ID: 969573423

View in Genome Browser
Species Human (GRCh38)
Location 4:8023234-8023256
Sequence CACGGGATTCGGGTTTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969573410_969573423 20 Left 969573410 4:8023191-8023213 CCCATCACTAGGGTGCCCACAGA 0: 1
1: 0
2: 0
3: 7
4: 96
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573414_969573423 4 Left 969573414 4:8023207-8023229 CCACAGATTGGTGCCACCTGCAC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573407_969573423 27 Left 969573407 4:8023184-8023206 CCCCTCTCCCATCACTAGGGTGC No data
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573408_969573423 26 Left 969573408 4:8023185-8023207 CCCTCTCCCATCACTAGGGTGCC 0: 1
1: 0
2: 2
3: 15
4: 182
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573409_969573423 25 Left 969573409 4:8023186-8023208 CCTCTCCCATCACTAGGGTGCCC 0: 1
1: 0
2: 0
3: 21
4: 190
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573417_969573423 -9 Left 969573417 4:8023220-8023242 CCACCTGCACGCCGCACGGGATT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573413_969573423 5 Left 969573413 4:8023206-8023228 CCCACAGATTGGTGCCACCTGCA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64
969573411_969573423 19 Left 969573411 4:8023192-8023214 CCATCACTAGGGTGCCCACAGAT No data
Right 969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969573423 Original CRISPR CACGGGATTCGGGTTTCCCC GGG Intronic