ID: 969573409

View in Genome Browser
Species Human (GRCh38)
Location 4:8023186-8023208
Sequence GGGCACCCTAGTGATGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969573409_969573423 25 Left 969573409 4:8023186-8023208 CCTCTCCCATCACTAGGGTGCCC 0: 1
1: 0
2: 0
3: 21
4: 190
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573409_969573420 15 Left 969573409 4:8023186-8023208 CCTCTCCCATCACTAGGGTGCCC 0: 1
1: 0
2: 0
3: 21
4: 190
Right 969573420 4:8023224-8023246 CTGCACGCCGCACGGGATTCGGG 0: 1
1: 0
2: 0
3: 4
4: 51
969573409_969573422 24 Left 969573409 4:8023186-8023208 CCTCTCCCATCACTAGGGTGCCC 0: 1
1: 0
2: 0
3: 21
4: 190
Right 969573422 4:8023233-8023255 GCACGGGATTCGGGTTTCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 48
969573409_969573419 14 Left 969573409 4:8023186-8023208 CCTCTCCCATCACTAGGGTGCCC 0: 1
1: 0
2: 0
3: 21
4: 190
Right 969573419 4:8023223-8023245 CCTGCACGCCGCACGGGATTCGG 0: 1
1: 0
2: 0
3: 2
4: 40
969573409_969573416 8 Left 969573409 4:8023186-8023208 CCTCTCCCATCACTAGGGTGCCC 0: 1
1: 0
2: 0
3: 21
4: 190
Right 969573416 4:8023217-8023239 GTGCCACCTGCACGCCGCACGGG 0: 1
1: 0
2: 4
3: 6
4: 111
969573409_969573415 7 Left 969573409 4:8023186-8023208 CCTCTCCCATCACTAGGGTGCCC 0: 1
1: 0
2: 0
3: 21
4: 190
Right 969573415 4:8023216-8023238 GGTGCCACCTGCACGCCGCACGG 0: 1
1: 0
2: 0
3: 11
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969573409 Original CRISPR GGGCACCCTAGTGATGGGAG AGG (reversed) Intronic
900236417 1:1593809-1593831 GGGCACCACAGTCCTGGGAGAGG + Intergenic
901079349 1:6575049-6575071 GGGCACCCCAGTGATGTGCCTGG - Exonic
902690438 1:18107546-18107568 GGGGACCTGAGTGAGGGGAGAGG + Intergenic
906854625 1:49291710-49291732 GGTAACGCTAGTGATGGCAGTGG + Intronic
908350889 1:63285919-63285941 GGCTAGCCTAGTGCTGGGAGTGG - Intergenic
908537366 1:65090748-65090770 GGGCCGCCTAGGGACGGGAGTGG + Intergenic
913387721 1:118277899-118277921 GGGAACCCTAGTGATAGCCGAGG - Intergenic
915506069 1:156357183-156357205 GGGCACCCTGGCGGTGGGAGGGG + Intronic
916770366 1:167901917-167901939 AGGCATCCTAGAGAAGGGAGTGG - Intronic
917398173 1:174616656-174616678 TGTCAGCTTAGTGATGGGAGTGG + Intronic
918744532 1:188182850-188182872 GGGAAACCTAGTAAGGGGAGAGG + Intergenic
919744848 1:201002329-201002351 GGGCAAGCGAGTGATAGGAGAGG - Exonic
923274387 1:232383974-232383996 TGGATCCCTCGTGATGGGAGTGG - Intergenic
923992404 1:239453871-239453893 TGGCTCCCCAGTGAAGGGAGAGG + Intronic
924200849 1:241657069-241657091 AGGCACCCTAGAGATAGTAGTGG - Intronic
1064935719 10:20677081-20677103 GGGCAGCCTCGTGGTGGAAGAGG + Intergenic
1066731166 10:38437785-38437807 GGTCATGCAAGTGATGGGAGGGG - Intergenic
1067821880 10:49538175-49538197 GGGAGCCCCAGTGATGGGGGAGG - Intronic
1068084564 10:52359132-52359154 GGGCCCCCTAGAAATGGCAGTGG + Intergenic
1068267071 10:54665169-54665191 GGGGACAATAGTGATGGTAGAGG + Intronic
1070130282 10:73651136-73651158 GGGCAGCCCAGAGAAGGGAGAGG - Intronic
1071102552 10:82055807-82055829 AGGCACTCTAGTGAAGGGACTGG + Intronic
1071666997 10:87568210-87568232 GGGCACACTAGTGAAAGGAGTGG - Intergenic
1073795193 10:106979713-106979735 GGCCACACGAGTGATGGCAGAGG - Intronic
1074088558 10:110226698-110226720 GAGCGCGCTTGTGATGGGAGGGG + Intronic
1075441943 10:122486716-122486738 TGCCACTCTAGTGATGAGAGAGG + Intronic
1076573552 10:131449047-131449069 GGGCACCCCTGGGATGGGAGCGG - Intergenic
1077000826 11:321380-321402 GGGCACCATAGTGAAGGTAATGG - Intronic
1077000834 11:321419-321441 GGGCACCATAGTGAAGGTAATGG - Intronic
1077000842 11:321458-321480 GGGCACCATAGTGAAGGTAATGG - Intronic
1077000850 11:321497-321519 GGGCACCATAGTGAAGGTAATGG - Intronic
1077000858 11:321536-321558 GGGCACCATAGTGAAGGTAATGG - Intronic
1077000866 11:321575-321597 GGGCACCATAGTGAAGGTAATGG - Intronic
1077000884 11:321653-321675 GGGCACCATAGTGAAGGTAATGG - Intronic
1077000928 11:321848-321870 GGGCACCATAGTGAAGGTAATGG - Intronic
1077000963 11:322004-322026 GGGCACCATAGTGAAGGTAATGG - Intronic
1077001007 11:322199-322221 GGGCACCATAGTGAAGGTAATGG - Intronic
1077001051 11:322394-322416 GGGCACCATAGTGAAGGTAATGG - Intronic
1077001086 11:322550-322572 GGGCACCATAGTGAAGGTAATGG - Intronic
1077001094 11:322589-322611 GGGCACCATAGTGAAGGTAATGG - Intronic
1077052099 11:571550-571572 GGGCTCCCTGCTGCTGGGAGTGG + Intergenic
1077517772 11:3012140-3012162 GGGGAGCCCAGTGAGGGGAGTGG + Intronic
1077529907 11:3090293-3090315 GGGCTCCCCAGCGGTGGGAGGGG - Intronic
1079241305 11:18724054-18724076 GGCCACCCAAGGGATGGGTGTGG + Intronic
1079351166 11:19693222-19693244 GGGTCCCCTCGTGATGGGATGGG + Intronic
1082122636 11:48396093-48396115 GGGCTCCCTAATGATGGAGGTGG + Intergenic
1082792084 11:57353030-57353052 GGGCACCCAGGTGAAGGGATGGG - Intronic
1083765908 11:64841601-64841623 GGGCACCCTACAAATGGGTGTGG - Intronic
1083986138 11:66216759-66216781 GCTCACCCTTGTGATGGCAGAGG - Exonic
1084766690 11:71313832-71313854 GGGAACCCTCATGATGGGACTGG + Intergenic
1085328527 11:75627372-75627394 GGGCACCAGAGTGCTGGGTGTGG + Intronic
1086286098 11:85253408-85253430 GGCCACTTTAGTGCTGGGAGGGG + Intronic
1086290033 11:85297967-85297989 GGGCGCCCATGTGATGGGAAGGG + Intronic
1089586430 11:119512572-119512594 GGGCTCCCTGGGGATGGGGGAGG + Intergenic
1092108947 12:5945411-5945433 GGGCGCCCGGGTGCTGGGAGCGG + Intronic
1100359868 12:93866815-93866837 TGGGAACCTAGTGATGGAAGAGG + Intronic
1101757716 12:107634225-107634247 GGGGCCACTAGTGATGTGAGTGG - Intronic
1102233176 12:111277492-111277514 GGGCAGCCTGGTGAGGGGAGTGG - Intronic
1102951901 12:117036766-117036788 GGGAACCCTAGGCAGGGGAGTGG - Intergenic
1103075218 12:117976603-117976625 TAGCACCCTAAGGATGGGAGAGG + Intergenic
1104223884 12:126812502-126812524 GGGCACCCACCTGGTGGGAGTGG - Intergenic
1105857490 13:24386027-24386049 GGGCTCCCCACTGCTGGGAGAGG - Intergenic
1106584314 13:31044012-31044034 GGGCCCCCACGTGGTGGGAGCGG + Intergenic
1106680958 13:32006958-32006980 TGTCATCCTAGTGATGGGGGAGG - Intergenic
1106827930 13:33544255-33544277 TGGCACGGTAGGGATGGGAGTGG - Intergenic
1108734638 13:53269776-53269798 GTGCAGCCTAGTAATGTGAGTGG - Intergenic
1109941762 13:69376913-69376935 GGGAACCCTTGTGAAGGGGGTGG + Intergenic
1112468168 13:99663433-99663455 GGGCACACTAGACATGGGATGGG - Intronic
1114695655 14:24624735-24624757 GGGCAGCCTAGCAGTGGGAGTGG + Intergenic
1118324503 14:64772003-64772025 GGGCACTCCAGTGATGGGGCAGG + Intronic
1119561211 14:75591406-75591428 GGGCACACTAGTGCCAGGAGGGG + Intronic
1119621318 14:76134115-76134137 GGGCACCCCAGTGGGGTGAGTGG - Intergenic
1121671137 14:95711614-95711636 AGGGTCCCTAGGGATGGGAGAGG - Intronic
1122208302 14:100159355-100159377 GGGGACCCCAGGGAGGGGAGCGG + Intronic
1122392899 14:101402492-101402514 TGACACCCGAGTGATGGGTGTGG + Intergenic
1122903224 14:104790511-104790533 GGGGACCCCAGGGACGGGAGTGG + Intronic
1124087812 15:26568208-26568230 GGGCACCCTAAGAATGAGAGAGG + Intronic
1126107279 15:45154929-45154951 GGGGACCCTAGTGATGAGCAGGG + Intronic
1126875125 15:53033091-53033113 GGGCACCAGAGAGATGGGAGTGG + Intergenic
1129034353 15:72640640-72640662 GTGCACCTTGGGGATGGGAGTGG + Intergenic
1129215529 15:74096576-74096598 GTGCACCTTGGGGATGGGAGTGG - Intergenic
1129265781 15:74392413-74392435 GGGCAGGCTAGGGGTGGGAGAGG - Intergenic
1129391893 15:75224884-75224906 GTGCACCTTGGGGATGGGAGTGG + Intergenic
1129732666 15:77940905-77940927 GTGCACCTTGGGGATGGGAGTGG - Intergenic
1132899653 16:2246344-2246366 GGGCACCCAAGTGATCCTAGTGG + Intronic
1133031953 16:3015389-3015411 GGGCCCCCGAGAGATGGCAGGGG + Exonic
1134216755 16:12322198-12322220 AGTCACGCTAGTGATGGGAGTGG + Intronic
1134749834 16:16617256-16617278 GGTCATCCTTGTGATGGGAGTGG + Intergenic
1134995640 16:18736359-18736381 GTGCATCCTTGTGATGGGAGTGG - Intergenic
1139705401 16:68737619-68737641 GGACCCCCCAGTGATGGGAGTGG + Intronic
1142459012 17:76656-76678 GGTCATGCAAGTGATGGGAGGGG + Intergenic
1143270320 17:5670403-5670425 TGGCACCCTCATGATGGGATTGG - Intergenic
1144857494 17:18277827-18277849 GGCAACCCTGGTGATGGCAGTGG - Exonic
1146884571 17:36462503-36462525 AGGCACCCTAGAGAAGGAAGGGG + Intergenic
1149667359 17:58374731-58374753 GGGCACCGTAGCCATGGGATTGG - Intronic
1150281232 17:63930736-63930758 GGGCAGCCCAGTGAAAGGAGGGG - Intronic
1150463973 17:65376166-65376188 GAGACCCCTGGTGATGGGAGGGG - Intergenic
1150852072 17:68713081-68713103 GGGCACCGGAGTGATGGGGTAGG + Intergenic
1153671361 18:7415352-7415374 AGGCAGCCAAGTGGTGGGAGGGG + Intergenic
1153811599 18:8756959-8756981 AGACACCCTAGTGATGAGTGAGG + Intronic
1155581466 18:27312821-27312843 GGGCAGCGTAGGGGTGGGAGTGG - Intergenic
1156168138 18:34448954-34448976 GGGCATGCTAGGAATGGGAGTGG + Intergenic
1158910829 18:62060248-62060270 TGGCACAATAGTCATGGGAGGGG - Intronic
1160828202 19:1090385-1090407 AGGGACCCTAGTGCTGGGACAGG - Intronic
1160888526 19:1364227-1364249 ACGCACCCTTGGGATGGGAGGGG - Intronic
1162315098 19:9934170-9934192 TGGCACCCCAGGGAAGGGAGGGG - Intronic
1166175093 19:41062429-41062451 TGGCACCATGGAGATGGGAGGGG - Intergenic
1166822252 19:45587744-45587766 GGGAACCTTTGTGAAGGGAGAGG + Intronic
1167045807 19:47048174-47048196 GGGCGCCGTAGGGATTGGAGGGG - Intronic
1167564726 19:50249140-50249162 GTCCACCCTTGTGCTGGGAGGGG + Intronic
1167622446 19:50567488-50567510 GGGCACGCCAGTGATGGGGAGGG - Intronic
926451953 2:13014996-13015018 TGGCATCCTGGAGATGGGAGAGG + Intergenic
929900063 2:45993075-45993097 GGGCAGCCTAGGGCTGGGAGTGG + Intronic
934558053 2:95297710-95297732 GGGCTCCCTTTGGATGGGAGAGG + Intronic
935609014 2:105001467-105001489 GGCCAGCCTAGTGCTGGGGGTGG - Intergenic
937701647 2:124868954-124868976 GGGCTCCCTAGGAATGGGAAGGG + Intronic
938105997 2:128530218-128530240 GGGCAGCCCAGTGTGGGGAGTGG + Intergenic
942231456 2:173864220-173864242 AGGCACCCCTGTGATGGGATCGG - Intergenic
942930522 2:181487204-181487226 GGGGAAGCTAGTGATGGGTGGGG - Intronic
944428046 2:199604033-199604055 GGCCAGCCCAGTGCTGGGAGCGG + Intergenic
945587516 2:211684919-211684941 GGGCAACCTAGTGAGGAGATGGG - Intronic
946300904 2:218823558-218823580 GGACACCCTGAGGATGGGAGTGG - Intronic
948289426 2:236814149-236814171 GTGCTCCCTAGCAATGGGAGTGG - Intergenic
948940186 2:241191444-241191466 GGGCTCCCTACTGATGGGGTGGG + Intronic
1169392927 20:5204832-5204854 GGTCAGCATAGTGAAGGGAGTGG - Intergenic
1170094309 20:12629229-12629251 GGGCACACTTGTGTTGGCAGTGG + Intergenic
1172105228 20:32513179-32513201 GGGCCTCCTTGTGATGGTAGAGG - Intronic
1172966596 20:38839999-38840021 GGGCAGCCAAGTGAGGGGAAGGG + Intronic
1175407696 20:58745518-58745540 GGGTTCCCAAGTGATGGGACTGG - Intergenic
1176218149 20:63957837-63957859 GGGCAGCCTCATGAGGGGAGGGG - Exonic
1176250335 20:64117497-64117519 GGGCACCCTGATGTTGGGGGCGG + Intergenic
1176250379 20:64117647-64117669 GGGCACCCTGATGTTGGGGGGGG + Intergenic
1176250490 20:64117997-64118019 GGGCACCCTGATGTTGGGGGGGG + Intergenic
1176250533 20:64118151-64118173 GGGCACCCTGATGTTGGGGGGGG + Intergenic
1176250579 20:64118302-64118324 GGGCACCCTGATGTTGGGGGGGG + Intergenic
1176250737 20:64118802-64118824 GGGCACCCTGATGTTGGGGGGGG + Intergenic
1176250753 20:64118853-64118875 GGGCACCCTGATGTTGGGGGGGG + Intergenic
1176250800 20:64119006-64119028 GGGCACCCTGATGTTGGGGGGGG + Intergenic
1176250860 20:64119209-64119231 GGGCACCCTGATGTCGGGAGGGG + Intergenic
1177599515 21:23292126-23292148 GGGAAGCCTAGTGGTGGGGGTGG - Intergenic
1180835271 22:18926539-18926561 AGGTACCCTAGAGAAGGGAGGGG - Intronic
1181035087 22:20166087-20166109 GGGCACCTTAGTGCTGGGGGTGG + Intergenic
1181508729 22:23379280-23379302 GGGCACCTTGGTGCTGGGGGTGG - Intergenic
1182022845 22:27095574-27095596 GTGCCTGCTAGTGATGGGAGAGG - Intergenic
1182865127 22:33597762-33597784 GCGCACCCCAGTGATGGCATGGG + Intronic
1183721880 22:39567417-39567439 GAGCACCACAGTGAGGGGAGAGG + Intergenic
1183793667 22:40097054-40097076 GTTCACCCTGGTGATGGGTGAGG + Intronic
1203285359 22_KI270734v1_random:151838-151860 AGGTACCCTAGAGAAGGGAGGGG - Intergenic
950630447 3:14278597-14278619 AGGCACCCTAGGGGTGGGAGAGG + Intergenic
952437648 3:33288081-33288103 GGCCACCCTAGTGCTGGAAGAGG - Intronic
953704480 3:45220766-45220788 TGGCTCCCTTGTGATGGGTGGGG + Intergenic
960316681 3:116186956-116186978 GGGCAACCAGGTGGTGGGAGGGG + Intronic
961831076 3:129623356-129623378 GGGCACCTTAGTGCTGGAAGGGG - Intergenic
968155138 3:196374852-196374874 GGGCAACAGAGTGAGGGGAGGGG + Intronic
969573409 4:8023186-8023208 GGGCACCCTAGTGATGGGAGAGG - Intronic
971085494 4:23270590-23270612 AGGTACCCCAGTGTTGGGAGTGG + Intergenic
979724318 4:123942387-123942409 GGGCAGCCCAGTGCTGGCAGAGG - Intergenic
980412776 4:132445584-132445606 GGGCAGCTTAGGAATGGGAGGGG - Intronic
985511322 5:315755-315777 AGGCTCCCTGGGGATGGGAGGGG + Intronic
985992482 5:3574963-3574985 GGGCACCCTAGGGAGAGGGGAGG - Intergenic
986407048 5:7436801-7436823 GGACACTTTTGTGATGGGAGTGG + Intronic
992069797 5:73137938-73137960 AGGCACCCTAGAAATGGGCGAGG - Intergenic
1003628841 6:7768295-7768317 GGGCGACCCAGTCATGGGAGGGG - Intronic
1010938495 6:81888285-81888307 GGGCAGCCTAGGCAGGGGAGGGG + Intergenic
1013686560 6:112591620-112591642 GGACACCCTTTTGATGGGAGTGG - Intergenic
1019764898 7:2843337-2843359 AGGCACCCTAGAGAGGGCAGAGG + Intronic
1022189987 7:28007859-28007881 GGGAATGCTAGTAATGGGAGAGG - Intronic
1022806620 7:33829023-33829045 GGTCACCCTAGTGCTAGGATAGG + Intergenic
1024231607 7:47367717-47367739 GAGCAGCTCAGTGATGGGAGGGG - Intronic
1025188743 7:56881128-56881150 GTGCACCCGAGTGATGTGATGGG + Intergenic
1025943083 7:66087656-66087678 GGGCAACCTAGTTGGGGGAGAGG + Intronic
1029481732 7:100817438-100817460 AGGCAGGCTAGTGATGGGAGTGG - Intronic
1032027620 7:128456054-128456076 GAGCACTCTAGCGATGGGGGTGG - Intronic
1035543147 8:457876-457898 GGTCACCCCAGTGATGAGGGAGG - Intronic
1037753910 8:21699448-21699470 GGGCTCCCTGGTGCTGGGAAAGG + Intronic
1038481104 8:27902326-27902348 GGGCTCCCTGGGGATGGGTGGGG - Intronic
1038651467 8:29407603-29407625 GGGCAACAGAGTGATGGGAAGGG - Intergenic
1038680623 8:29663868-29663890 GGGCACCCTGGTGCCAGGAGGGG + Intergenic
1039320703 8:36427406-36427428 GAGGCCCCTAGTGATGTGAGTGG - Intergenic
1042020404 8:64368380-64368402 GGGCACCCTGCTGATGGATGAGG - Intergenic
1044674977 8:94719805-94719827 GGGAACCAGAGTGTTGGGAGAGG - Intronic
1046600882 8:116315553-116315575 GGCCAGGCTTGTGATGGGAGGGG + Intergenic
1049328571 8:142037804-142037826 GGGCTCCCTATTGGTGGGAGGGG + Intergenic
1049614932 8:143571966-143571988 GGGCACCAAGGTGGTGGGAGGGG - Intronic
1054967923 9:71050888-71050910 GGGCACCTGATTAATGGGAGGGG + Intronic
1056287903 9:85109960-85109982 GGCCACCTTAGTGGTAGGAGTGG - Intergenic
1057203591 9:93157324-93157346 GGGCACCTTGGGGATAGGAGAGG - Intergenic
1059402037 9:114076641-114076663 GAGCACGCTGGTGCTGGGAGAGG - Exonic
1059748361 9:117224934-117224956 GGGCACTAGGGTGATGGGAGGGG - Intronic
1060334165 9:122705898-122705920 GGGCACACTAATGAAAGGAGTGG + Intergenic
1060479885 9:124011863-124011885 GCGCACCCCAGGGAGGGGAGGGG + Exonic
1060748275 9:126151974-126151996 GGGCAGCCCAGTGTGGGGAGTGG - Intergenic
1061716439 9:132521282-132521304 GGGGAACCTAGTGATGGGGGTGG - Intronic
1062065386 9:134523874-134523896 GGGATCCCAGGTGATGGGAGGGG - Intergenic
1062228826 9:135469689-135469711 GGGCCCCCTGGGGAGGGGAGTGG - Intergenic
1185620445 X:1450529-1450551 GGATGCCCTAGTGATGGGGGAGG - Intronic
1185620528 X:1450741-1450763 GGGAACCCTAGGGATGGGGGAGG - Intronic
1185620569 X:1450847-1450869 GGGACCCCTAGGGATGGGGGAGG - Intronic
1185620626 X:1450987-1451009 GGGACCCCTAGGGATGGGGGAGG - Intronic
1185620733 X:1451270-1451292 GGACCCCCTAGGGATGGGGGTGG - Intronic
1185620778 X:1451377-1451399 GGACCCCCTAGGGATGGGGGAGG - Intronic
1185620833 X:1451520-1451542 GGACCCCCTAGGGATGGGGGAGG - Intronic
1185621008 X:1451978-1452000 GGACCCCCTAGCGATGGGGGTGG - Intronic
1185621053 X:1452094-1452116 GGACCCCCTAGGGATGGGGGAGG - Intronic
1188529951 X:31128768-31128790 GGGGACCCAAGTGATGAGGGAGG - Intronic
1192245161 X:69365911-69365933 GAGCAGCCCAGTGTTGGGAGAGG + Intergenic
1194079727 X:89445000-89445022 GAACACCCTTGTGATGGGAGAGG - Intergenic
1197240090 X:124114329-124114351 GGGCAGCCTAGTGCTGGGGTGGG + Intronic
1199690856 X:150308188-150308210 GGGAATCCTATAGATGGGAGAGG - Intergenic
1200224243 X:154408474-154408496 GGGCTCCCCAGTGGTGGCAGGGG - Intronic
1200258121 X:154596601-154596623 GAGCACCATGGTGAGGGGAGGGG + Intergenic
1200432345 Y:3100289-3100311 GAACACCCTTGTGATGGGAGAGG - Intergenic