ID: 969573417

View in Genome Browser
Species Human (GRCh38)
Location 4:8023220-8023242
Sequence AATCCCGTGCGGCGTGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969573417_969573429 30 Left 969573417 4:8023220-8023242 CCACCTGCACGCCGCACGGGATT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 969573429 4:8023273-8023295 TCCGCTCCAGGATCCCACCCAGG 0: 1
1: 1
2: 15
3: 118
4: 502
969573417_969573422 -10 Left 969573417 4:8023220-8023242 CCACCTGCACGCCGCACGGGATT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 969573422 4:8023233-8023255 GCACGGGATTCGGGTTTCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 48
969573417_969573427 18 Left 969573417 4:8023220-8023242 CCACCTGCACGCCGCACGGGATT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 969573427 4:8023261-8023283 ACCTGATGTTCTTCCGCTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 138
969573417_969573423 -9 Left 969573417 4:8023220-8023242 CCACCTGCACGCCGCACGGGATT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969573417 Original CRISPR AATCCCGTGCGGCGTGCAGG TGG (reversed) Intronic