ID: 969573423

View in Genome Browser
Species Human (GRCh38)
Location 4:8023234-8023256
Sequence CACGGGATTCGGGTTTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969573413_969573423 5 Left 969573413 4:8023206-8023228 CCCACAGATTGGTGCCACCTGCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573414_969573423 4 Left 969573414 4:8023207-8023229 CCACAGATTGGTGCCACCTGCAC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573409_969573423 25 Left 969573409 4:8023186-8023208 CCTCTCCCATCACTAGGGTGCCC 0: 1
1: 0
2: 0
3: 21
4: 190
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573411_969573423 19 Left 969573411 4:8023192-8023214 CCATCACTAGGGTGCCCACAGAT 0: 1
1: 0
2: 1
3: 11
4: 96
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573417_969573423 -9 Left 969573417 4:8023220-8023242 CCACCTGCACGCCGCACGGGATT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573410_969573423 20 Left 969573410 4:8023191-8023213 CCCATCACTAGGGTGCCCACAGA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573408_969573423 26 Left 969573408 4:8023185-8023207 CCCTCTCCCATCACTAGGGTGCC 0: 1
1: 0
2: 2
3: 15
4: 182
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573407_969573423 27 Left 969573407 4:8023184-8023206 CCCCTCTCCCATCACTAGGGTGC 0: 1
1: 0
2: 2
3: 12
4: 168
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969573423 Original CRISPR CACGGGATTCGGGTTTCCCC GGG Intronic
904834947 1:33329776-33329798 CACGGAAATGGGGTCTCCCCTGG - Intronic
907178812 1:52552738-52552760 AACGGGCTTCGGGTGTCCCAGGG - Intronic
1071162827 10:82770861-82770883 AATGGAATTCGGGTCTCCCCTGG + Intronic
1072717806 10:97763076-97763098 CTGGGGATTCCGGATTCCCCTGG + Intergenic
1075965090 10:126604264-126604286 CAGGTGATGCTGGTTTCCCCTGG - Intronic
1077130818 11:971556-971578 CACAGGACTGGGGTTTGCCCTGG + Intronic
1077412069 11:2408250-2408272 CACGGGACCCAGGTTTCTCCTGG + Intronic
1080034983 11:27700784-27700806 CGCGGGACGCGGGGTTCCCCGGG - Intronic
1084847277 11:71910565-71910587 CACGGCATTCGGGTGTGCCAAGG + Intronic
1096157369 12:49347959-49347981 CACGGAAGTCCGGCTTCCCCAGG - Exonic
1100391918 12:94150869-94150891 CAAGCGATACAGGTTTCCCCTGG + Intronic
1101943310 12:109116817-109116839 GACGGGAGTCGTTTTTCCCCGGG - Intronic
1104292750 12:127484467-127484489 CACGGCATTCGGGTGTGCCAAGG + Intergenic
1113872240 13:113566361-113566383 CAGGGAATTCGGGTTCCCTCTGG - Intergenic
1116334237 14:43636811-43636833 CACTGGATATGGGCTTCCCCTGG + Intergenic
1119669408 14:76507189-76507211 CATGGCATTGGGGTTTCACCTGG - Intergenic
1121676685 14:95759219-95759241 CACGGTAACCTGGTTTCCCCTGG - Intergenic
1123115556 14:105892644-105892666 CATGGGAATCCGGTATCCCCAGG - Intergenic
1125679707 15:41523113-41523135 CTAGGGACTCGGGTTTCCCTCGG + Intronic
1130651459 15:85764320-85764342 CACGGGATTGGGGTGGCCTCAGG + Intronic
1142478037 17:201253-201275 CAAGGGCTTCGGCCTTCCCCAGG - Intergenic
1144768172 17:17744227-17744249 CATGGGGTTCGGGTTCCCCTAGG + Intronic
1160823723 19:1069693-1069715 ACCGAGATTAGGGTTTCCCCAGG - Intronic
1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG + Exonic
928730564 2:34227016-34227038 CACTGGAGTCAGTTTTCCCCAGG - Intergenic
928749955 2:34459402-34459424 CACAGGAATGGGGTTTCCCAAGG + Intergenic
934718143 2:96554940-96554962 CACGGGTTTTGGGTTTCGGCGGG + Intergenic
936126004 2:109789692-109789714 CACTGAACTCAGGTTTCCCCTGG - Intergenic
936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG + Intergenic
940856229 2:158730619-158730641 CAGGGGTTTGGGGTTGCCCCTGG + Intergenic
948268574 2:236656764-236656786 CATGGGATTCGGGTGTCACTGGG - Intergenic
948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG + Intergenic
948717134 2:239872128-239872150 CATGGGATTGGGGGTTGCCCTGG + Intergenic
949046523 2:241874862-241874884 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
949046579 2:241875020-241875042 CCCTGGATTGGGGTTTCCCCTGG - Intergenic
949046826 2:241876342-241876364 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
949046846 2:241876396-241876418 ACCTGGATTGGGGTTTCCCCTGG - Intergenic
949046879 2:241876502-241876524 ACCTGGATTGGGGTTTCCCCTGG - Intergenic
949046929 2:241876660-241876682 CCCTGGATTGGGGTTTCTCCTGG - Intergenic
1171384213 20:24756773-24756795 CAAGGGAGACGGTTTTCCCCTGG + Intergenic
1172952545 20:38731161-38731183 CCAGGGTTTCGGGTTTCCCTTGG - Intergenic
1173810194 20:45950698-45950720 CACAGGATTTTGGTTTTCCCAGG - Intronic
1175394579 20:58650002-58650024 CACCGGCTTCGCGTCTCCCCGGG + Intergenic
1178485920 21:33020193-33020215 CCCGGGCTTCGGGCCTCCCCAGG - Intergenic
1179101516 21:38359077-38359099 CATGTGATTTGGGTTTCTCCAGG - Intergenic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
949211975 3:1513887-1513909 CAGGAGATTGGGGTTTCCCAGGG - Intergenic
950498400 3:13348199-13348221 CATGGGAGTCAAGTTTCCCCAGG - Intronic
951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG + Intergenic
957044567 3:75363831-75363853 CACGGCATTCGGGTGTGCCAAGG - Intergenic
968835946 4:2964155-2964177 CCCGGGATTCGGGGTTCTCTGGG - Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
971449600 4:26787678-26787700 CACGAGATTTGGCTTTTCCCTGG + Intergenic
977071680 4:92397921-92397943 CAAGTGATTCTAGTTTCCCCAGG - Intronic
991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG + Intergenic
994353333 5:98770101-98770123 CAGGGGTTTCGGGTCTGCCCGGG + Intronic
995260744 5:110101545-110101567 CAGGGGATTCTTGTTTCCCAGGG + Intergenic
1002304513 5:178275271-178275293 CACTGGATTAGGGTTTGCCCTGG + Intronic
1019664930 7:2247141-2247163 CACGGGCCTGGGGTTGCCCCAGG - Intronic
1021408189 7:20298559-20298581 CAGGGGATTCTTCTTTCCCCTGG + Intergenic
1033967111 7:146989373-146989395 CACTGGATACAGGTTGCCCCAGG + Intronic
1035018741 7:155788145-155788167 CAATGTATTCAGGTTTCCCCAGG + Intergenic
1035108847 7:156463811-156463833 CTCGGGATTCAGGTGTCACCTGG + Intergenic
1038122102 8:24628892-24628914 CACTTGATTCAGGTCTCCCCTGG - Intergenic
1039288943 8:36073159-36073181 TTCGGGATTGGTGTTTCCCCTGG - Intergenic
1061084874 9:128392988-128393010 GAGGGGAGTCGGGGTTCCCCAGG - Intergenic
1062273121 9:135718773-135718795 CTCGGGCTTCCTGTTTCCCCCGG + Intronic
1199729645 X:150619106-150619128 CACGAGATACGCGTTTCCCCTGG + Exonic