ID: 969573408

View in Genome Browser
Species Human (GRCh38)
Location 4:8023185-8023207
Sequence GGCACCCTAGTGATGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969573408_969573416 9 Left 969573408 4:8023185-8023207 CCCTCTCCCATCACTAGGGTGCC 0: 1
1: 0
2: 2
3: 15
4: 182
Right 969573416 4:8023217-8023239 GTGCCACCTGCACGCCGCACGGG 0: 1
1: 0
2: 4
3: 6
4: 111
969573408_969573420 16 Left 969573408 4:8023185-8023207 CCCTCTCCCATCACTAGGGTGCC 0: 1
1: 0
2: 2
3: 15
4: 182
Right 969573420 4:8023224-8023246 CTGCACGCCGCACGGGATTCGGG 0: 1
1: 0
2: 0
3: 4
4: 51
969573408_969573423 26 Left 969573408 4:8023185-8023207 CCCTCTCCCATCACTAGGGTGCC 0: 1
1: 0
2: 2
3: 15
4: 182
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573408_969573419 15 Left 969573408 4:8023185-8023207 CCCTCTCCCATCACTAGGGTGCC 0: 1
1: 0
2: 2
3: 15
4: 182
Right 969573419 4:8023223-8023245 CCTGCACGCCGCACGGGATTCGG 0: 1
1: 0
2: 0
3: 2
4: 40
969573408_969573415 8 Left 969573408 4:8023185-8023207 CCCTCTCCCATCACTAGGGTGCC 0: 1
1: 0
2: 2
3: 15
4: 182
Right 969573415 4:8023216-8023238 GGTGCCACCTGCACGCCGCACGG 0: 1
1: 0
2: 0
3: 11
4: 95
969573408_969573422 25 Left 969573408 4:8023185-8023207 CCCTCTCCCATCACTAGGGTGCC 0: 1
1: 0
2: 2
3: 15
4: 182
Right 969573422 4:8023233-8023255 GCACGGGATTCGGGTTTCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969573408 Original CRISPR GGCACCCTAGTGATGGGAGA GGG (reversed) Intronic
901226990 1:7619172-7619194 GGCTCCGTGGTGATGGTAGATGG - Intronic
902690439 1:18107547-18107569 GGGACCTGAGTGAGGGGAGAGGG + Intergenic
903564884 1:24257804-24257826 GGCCCCCCAGTGAAGGCAGAGGG + Intergenic
903972870 1:27130490-27130512 GGCACCCTAGTAATGGGAAATGG + Intronic
904248167 1:29203061-29203083 GGCACCGCAGGGATGGGAGGTGG + Intronic
904773495 1:32893706-32893728 GGCAGCCTAGCGAGGGGAGGCGG - Intronic
905819888 1:40980607-40980629 TGCACACTAGTGATGGGGGCTGG + Intronic
906076540 1:43056150-43056172 GGCACAGTGGTGAGGGGAGATGG + Intergenic
907284815 1:53372775-53372797 GGCGCCATCCTGATGGGAGAAGG - Intergenic
911062316 1:93759014-93759036 TGCACAATAGTGTTGGGAGAGGG - Intronic
913387720 1:118277898-118277920 GGAACCCTAGTGATAGCCGAGGG - Intergenic
917052996 1:170945594-170945616 GACACAATAGAGATGGGAGAAGG + Intronic
917638465 1:176959453-176959475 GGCAACCTGGGGAGGGGAGAGGG - Intronic
920302825 1:204999614-204999636 GGCACCGTGGGGAGGGGAGAAGG - Intronic
921875306 1:220189069-220189091 GTTACCTTAGGGATGGGAGAAGG + Intronic
922420586 1:225458748-225458770 GGCTGCCTAGGGGTGGGAGAGGG + Intergenic
923992405 1:239453872-239453894 GGCTCCCCAGTGAAGGGAGAGGG + Intronic
1063557526 10:7095044-7095066 GCCATCCTAGTGATGTGAAATGG - Intergenic
1070130281 10:73651135-73651157 GGCAGCCCAGAGAAGGGAGAGGG - Intronic
1070387135 10:75935760-75935782 GGCTTCCCAGTGGTGGGAGAAGG - Intronic
1071666996 10:87568209-87568231 GGCACACTAGTGAAAGGAGTGGG - Intergenic
1073302858 10:102481463-102481485 GACACCTTAGTGATAGGTGAAGG - Intronic
1073795192 10:106979712-106979734 GCCACACGAGTGATGGCAGAGGG - Intronic
1074942616 10:118249676-118249698 GGCCTCCTGGTGATGAGAGATGG - Intergenic
1075054853 10:119209654-119209676 GGCCACCTAGTGGTGGGACACGG + Intronic
1075320738 10:121489909-121489931 GGAACCTTAGTCATGGGACATGG - Intronic
1075481801 10:122788569-122788591 GACATCCTAGTGATGGATGAAGG + Intergenic
1075684263 10:124353140-124353162 GGCAGCCTTGTGAGAGGAGAAGG - Intergenic
1076140069 10:128071410-128071432 GCCACCCAGGTCATGGGAGAGGG + Intronic
1076165846 10:128281868-128281890 CGCCGGCTAGTGATGGGAGAGGG + Intergenic
1076378515 10:130009328-130009350 GGAACCCCAGTGCAGGGAGACGG + Intergenic
1076995908 11:297424-297446 CACAGCCTGGTGATGGGAGAGGG - Intergenic
1077154413 11:1084998-1085020 GCCACCCTGGGGATGGGAGCTGG + Intergenic
1078251681 11:9621774-9621796 AGCAGTCTAGAGATGGGAGAAGG + Intergenic
1083579562 11:63816174-63816196 GGTGCTCTAGTGAGGGGAGATGG + Intronic
1088228096 11:107643855-107643877 GGCACTGTGGTGATGGCAGAGGG - Intronic
1088707513 11:112477246-112477268 GGCAACCTAGTGGGGAGAGATGG - Intergenic
1089460172 11:118648405-118648427 GGCATCCCAGAGATGGGAGCTGG + Intronic
1090791728 11:130095960-130095982 CACATTCTAGTGATGGGAGATGG + Intronic
1096354413 12:50928234-50928256 GGAACCCCAGTGGTAGGAGATGG - Intronic
1099806293 12:87524233-87524255 GGCACCATAGCCATGGAAGATGG + Intergenic
1100359869 12:93866816-93866838 GGGAACCTAGTGATGGAAGAGGG + Intronic
1100783968 12:98059574-98059596 TGATCCCTAGTGTTGGGAGATGG + Intergenic
1102221470 12:111197769-111197791 GGCTCCCTGGTGGTGGGAGGTGG - Intronic
1105857489 13:24386026-24386048 GGCTCCCCACTGCTGGGAGAGGG - Intergenic
1106680957 13:32006957-32006979 GTCATCCTAGTGATGGGGGAGGG - Intergenic
1106827929 13:33544254-33544276 GGCACGGTAGGGATGGGAGTGGG - Intergenic
1107415559 13:40196888-40196910 GGCACTGTAGTAATGGGACAAGG - Intergenic
1112811614 13:103224961-103224983 GGCAGCCTGTTGATGTGAGATGG + Intergenic
1113796375 13:113061090-113061112 TGCACCCCAGGGATGAGAGAAGG + Intronic
1117579238 14:57135369-57135391 GGGAGCCCAGTGATGGGAGGTGG - Intergenic
1118324504 14:64772004-64772026 GGCACTCCAGTGATGGGGCAGGG + Intronic
1122205851 14:100147629-100147651 GGCATCCCTGTGATGGGAGCTGG - Intronic
1125480454 15:40075698-40075720 TGCAGTCTAGTGATAGGAGAAGG + Intergenic
1126875126 15:53033092-53033114 GGCACCAGAGAGATGGGAGTGGG + Intergenic
1127256261 15:57296425-57296447 GGCAGCCTAGTGTTGGGAGCAGG + Intronic
1128926138 15:71658045-71658067 GACACCCTAGTTACAGGAGAGGG + Intronic
1129949818 15:79575883-79575905 GGGACCCCAGTGAAGCGAGAAGG - Intergenic
1131169182 15:90164670-90164692 GGCACCCTTGTGATGGAATATGG + Intronic
1132517230 16:371451-371473 GTCACCATAGGGACGGGAGACGG - Exonic
1133980900 16:10632646-10632668 GGGACCCTAGTGATTGGAGTAGG + Intronic
1134216756 16:12322199-12322221 GTCACGCTAGTGATGGGAGTGGG + Intronic
1135097710 16:19578399-19578421 GGCCCCCTAAAGATGGGGGAAGG + Intronic
1137357453 16:47780401-47780423 GTCACCCTGGGGGTGGGAGAGGG + Intergenic
1137744928 16:50813411-50813433 GGTACCTTAGGGAAGGGAGAAGG + Intergenic
1138738411 16:59279612-59279634 GGCTCCCCAGTGAAGGGAAAGGG + Intergenic
1139705402 16:68737620-68737642 GACCCCCCAGTGATGGGAGTGGG + Intronic
1142120961 16:88386487-88386509 GGGACACCAGTGATGGGAGGTGG - Intergenic
1144310163 17:14006480-14006502 TGCACCCAGGTGTTGGGAGAAGG + Intergenic
1144834967 17:18151943-18151965 GGCACCCAGGTGAGGGGGGAAGG + Exonic
1146884572 17:36462504-36462526 GGCACCCTAGAGAAGGAAGGGGG + Intergenic
1149285756 17:55162411-55162433 GGCACTCTAGTAAAGTGAGACGG - Exonic
1149336832 17:55644146-55644168 AGCACCCTAGAGAAGGGAGAAGG - Intergenic
1150221394 17:63497535-63497557 GGCAGCCGTGTGCTGGGAGAAGG - Intronic
1150852073 17:68713082-68713104 GGCACCGGAGTGATGGGGTAGGG + Intergenic
1153671362 18:7415353-7415375 GGCAGCCAAGTGGTGGGAGGGGG + Intergenic
1153811600 18:8756960-8756982 GACACCCTAGTGATGAGTGAGGG + Intronic
1154135902 18:11777965-11777987 GGCAGCCCAGTGAGGGGCGAAGG - Intronic
1154485581 18:14869012-14869034 GGCACCCTAGTGGGGGAAAAGGG + Intergenic
1158671092 18:59474509-59474531 GGAACTCAAGTGAAGGGAGAAGG + Intronic
1160866879 19:1260136-1260158 GGGCCCCTAGAGATGGGATAAGG - Intronic
1161196275 19:2988243-2988265 GGCAGAGTAGTGATGGGAAAAGG - Intronic
1162281957 19:9705892-9705914 GTGACCTTAGTGTTGGGAGACGG - Intergenic
1163788417 19:19290203-19290225 GGCTCCCAAGTGATGGAGGAAGG + Intronic
1164623682 19:29713158-29713180 GGCAGCCTTGCGGTGGGAGAAGG - Intronic
1166431735 19:42733487-42733509 GACATCCTAGAGATGGGTGATGG + Intronic
1166434853 19:42758702-42758724 GACATCCTAGAGATGGGTGATGG + Intronic
1166491275 19:43262563-43262585 GACATCCTAGAGATGGGTGATGG + Intronic
1166553538 19:43683202-43683224 AGCAGCCTGGGGATGGGAGATGG - Intergenic
1166937697 19:46344716-46344738 GGTAACCAAGTGAGGGGAGAGGG - Intergenic
1167721838 19:51184946-51184968 GGCAACCTGGGGGTGGGAGAAGG - Intergenic
926685031 2:15691615-15691637 CGCCCCAGAGTGATGGGAGAAGG - Intronic
932874214 2:75433453-75433475 GGCACCCCAGTGAGGAGGGATGG - Intergenic
936624698 2:114136022-114136044 GGCACCGTAGTTTTAGGAGAAGG + Intergenic
941154513 2:161959749-161959771 TGCACCCAAGTGAAGGGAAAAGG + Intronic
942758282 2:179367408-179367430 GGCAGCCAAGAGAAGGGAGAAGG - Intergenic
948874203 2:240818677-240818699 AGCACCCTCGTGGTGTGAGAAGG - Intronic
1168946807 20:1767707-1767729 GGGACCCTGGAGATGGGAGGAGG - Intergenic
1169233353 20:3908407-3908429 GGTACGCTAGTGATAGGAGTTGG + Intronic
1169605214 20:7310114-7310136 GGGAGCCCAGTGATGGGAGGTGG - Intergenic
1172105227 20:32513178-32513200 GGCCTCCTTGTGATGGTAGAGGG - Intronic
1172123104 20:32609959-32609981 TACACCCCAGTGAAGGGAGAGGG - Intergenic
1175923491 20:62461034-62461056 GGCACCCTGGGGGAGGGAGAAGG - Intergenic
1175943253 20:62547478-62547500 GGCCCCCCAGTGATGTCAGAGGG - Intergenic
1176795752 21:13370464-13370486 GGCACCCTAGTGGGGGAAAAGGG - Intergenic
1180835413 22:18927130-18927152 TGCAGCCCAGTGATGGGAGCTGG + Intronic
1182065519 22:27428789-27428811 GACCCCCAAGTGATGGTAGAAGG - Intergenic
1183358645 22:37372243-37372265 GGCACCCGGGAGAAGGGAGAGGG - Exonic
1183735676 22:39643597-39643619 GGCTTCCTGGTGGTGGGAGAGGG + Intronic
1184451843 22:44587136-44587158 GGCACCGAAGAGAAGGGAGAAGG + Intergenic
1203285501 22_KI270734v1_random:152429-152451 TGCAGCCCAGTGATGGGAGCTGG + Intergenic
950630448 3:14278598-14278620 GGCACCCTAGGGGTGGGAGAGGG + Intergenic
950730707 3:14954063-14954085 GACACCATAGTGGTGGGACAGGG - Intronic
951301720 3:21006580-21006602 GGTTTCCTAGTGCTGGGAGAGGG - Intergenic
954327710 3:49872639-49872661 GGCACCCTAGAGCTGGGAGTTGG - Intergenic
955459529 3:59165764-59165786 GGCCCTCAAGTGATGGGAGGAGG + Intergenic
956758989 3:72420874-72420896 GGCTCCCTAGGGCTGGGAGTTGG + Intronic
961654928 3:128435925-128435947 GGCACCCCACTGATGAGGGACGG - Intergenic
962118840 3:132541088-132541110 GCCACTTTTGTGATGGGAGAGGG + Intergenic
965773923 3:172209238-172209260 GGCTGCCTAGTGCTGGCAGAGGG + Intronic
968900463 4:3429102-3429124 GGCACCCAGGTGAGGGGAGGTGG + Intronic
969175448 4:5395469-5395491 GGGACCCTAGTTTTGGTAGATGG - Intronic
969573408 4:8023185-8023207 GGCACCCTAGTGATGGGAGAGGG - Intronic
969827430 4:9768551-9768573 GTATCCCTAGTGATGGTAGAAGG + Intergenic
969951134 4:10836895-10836917 GGAATCCAAGAGATGGGAGATGG - Intergenic
975404712 4:73976415-73976437 GGCACCCTGGTGGTGAGAGTAGG + Intergenic
977243615 4:94603623-94603645 AGCAGCCTAGAGATGGGAGGCGG - Intronic
977926371 4:102705154-102705176 GGCTCCCCAATGCTGGGAGAAGG + Intronic
977972441 4:103227797-103227819 GTGACCTTAGTGTTGGGAGACGG - Intergenic
979724317 4:123942386-123942408 GGCAGCCCAGTGCTGGCAGAGGG - Intergenic
983847290 4:172536135-172536157 GGCATCATAGTAATGGGAGAAGG - Intronic
985195342 4:187422855-187422877 GGCAACCTCCTGATGGGTGAGGG - Intergenic
985511323 5:315756-315778 GGCTCCCTGGGGATGGGAGGGGG + Intronic
985850872 5:2388321-2388343 GGCACCCCAGTGTAGGGAAACGG + Intergenic
985992481 5:3574962-3574984 GGCACCCTAGGGAGAGGGGAGGG - Intergenic
986389518 5:7271573-7271595 GCTATCCTAGTGCTGGGAGACGG - Intergenic
990867001 5:60390780-60390802 GGCACGGGAGGGATGGGAGATGG - Intronic
1002724372 5:181284449-181284471 GGCACCCTAGTGGGGGAAAAGGG + Intergenic
1005360787 6:25028963-25028985 GGCAGCAGAGTGCTGGGAGAGGG + Intronic
1006193665 6:32224098-32224120 GACACCCTAGTAATGGGGGGCGG + Intergenic
1006570702 6:35001572-35001594 GTGAACCTAGTGTTGGGAGATGG - Intronic
1007181669 6:39933487-39933509 GGAAGCCTAGTTCTGGGAGACGG + Intronic
1008016818 6:46529842-46529864 GACACTGAAGTGATGGGAGAAGG - Intergenic
1011104918 6:83768833-83768855 GTCACCTCAGTGATGGGAGTAGG - Intergenic
1011120587 6:83947825-83947847 GCCATCCTAATGATGTGAGATGG - Intronic
1011652766 6:89522218-89522240 GGCATCCAAGCCATGGGAGAAGG + Intronic
1016624126 6:146145916-146145938 TGCACACTAGTGAGGGGAGTTGG - Intronic
1016705469 6:147101975-147101997 GTCATCCTAGTGGTGTGAGATGG - Intergenic
1022466636 7:30656578-30656600 GGCACCCTAGACAGGGAAGATGG + Intronic
1022524788 7:31029877-31029899 GGCACCCTAGGGAGGTGTGAGGG - Intergenic
1024038644 7:45531700-45531722 GGCAACCTAGTGATGTAGGAAGG + Intergenic
1024953302 7:54888484-54888506 GACACCATAGTGATGGGAGGTGG - Intergenic
1025943084 7:66087657-66087679 GGCAACCTAGTTGGGGGAGAGGG + Intronic
1026960816 7:74406004-74406026 GGCACCCTGGTGCCAGGAGATGG + Intergenic
1027528810 7:79304420-79304442 GATACTCTGGTGATGGGAGACGG + Intronic
1032348118 7:131135592-131135614 GGCAACCTAGTGAGGTGTGATGG + Intronic
1033661504 7:143406183-143406205 GGCAACCTTGTGATTGGAGTTGG + Intronic
1038335018 8:26639018-26639040 TGCACCCGGGTTATGGGAGAGGG - Intronic
1040468475 8:47716817-47716839 CCCTCCCAAGTGATGGGAGAGGG + Intronic
1040976474 8:53199011-53199033 GGGACCCCAGAGGTGGGAGATGG + Intergenic
1041010937 8:53542663-53542685 GGCACCCTGGTCCTGGAAGAAGG - Intergenic
1041163207 8:55065848-55065870 GGTACCCTAGTGATGCTGGAGGG - Intergenic
1041379100 8:57234181-57234203 GGCTTCCAAGTGATGGGAAAAGG - Intergenic
1042200304 8:66274791-66274813 GGCACCCTCCAGATGGCAGAGGG + Intergenic
1044046755 8:87445043-87445065 GGCATCCTAGTGAAGTTAGAAGG - Intronic
1044674976 8:94719804-94719826 GGAACCAGAGTGTTGGGAGAGGG - Intronic
1048026700 8:130593573-130593595 GGCACCCATGCAATGGGAGAAGG - Intergenic
1048068521 8:130998107-130998129 GTCATTCTAGTGGTGGGAGATGG + Intronic
1049968509 9:800591-800613 GGGACAGTTGTGATGGGAGAAGG - Intergenic
1050191973 9:3035796-3035818 GGCACCCTAGTGCTGTGGCACGG + Intergenic
1050827653 9:9969365-9969387 GGTACCCTATTGGTGGGAGTAGG - Intronic
1053886507 9:42647881-42647903 GGCACCCTAGTGGGGGAAAAGGG + Intergenic
1054225526 9:62455330-62455352 GGCACCCTAGTGGGGGAAAAGGG + Intergenic
1054809671 9:69425071-69425093 GTCATCCTGGTGATGTGAGAGGG + Intergenic
1055709951 9:79049878-79049900 GGGTGCCTAGGGATGGGAGAAGG + Intergenic
1057203590 9:93157323-93157345 GGCACCTTGGGGATAGGAGAGGG - Intergenic
1057576589 9:96247347-96247369 GGGACCCAAGTGAAAGGAGAGGG + Intronic
1057825761 9:98371092-98371114 GGCAGCCTGGGGATGGGAGGAGG - Intronic
1059402036 9:114076640-114076662 AGCACGCTGGTGCTGGGAGAGGG - Exonic
1060295709 9:122341507-122341529 GGGCCCCTGGGGATGGGAGAAGG - Intergenic
1061688679 9:132306100-132306122 GGTTCCCTCGTTATGGGAGAAGG - Intronic
1061716438 9:132521281-132521303 GGGAACCTAGTGATGGGGGTGGG - Intronic
1061719191 9:132541298-132541320 GGCACCCTATTGCTAGCAGAAGG + Intronic
1061945228 9:133904977-133904999 GGGACACTGGTGAAGGGAGAGGG + Intronic
1062235220 9:135504748-135504770 GGGACCCCAGTGATGAGAGATGG + Intergenic
1185620444 X:1450528-1450550 GATGCCCTAGTGATGGGGGAGGG - Intronic
1185620527 X:1450740-1450762 GGAACCCTAGGGATGGGGGAGGG - Intronic
1185620568 X:1450846-1450868 GGACCCCTAGGGATGGGGGAGGG - Intronic
1185620610 X:1450951-1450973 GGACCCCTAGGGATGGGGGAGGG - Intronic
1185620625 X:1450986-1451008 GGACCCCTAGGGATGGGGGAGGG - Intronic
1185620777 X:1451376-1451398 GACCCCCTAGGGATGGGGGAGGG - Intronic
1185620832 X:1451519-1451541 GACCCCCTAGGGATGGGGGAGGG - Intronic
1185621052 X:1452093-1452115 GACCCCCTAGGGATGGGGGAGGG - Intronic
1185782525 X:2861801-2861823 GGCTCCCTGGGGAGGGGAGATGG + Intronic
1189211226 X:39285490-39285512 GGCATCCTCTCGATGGGAGAGGG - Intergenic
1189212974 X:39300368-39300390 AACACCCTAGGGATGGGAGTTGG - Intergenic
1192245162 X:69365912-69365934 AGCAGCCCAGTGTTGGGAGAGGG + Intergenic
1195417979 X:104641357-104641379 GGCCCCCTAATGGTGAGAGATGG + Intronic
1195963941 X:110413356-110413378 GGCACCCTAGGGCTGGGAGGTGG + Intronic
1198742540 X:139856314-139856336 GTGAACCTAGTGTTGGGAGACGG - Intronic