ID: 969573410

View in Genome Browser
Species Human (GRCh38)
Location 4:8023191-8023213
Sequence TCTGTGGGCACCCTAGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969573410_969573415 2 Left 969573410 4:8023191-8023213 CCCATCACTAGGGTGCCCACAGA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 969573415 4:8023216-8023238 GGTGCCACCTGCACGCCGCACGG 0: 1
1: 0
2: 0
3: 11
4: 95
969573410_969573420 10 Left 969573410 4:8023191-8023213 CCCATCACTAGGGTGCCCACAGA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 969573420 4:8023224-8023246 CTGCACGCCGCACGGGATTCGGG 0: 1
1: 0
2: 0
3: 4
4: 51
969573410_969573419 9 Left 969573410 4:8023191-8023213 CCCATCACTAGGGTGCCCACAGA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 969573419 4:8023223-8023245 CCTGCACGCCGCACGGGATTCGG 0: 1
1: 0
2: 0
3: 2
4: 40
969573410_969573422 19 Left 969573410 4:8023191-8023213 CCCATCACTAGGGTGCCCACAGA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 969573422 4:8023233-8023255 GCACGGGATTCGGGTTTCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 48
969573410_969573423 20 Left 969573410 4:8023191-8023213 CCCATCACTAGGGTGCCCACAGA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573410_969573416 3 Left 969573410 4:8023191-8023213 CCCATCACTAGGGTGCCCACAGA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 969573416 4:8023217-8023239 GTGCCACCTGCACGCCGCACGGG 0: 1
1: 0
2: 4
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969573410 Original CRISPR TCTGTGGGCACCCTAGTGAT GGG (reversed) Intronic