ID: 969573413

View in Genome Browser
Species Human (GRCh38)
Location 4:8023206-8023228
Sequence TGCAGGTGGCACCAATCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969573413_969573423 5 Left 969573413 4:8023206-8023228 CCCACAGATTGGTGCCACCTGCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573413_969573419 -6 Left 969573413 4:8023206-8023228 CCCACAGATTGGTGCCACCTGCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 969573419 4:8023223-8023245 CCTGCACGCCGCACGGGATTCGG 0: 1
1: 0
2: 0
3: 2
4: 40
969573413_969573422 4 Left 969573413 4:8023206-8023228 CCCACAGATTGGTGCCACCTGCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 969573422 4:8023233-8023255 GCACGGGATTCGGGTTTCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 48
969573413_969573420 -5 Left 969573413 4:8023206-8023228 CCCACAGATTGGTGCCACCTGCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 969573420 4:8023224-8023246 CTGCACGCCGCACGGGATTCGGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969573413 Original CRISPR TGCAGGTGGCACCAATCTGT GGG (reversed) Intronic
904331649 1:29761641-29761663 TGGAGGTGGCACTAACCTGGTGG - Intergenic
905468712 1:38175725-38175747 TGCAGGCACCTCCAATCTGTGGG - Intergenic
908325236 1:63017158-63017180 TGCAGGGGTCTCCAATCTTTTGG + Intergenic
910437523 1:87220283-87220305 TGGAAGTGGCAGCAATCTGGAGG + Intergenic
912984354 1:114411765-114411787 TTCAGTTAGCACCTATCTGTTGG - Intronic
916660439 1:166918545-166918567 TGTGTGTGGCACCAACCTGTGGG + Exonic
916743556 1:167666950-167666972 TGCAGGGGTCTCCAATCTTTTGG - Intronic
917056553 1:170988352-170988374 TGCAGATGGGAGCATTCTGTAGG + Intronic
917662602 1:177192038-177192060 TAAAGGTGGCATCAATCAGTTGG + Intronic
917956398 1:180103102-180103124 ACCTGGTGGAACCAATCTGTGGG - Intronic
918376712 1:183916626-183916648 TGCAGGTGTCTTCATTCTGTTGG - Exonic
918460486 1:184771478-184771500 ACCTGGTGGAACCAATCTGTGGG + Intergenic
922252581 1:223863564-223863586 TGAAGGTGACAGCAGTCTGTTGG - Intergenic
1066206830 10:33197692-33197714 TTCAGGTGGCACCACTGTGCTGG - Exonic
1067158065 10:43799475-43799497 TGCAGGTGGCAAGGATCTGGGGG + Intergenic
1069863923 10:71488654-71488676 TGCACCTGGCAACAATCAGTGGG + Intronic
1070461165 10:76671912-76671934 ACCTGGTGGAACCAATCTGTGGG - Intergenic
1074510603 10:114108588-114108610 TGGAGGTGGCACATAGCTGTGGG - Intergenic
1077943860 11:6873529-6873551 TGCATGTGGCACTCTTCTGTTGG - Intergenic
1079669149 11:23144454-23144476 TGTATGTGGCACAAACCTGTAGG - Intergenic
1080777565 11:35400387-35400409 TGTAGGTTGCAAAAATCTGTAGG + Intronic
1083889902 11:65590488-65590510 TGCAGGTGCCAACAAGCTGCAGG + Exonic
1084534991 11:69751283-69751305 GGGAGGTGGCACCAGCCTGTGGG + Intergenic
1084603881 11:70161798-70161820 TCCAGGTGCCCCCAACCTGTGGG - Intronic
1085277127 11:75307401-75307423 TGCAGGAGCCTCCAATCTGATGG - Intronic
1090463661 11:126913506-126913528 TGCAGCTGGCAGCTATCTGATGG + Intronic
1090955858 11:131512484-131512506 TCCAGGAGGCACCCAGCTGTGGG - Intronic
1091624245 12:2110344-2110366 TGCTGGGGGCACCTACCTGTTGG + Intronic
1092566820 12:9674269-9674291 TGCAGATTGCAAAAATCTGTGGG + Intronic
1094265685 12:28556745-28556767 TGCTGGTGGGACAAAACTGTGGG + Intronic
1096908745 12:54961328-54961350 TGCAGGTGGCAGGTAGCTGTAGG + Intronic
1100119798 12:91356258-91356280 TGAAGTTGGCACCAGTCTCTGGG - Intergenic
1101292195 12:103382105-103382127 AGCAGGTGCCACCAATCCATTGG + Intronic
1102057232 12:109905728-109905750 TGCAGTTTGCACTAATCTGTGGG + Intronic
1103178331 12:118884753-118884775 TGCAGGAGGCTACAAGCTGTAGG - Intergenic
1103881686 12:124171146-124171168 GGCAGGTGGCAAAAGTCTGTGGG - Intronic
1104746526 12:131214305-131214327 GGCAGGTGGCCCCTCTCTGTGGG - Intergenic
1106202482 13:27551929-27551951 TGCAGGTGGCCCCTATATGCAGG - Intronic
1109097335 13:58134581-58134603 TGCAGGTTGCACAGATCTATGGG + Intergenic
1113646805 13:112003622-112003644 TGTAGCTGGCACGAATCTGAGGG - Intergenic
1116711931 14:48379221-48379243 TGCATGTGTCATCAAGCTGTTGG + Intergenic
1117894181 14:60462888-60462910 TGCAGGTGTGTCCAATCTTTTGG - Intronic
1119215080 14:72863346-72863368 TGCAGGTGCCACCGACCTGAAGG + Intronic
1120738656 14:88083296-88083318 TACAGGTGACTCCAATCTCTGGG + Intergenic
1121272061 14:92644349-92644371 TGCAGGTGAGAGGAATCTGTAGG - Intronic
1121434825 14:93912182-93912204 TGCAGGTGGCAGCCATCAGAGGG - Intergenic
1122347278 14:101068375-101068397 TGCAGGAGGCACGAGTCAGTTGG + Intergenic
1125734207 15:41912183-41912205 CTCAGGTGGCACCAAGCTGGCGG - Intronic
1127832231 15:62761033-62761055 TACAGGAGGCACCCATTTGTGGG + Intronic
1128376127 15:67077309-67077331 TCCAGGTGGCACCATTATATGGG + Intronic
1131522180 15:93124990-93125012 TGCTGGTGGCAGCAATGTGTTGG + Intergenic
1132605426 16:791846-791868 TGCAGGTGGCACTGCTCTGTGGG + Exonic
1138355517 16:56375266-56375288 TGCAGGTGTGTCCAATCTTTTGG - Intronic
1140474881 16:75234873-75234895 GGCAGGCGGCACCCACCTGTAGG + Exonic
1142158222 16:88542682-88542704 TGCGGCTGGCACCAATCAGATGG + Intergenic
1145067524 17:19772000-19772022 AACAGGTGGGATCAATCTGTAGG - Intronic
1146841216 17:36155720-36155742 TGCAAGTGGCGCCAATGTGGAGG - Intergenic
1147072238 17:37967868-37967890 TGCAAGTGGCGCCAATGTGGAGG - Intergenic
1148051327 17:44771466-44771488 TGCAGGTGGCCACAATCCCTGGG - Intronic
1149858359 17:60105439-60105461 TTCAAGTGGCACCAATGTGGAGG + Intergenic
1152351411 17:79785803-79785825 TTCAGGTGGAACCCAGCTGTGGG - Exonic
1152750183 17:82059015-82059037 TGCAGGGGGCACCATCCTGCAGG + Intronic
1157520780 18:48343824-48343846 TGCAGGTGGCAGGCAGCTGTGGG - Intronic
1158392296 18:57053295-57053317 TGGCCCTGGCACCAATCTGTGGG - Intergenic
1163371327 19:16902848-16902870 TGTAGGTGACATCAATCTGGGGG + Exonic
1163578572 19:18124595-18124617 TGCAGGTGGAACCAAGCCCTGGG + Intronic
1163757671 19:19116167-19116189 TGCAGGGGGCACCAATGAGCAGG - Intergenic
1167969245 19:53176437-53176459 TGCAGGTGGAAGCGATCTATTGG - Intronic
1168630902 19:57955269-57955291 TGCAGGCAGGACCAAGCTGTCGG + Intergenic
925740252 2:6999363-6999385 TGCAGGTCGCCCCAAGCTGGGGG + Intronic
929588705 2:43131726-43131748 TGCAGGGGGCACCATTCACTTGG + Intergenic
933051993 2:77611926-77611948 TACAGGTTGCAAAAATCTGTGGG - Intergenic
933153798 2:78947965-78947987 TTCAGGTGGCACCAACCGGCTGG + Intergenic
938159727 2:128974255-128974277 TGCAGGTGGTCCCAAACTGCAGG - Intergenic
940057224 2:149525856-149525878 TGCAGGTTGCAAAGATCTGTAGG + Intergenic
946146192 2:217732938-217732960 TGCAGGTGGCCCCATCCTGGTGG + Intronic
947407414 2:229793941-229793963 TGCAGGAGGGTCCAATCTTTTGG - Intronic
1170208377 20:13823534-13823556 TTCAGGTGGCAGCACTCTGGAGG + Intergenic
1173067574 20:39727947-39727969 AGCAGGTGGCAGCCATATGTAGG - Intergenic
1173097893 20:40054443-40054465 TGCAATTGGAACCATTCTGTTGG + Intergenic
1173114550 20:40228364-40228386 TGAGGGTGGCACCAAGGTGTAGG - Intergenic
1176359458 21:5982813-5982835 TGCAGGTGGCACATATGGGTGGG + Intergenic
1178738070 21:35170752-35170774 TGCAGGTGGCTTCAAACAGTGGG + Intronic
1179764060 21:43555737-43555759 TGCAGGTGGCACATATGGGTGGG - Intronic
1183747585 22:39700473-39700495 TGCATGTGACACTAAGCTGTGGG + Intergenic
1185328024 22:50237070-50237092 TGCATGTGCCACCCATCTGGGGG - Intronic
954397763 3:50302110-50302132 TGCTGGTGACCCCAATCTGCCGG - Exonic
956213198 3:66822980-66823002 TGCAGGGGGCACCTATCTTATGG + Intergenic
957286463 3:78223230-78223252 TGCAGGTGTCTCCAATCTTTTGG - Intergenic
962028734 3:131576194-131576216 TCCAGGTGGCACACATCTATTGG + Intronic
962984482 3:140522077-140522099 TGCAGGTTGCAAAAATCTGTGGG + Intronic
964907296 3:161733074-161733096 TGCATGTGCCAACATTCTGTAGG + Intergenic
965093524 3:164193003-164193025 GGCAGCTGGCACCAACCTGTGGG - Intergenic
967344778 3:188442568-188442590 TGCCCGGGCCACCAATCTGTTGG - Intronic
968728675 4:2259840-2259862 TGCAGGGGGGTCCATTCTGTGGG - Intronic
968969500 4:3786207-3786229 TGCAGATGACACCAACCTGCAGG - Intergenic
969554197 4:7894985-7895007 GGCAGGTGGCACCAGGCTCTGGG + Intronic
969573413 4:8023206-8023228 TGCAGGTGGCACCAATCTGTGGG - Intronic
969866659 4:10080754-10080776 TGCAGGTGGCCCCACTGTCTGGG + Intronic
975081553 4:70286194-70286216 TGGTGGTGGCACCAATCCCTAGG - Intergenic
976426274 4:84906871-84906893 TGCAGGTGTGTCCAATCTTTGGG - Intronic
981724616 4:147834328-147834350 TGGTGGTGGCACGCATCTGTAGG + Intronic
984723070 4:182994567-182994589 TGCAGGGGTGACCAATCTTTTGG - Intergenic
987072443 5:14351132-14351154 TACAGGGGTCACCAATGTGTGGG - Intronic
991106596 5:62851179-62851201 TGCAGGTGGCACATACATGTAGG + Intergenic
996571578 5:124937791-124937813 AGCTGGTGGCACACATCTGTAGG - Intergenic
997425687 5:133801170-133801192 AGCAGTGGGCACCAATGTGTGGG - Intergenic
997615160 5:135241078-135241100 TACCTGTGGCACCAATCTATGGG - Intronic
998607081 5:143646604-143646626 ACCAGGTGGCAGCACTCTGTGGG - Intergenic
1002055241 5:176594932-176594954 TGCAGGTGGGACCAGCCTGTGGG + Intronic
1006429013 6:33983788-33983810 GGCAGGAGGAACCAAGCTGTGGG + Intergenic
1007167403 6:39838543-39838565 TCCAGGTGACACTAATTTGTAGG - Intronic
1008492466 6:52100675-52100697 TGCAGGTGGCAGTAATCTCTTGG - Intergenic
1011413781 6:87095136-87095158 TGCAGGTGGAAACACTCTGCTGG - Intronic
1012309862 6:97709797-97709819 TCCAGGTAGCACCATTCTGGAGG + Intergenic
1017906264 6:158759213-158759235 TGCAGGTGGCACAGAGCTGCAGG + Intronic
1019278676 7:189058-189080 TGCAGGTGGGGCCAGGCTGTGGG - Intergenic
1019558270 7:1643164-1643186 TGCAGGTGAGACCCATCTGAAGG - Intergenic
1020556821 7:9680798-9680820 TGTAGATGGCATCAATCAGTGGG - Intergenic
1024637406 7:51301785-51301807 TGCAGGTTCCTCCACTCTGTGGG + Intronic
1029661702 7:101966689-101966711 TGCAGGTGGCCCTCACCTGTCGG - Intronic
1029941719 7:104487862-104487884 TGCAGGTGGTTCCTATATGTAGG + Intronic
1036971060 8:13355517-13355539 TGCAGGTGGCCCCTCTCTGGTGG + Intronic
1039527601 8:38230998-38231020 TGCAGCTGGCACCAATGGGCTGG + Intronic
1041586641 8:59528474-59528496 TGCAGGGGTGACCAATCTTTTGG + Intergenic
1046890390 8:119416017-119416039 TGCAGATGGCCCCAAACTGCAGG + Intergenic
1048893016 8:138964721-138964743 TGCAGGTGGCTCCAAAATGGAGG - Intergenic
1050545214 9:6703910-6703932 TGCAGGTGTCACCAGCCTCTGGG - Intergenic
1052093090 9:24353998-24354020 TACAGGTGCCACCAAACTTTTGG + Intergenic
1052691484 9:31821227-31821249 AGCAGGTAGCACCTATCTGCAGG - Intergenic
1058803050 9:108563447-108563469 TGCAGGTAGCTCCATTCAGTAGG - Intergenic
1061009193 9:127945338-127945360 TCCAGGGGGCACCAAGCAGTAGG + Intronic
1061957617 9:133971755-133971777 TGCAGGTGGCCCCAGGCTGTGGG - Intronic
1062386381 9:136313290-136313312 TGCAGGTGGCCCCTATCCTTGGG + Intergenic
1185765096 X:2718942-2718964 TGCAGATAGCACCAATGAGTAGG + Intronic
1188318945 X:28711350-28711372 TGCAGGTGGCACAGATTTGGAGG + Intronic
1189652394 X:43204040-43204062 TGCAGGTGGCAAAGATCTGTAGG + Intergenic
1191185625 X:57607940-57607962 TGCGGGTTGCAAAAATCTGTGGG + Intergenic
1193935920 X:87621635-87621657 TGCAGTTGGTAACAATCTATGGG - Intronic
1197592010 X:128420345-128420367 TGGATGTGGCACCATTCTTTGGG + Intergenic
1198958272 X:142156241-142156263 TGCAGGTTGCAAGGATCTGTGGG - Intergenic
1200372101 X:155738692-155738714 TGCAGGTTGCAAAGATCTGTGGG - Intergenic