ID: 969573414

View in Genome Browser
Species Human (GRCh38)
Location 4:8023207-8023229
Sequence GTGCAGGTGGCACCAATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969573414_969573420 -6 Left 969573414 4:8023207-8023229 CCACAGATTGGTGCCACCTGCAC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 969573420 4:8023224-8023246 CTGCACGCCGCACGGGATTCGGG 0: 1
1: 0
2: 0
3: 4
4: 51
969573414_969573422 3 Left 969573414 4:8023207-8023229 CCACAGATTGGTGCCACCTGCAC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 969573422 4:8023233-8023255 GCACGGGATTCGGGTTTCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 48
969573414_969573423 4 Left 969573414 4:8023207-8023229 CCACAGATTGGTGCCACCTGCAC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573414_969573419 -7 Left 969573414 4:8023207-8023229 CCACAGATTGGTGCCACCTGCAC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 969573419 4:8023223-8023245 CCTGCACGCCGCACGGGATTCGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969573414 Original CRISPR GTGCAGGTGGCACCAATCTG TGG (reversed) Intronic
900182806 1:1319850-1319872 GTGAAGGTGGCACAGACCTGAGG + Intronic
905321278 1:37119177-37119199 GTGCAGGTGGCACTAGTGTGGGG + Intergenic
905468713 1:38175726-38175748 GTGCAGGCACCTCCAATCTGTGG - Intergenic
906710567 1:47926773-47926795 GAGTAGTTGGCACCAGTCTGTGG - Intronic
909318050 1:74248173-74248195 GGGCTGGTGGCACCAGCCTGCGG + Intronic
910482797 1:87676662-87676684 GTGCAGGTGGCACCACTGCCCGG + Intergenic
910867642 1:91802831-91802853 GTACACCTGGCACCAACCTGGGG + Intronic
915424881 1:155817494-155817516 GTGTAGGTGGGACCAATATAGGG + Intronic
916660438 1:166918544-166918566 GTGTGTGTGGCACCAACCTGTGG + Exonic
918839183 1:189512932-189512954 CTGCGGGTTGCACGAATCTGTGG - Intergenic
1063397149 10:5699399-5699421 GTGAAGGTTGCACAATTCTGTGG + Intronic
1063402377 10:5758690-5758712 GAGCAGGTGGGACCAGGCTGAGG + Intronic
1065493911 10:26309620-26309642 GTGAAGATGGGTCCAATCTGTGG + Intergenic
1067158064 10:43799474-43799496 GTGCAGGTGGCAAGGATCTGGGG + Intergenic
1067561425 10:47307470-47307492 GTGCAGGGGGCTCCAGGCTGTGG - Intronic
1069587587 10:69618776-69618798 GGGCAGGTGGCAGCACTCTGGGG + Intergenic
1072782283 10:98259121-98259143 GTGCAGGTGGCTCCAGCCCGGGG - Exonic
1073042350 10:100616131-100616153 GAGGAGGTGGAACCAGTCTGGGG - Intergenic
1074510604 10:114108589-114108611 GTGGAGGTGGCACATAGCTGTGG - Intergenic
1075140243 10:119827261-119827283 GTGCATCTTGCACAAATCTGTGG - Exonic
1079124754 11:17710374-17710396 GAGCAGGTGGGACGCATCTGTGG + Intergenic
1084976127 11:72799618-72799640 GATCAGGTGACACCAGTCTGGGG + Intergenic
1085471537 11:76761528-76761550 GTGCTGGTAGCACTGATCTGAGG - Intergenic
1086050455 11:82582940-82582962 GTTAAGGTGGCACTAGTCTGTGG - Intergenic
1086858019 11:91890180-91890202 GTGCATGTGGCAAGAACCTGAGG + Intergenic
1091454911 12:599777-599799 GTGCAGGTCCAACCAAGCTGAGG - Intronic
1096046017 12:48563125-48563147 GAGCAGGTAGCACCCATCAGAGG + Intergenic
1096776101 12:53965347-53965369 TTGCAGGTGGGGCCAATGTGAGG + Intergenic
1098134533 12:67388482-67388504 CTGCAAATGGCACCAATCTCAGG - Intergenic
1102057231 12:109905727-109905749 GTGCAGTTTGCACTAATCTGTGG + Intronic
1104746527 12:131214306-131214328 GGGCAGGTGGCCCCTCTCTGTGG - Intergenic
1108997769 13:56756590-56756612 GTTGAGGTGGCTCCAATCTTGGG + Intergenic
1113646806 13:112003623-112003645 CTGTAGCTGGCACGAATCTGAGG - Intergenic
1113684346 13:112271842-112271864 GTTTAGGTGACACTAATCTGGGG - Intergenic
1113857168 13:113453577-113453599 CTGCAGGTGGCACCAATGAGAGG + Intergenic
1113911352 13:113842937-113842959 GGGCAGGTGGCATGAGTCTGGGG - Intronic
1119541330 14:75440091-75440113 GGGCAGATGCCACCAATTTGGGG - Intronic
1121434826 14:93912183-93912205 CTGCAGGTGGCAGCCATCAGAGG - Intergenic
1121449701 14:93999253-93999275 GTGCAGGTGGCTGCCATCTCAGG - Intergenic
1127832230 15:62761032-62761054 GTACAGGAGGCACCCATTTGTGG + Intronic
1128250903 15:66163761-66163783 GTGCACGGGGCATCAATCAGTGG + Intronic
1128376126 15:67077308-67077330 GTCCAGGTGGCACCATTATATGG + Intronic
1128905185 15:71461238-71461260 GTGCATGTGGCAGGGATCTGAGG - Intronic
1132143829 15:99415193-99415215 CTGCAGGCTGCACCAAGCTGCGG - Intergenic
1132605425 16:791845-791867 CTGCAGGTGGCACTGCTCTGTGG + Exonic
1135130334 16:19848609-19848631 GTACTGGTGGCACCAGTATGTGG - Intronic
1135848888 16:25944381-25944403 GTGCAGGTGGCAACATTCCCAGG - Intronic
1136045916 16:27614832-27614854 AAGCAGATGGCAACAATCTGGGG + Intronic
1137724448 16:50647594-50647616 GTGCAGGTGGGATAACTCTGAGG - Intergenic
1140252063 16:73302900-73302922 GAGCAGGTGGCATTAAACTGTGG + Intergenic
1140519315 16:75567691-75567713 GTGAAGGTGGATCCATTCTGGGG + Intronic
1141323007 16:83029658-83029680 ATGCAGGTAAAACCAATCTGTGG + Intronic
1141720414 16:85752367-85752389 GTGCAGGTGGCTCCCTGCTGAGG + Intergenic
1142905428 17:3038096-3038118 GGGCAGGTGGCACGTACCTGTGG + Intergenic
1148051328 17:44771467-44771489 GTGCAGGTGGCCACAATCCCTGG - Intronic
1151247997 17:72810529-72810551 GAGCAGGTGGAACCTATCTATGG + Intronic
1151423957 17:74017514-74017536 GTGGGGGTGGCTCAAATCTGAGG - Intergenic
1155708395 18:28845104-28845126 GTGTAGGTGGTACCAATCACAGG + Intergenic
1158043232 18:53123307-53123329 GTGCTGGTGGTCCCAAACTGGGG + Intronic
1163017839 19:14467636-14467658 GTGCAGGTGACACCACTCCCTGG + Exonic
1163371326 19:16902847-16902869 TTGTAGGTGACATCAATCTGGGG + Exonic
1165665284 19:37622432-37622454 GTGCAGGTGGCTGCCAGCTGTGG - Intronic
1166334228 19:42095771-42095793 ATGCAGGTGGGACCAGGCTGGGG - Exonic
1167094229 19:47365389-47365411 GGCCTGGTGGCACCCATCTGTGG - Intronic
1167165993 19:47800607-47800629 CCACAGGTGGCACCAGTCTGAGG - Intergenic
925740251 2:6999362-6999384 CTGCAGGTCGCCCCAAGCTGGGG + Intronic
926743055 2:16127998-16128020 GTGCAGGTTGCACAAAATTGTGG - Intergenic
931224211 2:60315694-60315716 GTGCAGGGGTCAGGAATCTGTGG + Intergenic
932325782 2:70860672-70860694 GTCCAGGTGGCACCGCTTTGTGG + Intergenic
937320963 2:120960478-120960500 GTGCAGGTGGCACTCAGCTAAGG - Intronic
937369483 2:121287371-121287393 GTGGAAGTGAAACCAATCTGTGG + Intergenic
939572307 2:143855017-143855039 GTGCGGGTGGGGCCAATCAGAGG - Intergenic
940038538 2:149334585-149334607 GTGTACGTGACAGCAATCTGGGG + Intronic
941476434 2:165956222-165956244 GAGCAGGGGTCCCCAATCTGAGG - Intergenic
945021244 2:205573641-205573663 ATGCAGGTGCCTCCAAACTGAGG + Intronic
945573654 2:211503350-211503372 GTGCTGGTGGGACCCATCTTGGG - Intronic
946335157 2:219031061-219031083 GTGCAGGAGGGGCCAGTCTGGGG + Intronic
946587672 2:221208490-221208512 CTGGAGATGGCACCAATCTATGG - Intergenic
946628842 2:221644645-221644667 ATCCAGGTCTCACCAATCTGAGG + Intergenic
947448456 2:230182952-230182974 TTGTAGATGGCACCAGTCTGGGG + Intronic
948873580 2:240815997-240816019 GTGGAGGGGGTGCCAATCTGAGG + Intronic
948977679 2:241473417-241473439 CTGCAGGGGGCACTACTCTGTGG + Intronic
1168853267 20:990893-990915 CTGCAGTTGGCACGCATCTGCGG - Intronic
1169036662 20:2458666-2458688 GTCCTGGTGGCACCAGTCTGAGG - Intergenic
1171086454 20:22242548-22242570 GTGCAGTGGCCACCCATCTGCGG - Intergenic
1171450068 20:25229351-25229373 GTGCAGGTCGCAGCCATCAGTGG + Intergenic
1175797441 20:61780791-61780813 GTGCAGGTGGCTTCCCTCTGAGG + Intronic
1178245814 21:30951044-30951066 GTGCAGGTAAAAACAATCTGGGG - Intergenic
1178246006 21:30953356-30953378 GAAGAGGTGGCACCCATCTGTGG - Intergenic
1178738069 21:35170751-35170773 GTGCAGGTGGCTTCAAACAGTGG + Intronic
1180246410 21:46550888-46550910 CGGGAGGTGGCACCATTCTGGGG - Intronic
1184461010 22:44638043-44638065 GGTCTGGTGGCACCCATCTGTGG + Intergenic
1185328025 22:50237071-50237093 CTGCATGTGCCACCCATCTGGGG - Intronic
949492502 3:4602924-4602946 GTGGTGGTGGTACCAATCTGTGG + Intronic
950595432 3:13976460-13976482 GTGCAGGTGGATCTGATCTGGGG - Intronic
953929095 3:46997072-46997094 GTGCAGGAGGCATGAATATGGGG + Intronic
955632097 3:60985653-60985675 CTGGGGGTGGAACCAATCTGTGG - Intronic
962289679 3:134123558-134123580 CTGCAGCTGCCACCCATCTGAGG - Intronic
962984481 3:140522076-140522098 CTGCAGGTTGCAAAAATCTGTGG + Intronic
965093525 3:164193004-164193026 TGGCAGCTGGCACCAACCTGTGG - Intergenic
966418782 3:179716923-179716945 GAGCATGAGGCAGCAATCTGCGG - Intronic
966537518 3:181051180-181051202 GTGAAGGTTGCAGAAATCTGTGG - Intergenic
967557251 3:190874885-190874907 GGCCTGGTGGCACCCATCTGTGG - Intronic
969472926 4:7400295-7400317 GTGCATGTGGCACCAACCCCAGG + Intronic
969554196 4:7894984-7895006 GGGCAGGTGGCACCAGGCTCTGG + Intronic
969573414 4:8023207-8023229 GTGCAGGTGGCACCAATCTGTGG - Intronic
969866658 4:10080753-10080775 GTGCAGGTGGCCCCACTGTCTGG + Intronic
971421377 4:26476832-26476854 GGGCAGGAGTCACCAAGCTGAGG + Intergenic
972490227 4:39580317-39580339 GTGTTGGTGGCACGCATCTGTGG - Intronic
976857071 4:89616788-89616810 GTTCAGGGGCCACCATTCTGAGG + Intergenic
977364009 4:96043454-96043476 GTGTAGGTGCCTCAAATCTGTGG - Intergenic
987190377 5:15471089-15471111 GTGTAGGTGGCACGCACCTGTGG + Intergenic
987243704 5:16027124-16027146 TTGGAGGTGCCACCTATCTGTGG - Intergenic
990824340 5:59880231-59880253 GAGTAGGTGGGACCAATCAGAGG + Intronic
992255825 5:74920058-74920080 GTGGTGGTGGCACGCATCTGTGG + Intergenic
997241822 5:132313311-132313333 GTGCTGGTAGCATCTATCTGTGG + Intronic
997452169 5:133992553-133992575 GTGCAGGTGGGACCCAGGTGGGG - Intronic
998389117 5:141775673-141775695 GTTCAGGTGGTACCGGTCTGTGG - Intergenic
998607082 5:143646605-143646627 GACCAGGTGGCAGCACTCTGTGG - Intergenic
1001811975 5:174635789-174635811 GTGCAGGTGGTCCAAAGCTGAGG + Intergenic
1001811994 5:174635897-174635919 GTGCAGGTGGTCCAAAGCTGAGG + Intergenic
1002055240 5:176594931-176594953 CTGCAGGTGGGACCAGCCTGTGG + Intronic
1002376611 5:178793539-178793561 GGGCAGTTAGCACCAACCTGTGG - Intergenic
1003905057 6:10691751-10691773 GTCCAGGTGTTACTAATCTGGGG - Intronic
1005981165 6:30837881-30837903 GTGCAGATGGCACAGTTCTGTGG - Intergenic
1006142342 6:31937494-31937516 GTGGAAGGGGCACCAATATGGGG + Intronic
1006304248 6:33209351-33209373 GTGAAGATGGCACAAATCTGTGG - Intronic
1006429012 6:33983787-33983809 GGGCAGGAGGAACCAAGCTGTGG + Intergenic
1011396564 6:86915919-86915941 GTGCAGGTGGCACTAATGAGTGG - Intergenic
1017182232 6:151564646-151564668 GTGCAGGTGGGTGCCATCTGTGG + Intronic
1017722576 6:157254098-157254120 GTGATGGTGGCACCTGTCTGTGG - Intergenic
1023572728 7:41589086-41589108 GTGCAGATGACAACAACCTGAGG - Intergenic
1023685774 7:42733546-42733568 GTGCAGGTCGCGCCACCCTGGGG + Intergenic
1024599350 7:50965912-50965934 CTGCATGTGGCACCCACCTGAGG + Intergenic
1033451397 7:141465230-141465252 GTGCAAGTGGCACAAGCCTGGGG - Intronic
1036599672 8:10248794-10248816 GTGCAAGTGGCACCAAGCAATGG - Intronic
1036697012 8:10981807-10981829 GTGGAGGTGCCACCATTTTGTGG + Intronic
1040468129 8:47714090-47714112 ATGGAGGTGGGACCAAGCTGAGG + Intronic
1040974758 8:53177592-53177614 GGGCAAGTGGCACCCTTCTGTGG + Intergenic
1042667588 8:71223249-71223271 GGGCAGATGGCACCAGTCAGAGG + Intronic
1043592239 8:81845121-81845143 GTGGTGGTGGCACCAATCTAAGG + Intergenic
1047538140 8:125738015-125738037 GTGGAGTTGTCACCAGTCTGGGG + Intergenic
1050545215 9:6703911-6703933 GTGCAGGTGTCACCAGCCTCTGG - Intergenic
1052975240 9:34405397-34405419 GCCCAGTTGGCACCTATCTGGGG - Intronic
1057040421 9:91843886-91843908 GAGCAGCTGGAACCAATGTGGGG - Intronic
1057359127 9:94357386-94357408 GGGCAGGTGCCACCACCCTGGGG + Intergenic
1057626996 9:96686758-96686780 CTGCAGGGGGCGCCAAGCTGCGG + Intergenic
1057648632 9:96900204-96900226 GGGCAGGTGCCACCACCCTGGGG - Intronic
1058896054 9:109401549-109401571 ACGCAGGTGGCTCCAATTTGAGG - Intronic
1061898963 9:133663217-133663239 GTGAGGAGGGCACCAATCTGAGG + Intergenic
1061957618 9:133971756-133971778 GTGCAGGTGGCCCCAGGCTGTGG - Intronic
1186457083 X:9718196-9718218 GTGAAGGTGGCATTCATCTGCGG + Exonic
1189107226 X:38249556-38249578 GGGCAGTTGTCACCAACCTGAGG - Intronic