ID: 969573414

View in Genome Browser
Species Human (GRCh38)
Location 4:8023207-8023229
Sequence GTGCAGGTGGCACCAATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969573414_969573419 -7 Left 969573414 4:8023207-8023229 CCACAGATTGGTGCCACCTGCAC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 969573419 4:8023223-8023245 CCTGCACGCCGCACGGGATTCGG 0: 1
1: 0
2: 0
3: 2
4: 40
969573414_969573420 -6 Left 969573414 4:8023207-8023229 CCACAGATTGGTGCCACCTGCAC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 969573420 4:8023224-8023246 CTGCACGCCGCACGGGATTCGGG 0: 1
1: 0
2: 0
3: 4
4: 51
969573414_969573422 3 Left 969573414 4:8023207-8023229 CCACAGATTGGTGCCACCTGCAC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 969573422 4:8023233-8023255 GCACGGGATTCGGGTTTCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 48
969573414_969573423 4 Left 969573414 4:8023207-8023229 CCACAGATTGGTGCCACCTGCAC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969573414 Original CRISPR GTGCAGGTGGCACCAATCTG TGG (reversed) Intronic