ID: 969573411

View in Genome Browser
Species Human (GRCh38)
Location 4:8023192-8023214
Sequence ATCTGTGGGCACCCTAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969573411_969573416 2 Left 969573411 4:8023192-8023214 CCATCACTAGGGTGCCCACAGAT 0: 1
1: 0
2: 1
3: 11
4: 96
Right 969573416 4:8023217-8023239 GTGCCACCTGCACGCCGCACGGG 0: 1
1: 0
2: 4
3: 6
4: 111
969573411_969573422 18 Left 969573411 4:8023192-8023214 CCATCACTAGGGTGCCCACAGAT 0: 1
1: 0
2: 1
3: 11
4: 96
Right 969573422 4:8023233-8023255 GCACGGGATTCGGGTTTCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 48
969573411_969573419 8 Left 969573411 4:8023192-8023214 CCATCACTAGGGTGCCCACAGAT 0: 1
1: 0
2: 1
3: 11
4: 96
Right 969573419 4:8023223-8023245 CCTGCACGCCGCACGGGATTCGG 0: 1
1: 0
2: 0
3: 2
4: 40
969573411_969573420 9 Left 969573411 4:8023192-8023214 CCATCACTAGGGTGCCCACAGAT 0: 1
1: 0
2: 1
3: 11
4: 96
Right 969573420 4:8023224-8023246 CTGCACGCCGCACGGGATTCGGG 0: 1
1: 0
2: 0
3: 4
4: 51
969573411_969573415 1 Left 969573411 4:8023192-8023214 CCATCACTAGGGTGCCCACAGAT 0: 1
1: 0
2: 1
3: 11
4: 96
Right 969573415 4:8023216-8023238 GGTGCCACCTGCACGCCGCACGG 0: 1
1: 0
2: 0
3: 11
4: 95
969573411_969573423 19 Left 969573411 4:8023192-8023214 CCATCACTAGGGTGCCCACAGAT 0: 1
1: 0
2: 1
3: 11
4: 96
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969573411 Original CRISPR ATCTGTGGGCACCCTAGTGA TGG (reversed) Intronic
903796087 1:25929875-25929897 ATCTGTGGGCACCTCAATGCAGG + Intergenic
907286303 1:53382584-53382606 ACTTGTGTCCACCCTAGTGAGGG + Intergenic
907302933 1:53499686-53499708 ATCTGAGGGCAGCCAAGTCATGG - Intergenic
910511340 1:88009068-88009090 ATCTGATGGCACCCAAGAGAAGG + Intergenic
910678123 1:89835212-89835234 TTCTGAGGGCAGCCTGGTGAGGG + Intronic
911161295 1:94685262-94685284 ATGTGTGGGCCCCAAAGTGAAGG - Intergenic
914999633 1:152577189-152577211 ATCTGTGGGCTCCTTGGTGTGGG + Intronic
917170722 1:172170742-172170764 ATTTGTGGGCAGACTAGAGAAGG - Intronic
922769093 1:228172463-228172485 ATCTGAGGGCACTATGGTGAGGG - Intronic
1063568484 10:7193272-7193294 ATCTGTGGGCACCCCTTTGTGGG - Intronic
1063702913 10:8402962-8402984 TTCTGTCGACATCCTAGTGAGGG + Intergenic
1064194428 10:13233756-13233778 ATCTGTGGGCACCATGCAGATGG - Exonic
1064313921 10:14237127-14237149 AGCTGTGGGCACCCTACATATGG - Intronic
1065271262 10:24036114-24036136 ATCTTTGGCTACCCCAGTGAAGG - Intronic
1065439700 10:25738833-25738855 ATCTGTGGCCTCCCAAGTGCTGG + Intergenic
1067540459 10:47147318-47147340 ATCCCTGGTCACCCTAGGGATGG + Intergenic
1069160291 10:65084308-65084330 GTCTGTGGGCAGCCTTGTGGTGG + Intergenic
1070052266 10:72900683-72900705 ATCTGTGGCTACCCTAGTGGAGG - Intronic
1072533199 10:96338985-96339007 ATCTGAGGGCACCCAAGGGAAGG + Intergenic
1074154930 10:110789762-110789784 ATCTCTGGGGACCCTAGAGTGGG - Intronic
1077993324 11:7431824-7431846 AACTGTGGGTACCAGAGTGAAGG + Intronic
1080301741 11:30792163-30792185 ATATGTGGTCACCCTAATTAAGG + Intergenic
1089228007 11:116943074-116943096 ATCTGTGGGCACCACATTCATGG + Intronic
1089819664 11:121213204-121213226 GGCTGTGGGCACCCTACTGTGGG - Intergenic
1090954484 11:131502332-131502354 ATCTGTTGGCACCTTAATCATGG + Intronic
1095049941 12:37546271-37546293 GTCTGTGGGCACCCTCCTGGGGG - Intergenic
1095855637 12:46857733-46857755 CTTTCTGGGCACCATAGTGAAGG - Intergenic
1097221029 12:57451274-57451296 AGCTGTGGGCACGCAAGTGTGGG + Intergenic
1098264606 12:68705888-68705910 AGCTGTGTGCACCCAGGTGAAGG + Intronic
1101756545 12:107625530-107625552 CTCTGTTGGCACCCAAGTTAGGG + Intronic
1114364958 14:22015879-22015901 ATCTGAGGGCATCCTACTTAAGG - Intergenic
1123713375 15:23007846-23007868 GTCTGAGGTCACCCTGGTGAGGG + Intronic
1126063159 15:44803609-44803631 ATTTGTTGGCAGTCTAGTGAAGG - Intergenic
1126364116 15:47876190-47876212 TTCTGTGTGAACCCTAGTGGTGG + Intergenic
1141414320 16:83858384-83858406 ATCTGTGTGCACACTTGTGTAGG - Intergenic
1143158623 17:4854378-4854400 ATCTGTGGGGAACCTAGACATGG + Intronic
1203165603 17_GL000205v2_random:90104-90126 CTGTTTGGGCACCATAGTGAGGG - Intergenic
1159102190 18:63969974-63969996 GTCTGTGGGCACCGGAGAGAGGG - Exonic
1160032276 18:75272363-75272385 ATCTGTGTGCACCCCTCTGATGG + Intronic
1160783624 19:889703-889725 CTCAGTGGGCAGCCTAGTGGAGG - Exonic
1165509639 19:36258528-36258550 ATCTGTGGGCACCCTCCTGCGGG - Intergenic
1165511161 19:36267491-36267513 ATCTGTGGGCACCCTCCTGCTGG - Intergenic
1166771969 19:45289036-45289058 ACCTGTGTGCACCCTGGTCAAGG - Intronic
925213927 2:2076027-2076049 CTCTGTGGGCACAGTAGTGAGGG + Intronic
926225787 2:10966092-10966114 AGCTCTGGGCAGCCTAGTTATGG - Intergenic
926916086 2:17893515-17893537 ATCTCTGGGCACCCTCATGATGG + Intronic
928205647 2:29281340-29281362 CTCTGTGGGCAGCCTGGTCAAGG + Intronic
929940169 2:46327797-46327819 AGCTGTGGGCACCCTGGTGGTGG + Intronic
937013034 2:118578496-118578518 ATCTGTGGGCAGCCCACTGGAGG + Intergenic
938182676 2:129197027-129197049 ATGTTTCTGCACCCTAGTGATGG - Intergenic
939886872 2:147690768-147690790 ATCTGTGGGAACTGTAGAGATGG - Intergenic
942584747 2:177463179-177463201 AACTCTGGGCACCCTAGTTAGGG + Intronic
945590556 2:211724905-211724927 ATCAGTAGACAACCTAGTGAGGG + Intronic
946607998 2:221427010-221427032 AACTATGGAAACCCTAGTGAAGG + Intronic
947817668 2:233048870-233048892 ATCTGTGGGCAGAATAGTGAGGG + Intergenic
948731112 2:239964248-239964270 ATTTCTGAGGACCCTAGTGATGG - Intronic
949073685 2:242041574-242041596 CTCTGTGTGCACCCTGGGGACGG - Intergenic
1171384628 20:24761957-24761979 ATCTGCCAGCGCCCTAGTGAAGG + Intergenic
1171544464 20:25989785-25989807 GTCTGTGGGCACCCTCCTGGGGG - Intergenic
1176336003 21:5600876-5600898 CTGTTTGGGCACCATAGTGAGGG + Intergenic
1176391754 21:6220072-6220094 CTGTTTGGGCACCATAGTGAGGG - Intergenic
1176469665 21:7096102-7096124 CTGTTTGGGCACCATAGTGAGGG + Intergenic
1176493226 21:7477880-7477902 CTGTTTGGGCACCATAGTGAGGG + Intergenic
1176507416 21:7660503-7660525 CTGTTTGGGCACCATAGTGAGGG - Intergenic
1176516616 21:7789166-7789188 GTCTGGGGCCACCCTAGGGAAGG + Intergenic
1178596419 21:33957516-33957538 ATCTGAGGGCAGCCTAGTTGTGG + Intergenic
1178650644 21:34419178-34419200 GTCTGGGGCCACCCTAGGGAAGG + Exonic
1182486296 22:30641098-30641120 ACCTGTGGGCACCCCTGTGCAGG + Intronic
1183690549 22:39385507-39385529 ATCTGTGGTGAACCAAGTGAAGG + Exonic
955932345 3:64069938-64069960 ATATGTGGGGACCCTAGTGTTGG + Intergenic
956029321 3:65020169-65020191 ATCTGTGGGCCCCCTAGGGATGG - Intergenic
956780834 3:72601865-72601887 ACCTGTGGCCAACCCAGTGATGG + Intergenic
961017969 3:123482060-123482082 ATCTGTGGGCACCTTCCAGAAGG - Intergenic
962830185 3:139132548-139132570 ATCTGTGGGCCCACCTGTGATGG - Intronic
969462860 4:7337955-7337977 ATCTGTGGGGACCACAGAGAGGG - Intronic
969573411 4:8023192-8023214 ATCTGTGGGCACCCTAGTGATGG - Intronic
970311994 4:14792707-14792729 ATCTCTGGCCACCCTCCTGAAGG - Intergenic
974977450 4:68907437-68907459 CTGTCTGGGCACCATAGTGAAGG - Intergenic
975110938 4:70625758-70625780 ATGGGTGGGCACCCAAGTCAGGG + Intergenic
981860674 4:149352339-149352361 ATCTGTGGGTTCCCTGGTAATGG + Intergenic
985682366 5:1263124-1263146 AGGTGTGGACACCCTCGTGATGG - Intronic
989315305 5:40071406-40071428 CTCTTTGGGCACCCTAGATATGG + Intergenic
990491134 5:56304011-56304033 ATGTGTGGGCACCCTTTTGCAGG + Intergenic
993076073 5:83233391-83233413 ATCTTTAGGCACCCTAGAGGAGG + Intronic
997757076 5:136409361-136409383 TTCTGTGGGAAACATAGTGAGGG - Intergenic
998063366 5:139136662-139136684 ATCTGTGGACACTCTTTTGAAGG - Intronic
1000065401 5:157689938-157689960 ATCTGAGGGCAGCACAGTGAGGG + Intergenic
1001773716 5:174313548-174313570 ATGTGTGGGTGCCGTAGTGACGG + Intergenic
1002359362 5:178658528-178658550 TCCTGTGGGCAGCCTGGTGAGGG + Intergenic
1003228113 6:4224723-4224745 CTGTCTGGGCACCGTAGTGAAGG + Intergenic
1003622076 6:7709171-7709193 ATCTGTTGTCCCACTAGTGATGG - Intergenic
1005602946 6:27446344-27446366 CTCTGTGGCCACCCTAGCCATGG + Intergenic
1005983296 6:30853956-30853978 ATCTGTGGGCCCACAAGTTAAGG + Intergenic
1008887018 6:56442470-56442492 TTATGTGGGTACCCTAGAGAGGG - Intergenic
1010943027 6:81941618-81941640 AACTGTGGGCACACTGGGGAGGG + Intergenic
1013604520 6:111735366-111735388 AGCTTTAGGCACCATAGTGAGGG - Intronic
1019143989 6:169965096-169965118 GCCTGTGGGCAGCCTGGTGAGGG + Intergenic
1019351008 7:553978-554000 GTCTGTGGGCACCCGGCTGAGGG - Intronic
1019804438 7:3112964-3112986 AGCTGTGGTCACCCTGGTCAGGG - Intergenic
1024363523 7:48494452-48494474 ATCTGGTGGTACCCGAGTGAAGG + Intronic
1025284048 7:57648526-57648548 GTCTGTGGGCACACTCGTGCGGG + Intergenic
1025295849 7:57774850-57774872 GTCTGTGGGCACCCTCCTGGGGG - Intergenic
1030472384 7:109981235-109981257 ATCTGTGGGCTCCACAATGATGG - Intergenic
1045218961 8:100178471-100178493 ATCTGTGGGCTCCACAGAGAAGG + Intronic
1047310997 8:123691912-123691934 ATCTGTGGGCTCCGTAGTGTGGG + Intronic
1047684592 8:127292010-127292032 ATCTGTGGCCACTGTAGTTAAGG + Intergenic
1203425635 Un_GL000195v1:34026-34048 CTGTTTGGGCACCATAGTGAGGG - Intergenic
1186660194 X:11661760-11661782 TTCTGTGGGCACTCTCTTGATGG + Intronic
1193468841 X:81875885-81875907 AGCTGTGGCCACCCAAGTCAGGG - Intergenic