ID: 969572936

View in Genome Browser
Species Human (GRCh38)
Location 4:8020635-8020657
Sequence TTGGCGAATTTGCAGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969572936 Original CRISPR TTGGCGAATTTGCAGTTGGT TGG (reversed) Intronic
901357518 1:8664065-8664087 TTGTGGACTTTGCAGTTAGTGGG - Intronic
902733201 1:18383501-18383523 TGGGGGAATCTGCAGATGGTGGG - Intergenic
902751944 1:18521948-18521970 TTGGCTAACGTGCACTTGGTTGG + Intergenic
905717333 1:40162971-40162993 TTGATGAACTTACAGTTGGTGGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909761374 1:79291546-79291568 TAGGCGTATTTGGATTTGGTAGG - Intergenic
910937432 1:92496263-92496285 TTTGCAAATTTACATTTGGTAGG - Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
919545284 1:198909846-198909868 TTAGAGAATAAGCAGTTGGTGGG + Intergenic
921148869 1:212384475-212384497 TGGGCACAATTGCAGTTGGTGGG - Intronic
922082771 1:222313793-222313815 TTGACCAATTGACAGTTGGTGGG - Intergenic
923654287 1:235901757-235901779 TTGGGCAATTGGGAGTTGGTTGG + Intergenic
1062777229 10:162171-162193 TGGGAGAATGAGCAGTTGGTGGG + Intronic
1073352719 10:102831292-102831314 AGGGTGAATTTGCAGTTGGTTGG + Intronic
1079854576 11:25586096-25586118 TTGGAGAAGTGGTAGTTGGTTGG + Intergenic
1084116483 11:67045651-67045673 TTGGGGAGTTTGGAGTCGGTGGG + Intronic
1091017381 11:132064325-132064347 TTTGCTAAATTGCAGTTGTTAGG - Intronic
1093999998 12:25684644-25684666 TTGAAGAATTGGTAGTTGGTTGG + Intergenic
1096128000 12:49134152-49134174 TATAAGAATTTGCAGTTGGTGGG + Intergenic
1098231883 12:68379445-68379467 TTGGCAAATTCGCAGCTGGGTGG - Intergenic
1100430301 12:94526271-94526293 TTGGGGCAGATGCAGTTGGTTGG - Intergenic
1112659896 13:101496012-101496034 TTGTGGAATTTGAAGCTGGTGGG - Intronic
1113389131 13:109879004-109879026 TATGGGAATTTGCAGCTGGTGGG + Intergenic
1116947300 14:50847750-50847772 TTGGAGAATTGGTTGTTGGTGGG - Intergenic
1117459351 14:55929317-55929339 TTGGCGAAAATGTAGTTGGGTGG + Intergenic
1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG + Intronic
1138869085 16:60859212-60859234 TTGGGGAAGTTACAGTTGGAAGG - Intergenic
1140721978 16:77780312-77780334 TTGGCCTATATCCAGTTGGTTGG - Intergenic
1141890558 16:86924134-86924156 TGGGCGCATTTGCTGCTGGTGGG - Intergenic
1148931016 17:51127394-51127416 GTGGCGTATTTGTAGTTAGTAGG - Intergenic
1158720989 18:59924365-59924387 TTAGTTAATTTGCAGTTGTTTGG - Intergenic
1165725645 19:38110763-38110785 TTGGGGGATTTGCAGCTGGTAGG - Intronic
1167986546 19:53323468-53323490 TTGGAGAGTTTGTTGTTGGTGGG - Intergenic
928022093 2:27713354-27713376 AAGGCGAATTTGCAGGTGGTAGG + Intronic
928395682 2:30941815-30941837 TTTGAAAATTTGCAGTTGGAAGG - Intronic
930855287 2:56009378-56009400 CTGGGGTATTTGCAGGTGGTGGG + Intergenic
932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG + Intronic
937944307 2:127318284-127318306 TTGCCCAATCTCCAGTTGGTCGG + Exonic
947019762 2:225662177-225662199 TTGGAGATTTTGCTCTTGGTTGG - Intergenic
1173893042 20:46528188-46528210 TTTGCCAGCTTGCAGTTGGTGGG + Intergenic
1182975486 22:34620282-34620304 TTGGCGAGTTTGCTCTTAGTGGG + Intergenic
1184219800 22:43092540-43092562 TTTGCAAATGTACAGTTGGTTGG - Intergenic
949140121 3:622462-622484 TTGGCCAATGTGAAGTTGTTAGG - Intergenic
952581891 3:34843770-34843792 TTAGCGGATTTCCAGCTGGTGGG - Intergenic
953528846 3:43719920-43719942 TTAGGGAATTTGTAGTTGTTAGG + Intronic
956688104 3:71850822-71850844 TTGGGAGATTTGCAGTTTGTAGG + Intergenic
958698919 3:97563259-97563281 TTGGAGAATTTGATGTTGGAGGG + Intronic
958882183 3:99684904-99684926 CTGGCGTAATTGCAGTTGGGAGG + Intronic
960572169 3:119196047-119196069 ATGATGAATTTGTAGTTGGTAGG - Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
971088088 4:23303365-23303387 TTAGCGAATTTGCTATTTGTAGG - Intergenic
976576471 4:86677962-86677984 TGGGGCCATTTGCAGTTGGTGGG + Intronic
977187638 4:93960120-93960142 TTGGCGAATCTGCAGTGATTTGG - Intergenic
989665784 5:43852361-43852383 TTGGAGAATTTGCAATGAGTAGG + Intergenic
993510324 5:88763235-88763257 TTGGGGAATTTATAATTGGTGGG + Intronic
1001629025 5:173160747-173160769 TTGGCGAATCAGCTGCTGGTAGG + Intronic
1002609471 5:180405307-180405329 TTGGGGAATTGTAAGTTGGTGGG - Intergenic
1008463118 6:51799004-51799026 TTGGTACATTTGGAGTTGGTAGG - Intronic
1012269616 6:97192666-97192688 TTTGCCAATTAGCAGTTGGATGG + Intronic
1020234719 7:6346893-6346915 TTGGGGAGTTTACAGTTGGACGG - Intronic
1026582445 7:71629654-71629676 TTGGAGAATTGGGAGTTGGGAGG + Intronic
1026972353 7:74476103-74476125 GTGGCTATTTTGCAGTTGGATGG + Intronic
1029975332 7:104828302-104828324 CTGGGGAATTTGAGGTTGGTGGG - Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1034333497 7:150304801-150304823 TTGGAGCATGTACAGTTGGTTGG - Intronic
1034664546 7:152805089-152805111 TTGGAGCATGTACAGTTGGTTGG + Intronic
1036993078 8:13621437-13621459 CTGGCATATTTGCTGTTGGTTGG - Intergenic
1039824169 8:41158728-41158750 TTGGCGAGTTTGCTTTTGGCTGG + Intergenic
1048926378 8:139276176-139276198 TTTGCAAATTTGAAGGTGGTGGG - Intergenic
1049250539 8:141586472-141586494 TTTTCGAATTGGCAATTGGTTGG + Intergenic