGTAGAAGG + Intronic
998863392 5:146469026-146469048 AAGAGTAAACAAAGGGTATAAGG + Intronic
999505950 5:152196445-152196467 ATGGGTGAACAGAAGGGAAAGGG + Intergenic
999531650 5:152469605-152469627 AAGTGTGGAGAGAGGGTGGAAGG + Intergenic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000850994 5:166340131-166340153 AAGGGAGAACAGAAGTTAGCAGG - Intergenic
1001183840 5:169547863-169547885 GAGGGTGATAGGAGGGTAGAAGG - Intergenic
1001331603 5:170766464-170766486 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1001681470 5:173560668-173560690 AATAGTGAACATAGGGCAGAAGG - Intergenic
1004022530 6:11788251-11788273 AAGGATGAGGAGAGGGCAGAGGG - Intronic
1004108434 6:12688945-12688967 AAGGAGGAAAAGGGGGTAGATGG + Intergenic
1005014806 6:21365943-21365965 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1005049639 6:21673075-21673097 AAGGAGGAATAGAGAGTAGAAGG + Intergenic
1005992195 6:30910264-30910286 AAGGGTGGAAAGATGGCAGAGGG + Intronic
1006282387 6:33065080-33065102 AAAGGAGAACAGAGGATAAAAGG + Exonic
1007783938 6:44269972-44269994 AAGGACTAACAGAGGGCAGAGGG - Intergenic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1008330608 6:50240439-50240461 AAGGGTGAGCAAAGCGAAGAGGG + Intergenic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1009758193 6:67968432-67968454 AAAGGTGAACAGAGGTAAGTTGG - Intergenic
1010819872 6:80401062-80401084 AAGGGTGAAGGGTGGGAAGAGGG + Intergenic
1011780816 6:90787377-90787399 AAATGTGTGCAGAGGGTAGAAGG + Intergenic
1012180059 6:96141584-96141606 AAGGCTGAACAGAAAGGAGAAGG + Intronic
1012870679 6:104669802-104669824 AAGGGAGAACACATGGTATAAGG - Intergenic
1013542797 6:111127786-111127808 AAGGGTGGAAACAGAGTAGAGGG + Intronic
1013618846 6:111870233-111870255 AAGGGGCAACAGAGAGTAGACGG - Intronic
1014794138 6:125706313-125706335 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1014843842 6:126251779-126251801 AAGTTAGAACAGAGGATAGAGGG - Intergenic
1014884637 6:126764791-126764813 AGGGGAGAACAGATGGAAGAGGG + Intergenic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015184199 6:130394784-130394806 CAGGGTAAACAGAGGATAGTGGG + Intronic
1015588382 6:134799499-134799521 AAGGGTGAACACAGGGTCCAGGG + Intergenic
1015867737 6:137744001-137744023 CAGGGTGAACCGAGGTTAGCTGG + Intergenic
1015868667 6:137753784-137753806 AGGGGTGAACAGGGTGGAGAGGG + Intergenic
1016739649 6:147513731-147513753 AAGGGTAAGCAGAGGGTAGGTGG + Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017145758 6:151233160-151233182 AAGGGTTAAAGAAGGGTAGAGGG - Intergenic
1017996594 6:159536902-159536924 AAGGGCAAACAGAGAGGAGAAGG + Intergenic
1018234524 6:161710967-161710989 AAAGGGGAAAAGAGGGTAGGAGG - Intronic
1021246490 7:18269432-18269454 AAGGTTTAAAAGAGAGTAGAAGG + Intronic
1022157168 7:27672225-27672247 AAGGGGGAAAAGTGAGTAGAGGG + Intergenic
1022447258 7:30480499-30480521 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1026287662 7:68977442-68977464 AAGGCTGGACAGAGTGCAGAGGG + Intergenic
1027354263 7:77340924-77340946 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028640908 7:93040598-93040620 AAGGGTGAGCAGAGCGGTGAGGG - Intergenic
1029480485 7:100809480-100809502 ACTGGTGAACAGAGGAGAGATGG - Intronic
1029584780 7:101463519-101463541 AAGGGGGAAGAGGGGGAAGAGGG - Intronic
1029673072 7:102047346-102047368 GAGGGTGAATAGGGGATAGATGG + Intronic
1029953598 7:104613602-104613624 AGGGGTGAGTGGAGGGTAGATGG - Intronic
1030891433 7:115003814-115003836 AGGAGAGAACATAGGGTAGAAGG - Intronic
1031422660 7:121568697-121568719 AAGGGTGAAGAAGGGGTTGAGGG + Intergenic
1033077048 7:138259366-138259388 AAAGTTGATAAGAGGGTAGAAGG + Intergenic
1033084563 7:138330255-138330277 AAGGAGGAATAGAGGGTAGAAGG - Intergenic
1035527405 8:324616-324638 GTGGGTGAACAGGGGGTGGAGGG + Intergenic
1036472491 8:9063909-9063931 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1037913486 8:22758239-22758261 AAGGGTCACCGGAGGGAAGATGG - Intronic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1038437104 8:27543880-27543902 ACGGGTGCTCAGAGGGAAGACGG + Intronic
1038570546 8:28658345-28658367 GAGGGTGAAAACAGGGTGGATGG - Intronic
1039447466 8:37644073-37644095 AAGGGTGAGCAGAAGGCAGGTGG + Intergenic
1040799000 8:51320844-51320866 CAGGGTGTACAGATGTTAGAGGG - Exonic
1041588817 8:59551700-59551722 AAGGGTGGAGAGTGGGTAGAGGG - Intergenic
1043319701 8:78968698-78968720 AAGGGAGAAAAGCGGGGAGAGGG + Intergenic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1044467108 8:92520355-92520377 AAAGCTGAACAGAAGGCAGAAGG + Intergenic
1046101346 8:109617328-109617350 AAGGGGGAACAGAGTGCTGATGG + Intronic
1046611164 8:116427078-116427100 AAGAGTGAACAAAGGGTTAAGGG - Intergenic
1046732053 8:117736479-117736501 AAGGGACAAAAGAGGGAAGATGG + Intergenic
1047462894 8:125085733-125085755 AGGGGTGAGCAGATGGTAGAAGG + Intronic
1047994729 8:130323605-130323627 TAGGGGGAACAGACAGTAGAGGG - Intronic
1048348541 8:133596977-133596999 CAGGGGGAGCAGAGGGTAAACGG - Intergenic
1049231761 8:141488388-141488410 GAGGGAGAAGAGAGGGTAGTGGG - Intergenic
1049350580 8:142162386-142162408 ATGGATGGACAGAGGATAGATGG + Intergenic
1049350714 8:142163098-142163120 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350789 8:142163494-142163516 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350903 8:142164107-142164129 ATGGATGAACAGAGGATGGATGG + Intergenic
1049411294 8:142475138-142475160 GATGGTAAGCAGAGGGTAGAGGG - Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050342067 9:4650376-4650398 AAGGGTGAAAAGTGTGTGGATGG - Intronic
1050895925 9:10885991-10886013 AAGGAGGAATAGAGGGTGGAAGG - Intergenic
1052960253 9:34289516-34289538 ATGGGAGAATAGAGGTTAGAGGG - Intronic
1053008749 9:34621566-34621588 AGGGGTGAGGAGATGGTAGAGGG + Intronic
1053184203 9:36001500-36001522 AACAGTGATGAGAGGGTAGAGGG + Intergenic
1053462584 9:38282021-38282043 GAGGCTGAGCAGAGGGCAGAGGG + Intergenic
1053477943 9:38395696-38395718 CAGGGTGAACAGGTGGGAGAAGG - Intronic
1056391725 9:86147034-86147056 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1056634233 9:88318380-88318402 AAGGATGAAGAGAGGGAAAAAGG + Intergenic
1057155878 9:92838848-92838870 GAGGGTGAAGAGTGGGAAGAAGG + Intergenic
1057755502 9:97831806-97831828 AGGGGAGATAAGAGGGTAGAGGG + Intergenic
1058426088 9:104876291-104876313 AACGGGGAACAGAGGGAAGCTGG + Intronic
1059533038 9:115055389-115055411 GAGGGTGAAAAGTGGGTAGCGGG + Intronic
1059901313 9:118929206-118929228 AAGAAAGAACAGAGAGTAGAGGG - Intergenic
1060575575 9:124689831-124689853 AAGGGAGAACAGAGAAAAGAGGG - Intronic
1060920128 9:127414553-127414575 AAGGGGGAATAGAGGGTGGAAGG - Intergenic
1061074452 9:128332651-128332673 AAGAGTGAACAGAAGGGAGTAGG - Intronic
1061287673 9:129633375-129633397 AAGGGTGCAGAGAGGGAACATGG - Intronic
1061582907 9:131548311-131548333 AAGGAGGAATAGAGGGTGGAAGG - Intergenic
1185688341 X:1948485-1948507 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185688619 X:2134007-2134029 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185700463 X:2227549-2227571 AAGGGAGAAAGGAGGGAAGAAGG + Intronic
1185954880 X:4478380-4478402 AAGGGAGGAAAGAGGGAAGAAGG + Intergenic
1186113024 X:6276639-6276661 AAGGAGGAATAGAGGGTGGAAGG + Intergenic
1186533363 X:10320181-10320203 AAGGATGAAATGGGGGTAGAGGG - Intergenic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187570499 X:20496162-20496184 AGGGGTGAAGAGAGGGAAGTGGG - Intergenic
1187734606 X:22290996-22291018 AAAGGTCAACAGAGGGGAAATGG - Intergenic
1188430873 X:30104600-30104622 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188481225 X:30638796-30638818 AAGTGTAAACTGATGGTAGAAGG - Intergenic
1191047104 X:56150197-56150219 ATGGGTGAACAGAAAGGAGAAGG + Intergenic
1191102855 X:56751217-56751239 AAGGGTGTAAAGATGTTAGAGGG - Intergenic
1191805962 X:65134117-65134139 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1192914286 X:75636737-75636759 AAGAGGGAATTGAGGGTAGAAGG + Intergenic
1193725230 X:85030663-85030685 AAGTGAGAACAGAGGGTATTTGG - Intronic
1194063631 X:89235420-89235442 AAGGGTGAGCTGGTGGTAGAAGG - Intergenic
1194641327 X:96406944-96406966 ATGGGGGACCACAGGGTAGAGGG - Intergenic
1195657841 X:107349423-107349445 AAGGGTACGCACAGGGTAGAGGG - Intergenic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196237559 X:113300010-113300032 AAGGGAGAAGGGAGGGGAGAAGG - Intergenic
1197168295 X:123403522-123403544 AAGTGTGAACAGAAGGTAGGTGG + Intronic
1197339685 X:125251293-125251315 AAAGGTGAAAATAGTGTAGAAGG - Intergenic
1197470811 X:126864352-126864374 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1198202906 X:134439772-134439794 AAGGGTGAAAACAGTGCAGAAGG - Intergenic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1199807616 X:151316078-151316100 AATGGTGAACAGGAGGTAGGAGG - Intergenic
1199899906 X:152162844-152162866 AAGGGTGAAGAGAGGCTTCAAGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200717805 Y:6569524-6569546 AAGGGTGAGCTGGTGGTAGAAGG - Intergenic
1201073578 Y:10170810-10170832 AAGGAAGAACAGAGGGAAGGAGG - Intergenic