ID: 969573439

View in Genome Browser
Species Human (GRCh38)
Location 4:8023322-8023344
Sequence TCGCAGCCGAGAGGAGCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 2, 3: 81, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969573439_969573444 13 Left 969573439 4:8023322-8023344 CCCAAGGCTCCTCTCGGCTGCGA 0: 1
1: 0
2: 2
3: 81
4: 335
Right 969573444 4:8023358-8023380 TTCCTTGTGTCTGAGGACTCTGG 0: 1
1: 0
2: 1
3: 30
4: 257
969573439_969573447 27 Left 969573439 4:8023322-8023344 CCCAAGGCTCCTCTCGGCTGCGA 0: 1
1: 0
2: 2
3: 81
4: 335
Right 969573447 4:8023372-8023394 GGACTCTGGCAGTTTTGAGGAGG No data
969573439_969573448 28 Left 969573439 4:8023322-8023344 CCCAAGGCTCCTCTCGGCTGCGA 0: 1
1: 0
2: 2
3: 81
4: 335
Right 969573448 4:8023373-8023395 GACTCTGGCAGTTTTGAGGAGGG 0: 1
1: 0
2: 3
3: 21
4: 190
969573439_969573446 24 Left 969573439 4:8023322-8023344 CCCAAGGCTCCTCTCGGCTGCGA 0: 1
1: 0
2: 2
3: 81
4: 335
Right 969573446 4:8023369-8023391 TGAGGACTCTGGCAGTTTTGAGG 0: 1
1: 2
2: 10
3: 152
4: 1296
969573439_969573443 6 Left 969573439 4:8023322-8023344 CCCAAGGCTCCTCTCGGCTGCGA 0: 1
1: 0
2: 2
3: 81
4: 335
Right 969573443 4:8023351-8023373 GCAGACGTTCCTTGTGTCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969573439 Original CRISPR TCGCAGCCGAGAGGAGCCTT GGG (reversed) Intronic
900178222 1:1299961-1299983 TGGCAGCCGAGGTGAGCCTTTGG - Exonic
900704407 1:4071041-4071063 TCACAGCCAAGAGGAGCCCAAGG - Intergenic
902384323 1:16067812-16067834 AAGCAGACGAGAGGAGCCTGAGG - Intronic
902421041 1:16280335-16280357 TCACAGCCAAAAGGAGCCTAAGG + Intronic
904577379 1:31513817-31513839 TCTCAGCAGAGAGGAGGCCTCGG + Intergenic
905498541 1:38417132-38417154 TCACAGCCAAGAGGAACCTAAGG - Intergenic
906149548 1:43579573-43579595 TCCCAGCAGAGAGGAACCTGGGG + Intronic
906321711 1:44821370-44821392 TGACAGCCGAGAGGTGTCTTTGG - Intronic
906570275 1:46832040-46832062 CCACAGCCAAGAGGAGCCTAAGG - Intergenic
907114861 1:51959615-51959637 TCCCAGCCCAGAAGAGCCTAAGG + Intronic
907283381 1:53365226-53365248 TCACAACCAAGAGGAGCCTAGGG + Intergenic
907731156 1:57067315-57067337 TCTGAGCTGAGAGCAGCCTTAGG + Intronic
908766970 1:67563011-67563033 TCACAGCCAAGAGAAGCCTAAGG + Intergenic
908954117 1:69600355-69600377 TCAGAGCCAAGAGGAGCCTATGG - Intronic
909799440 1:79787614-79787636 TCACAGCCAAGAGGAGCCTAAGG - Intergenic
910219077 1:84872038-84872060 TCACAGCCAAGAGGAGCCTAAGG - Intronic
910219181 1:84873089-84873111 TCACAGCCAAGAGGAGCCTAAGG + Intronic
910900765 1:92118243-92118265 TTACAGCCAAGAGGAGCCTAAGG - Intronic
911302858 1:96196915-96196937 TCACAGCTAAGAGGAGCCTAAGG + Intergenic
911834604 1:102600746-102600768 TCACAGCCAAGAGAAGCCTAAGG - Intergenic
912278245 1:108283812-108283834 TCATAGCCAAGAGGAGCCTAAGG + Intergenic
912289981 1:108410545-108410567 TCATAGCCAAGAGGAGCCTAAGG - Intronic
912774977 1:112501053-112501075 TCACAGCCAAGAGGCGCCTAAGG - Intronic
915589201 1:156861059-156861081 TCGCAGTCCCGAGGAGCCGTGGG - Exonic
917466514 1:175282295-175282317 TCACAGCCAAGAGGAACCTAAGG + Intergenic
919432193 1:197509300-197509322 TCACAGGCAAGAGGAGCCTAAGG + Intronic
919852572 1:201683105-201683127 TCACAGCCTAGAGGGGCCTAAGG - Intronic
921816640 1:219571482-219571504 TCACAGCCAAGAGAAGCCTATGG - Intergenic
922052895 1:222011158-222011180 TCCCACCCCAGATGAGCCTTCGG - Intergenic
922077106 1:222255459-222255481 TCACAGCCAAGAGGAGCCTAGGG + Intergenic
922235962 1:223722911-223722933 TCACAGCCCAGAGGAGCCGAAGG - Intronic
922573850 1:226649095-226649117 TCGCAGGCAAGAGGTGCCTCTGG - Intronic
922861353 1:228819019-228819041 TCTCAGCAGAGAGGAGGCCTTGG - Intergenic
923352505 1:233123014-233123036 TCACAGCCAAGAGGAGCCTAAGG + Intronic
923603520 1:235423580-235423602 GGGCAGCCGAGAGGAGGCTGAGG + Intronic
924431466 1:244000832-244000854 TCGCAACCCAGAGTAGCCTAAGG + Intergenic
924541940 1:244989356-244989378 TCACAGCCAAGAGGAGCCGAAGG - Intronic
1062865593 10:849939-849961 TTACAGCCAAGAGGAGCCTAAGG + Intronic
1062975135 10:1677486-1677508 TCCCAGATGAGAGGAGCCCTGGG + Intronic
1063018787 10:2105221-2105243 TCACAGCCAAGAGCAGCCTAAGG + Intergenic
1066452353 10:35542138-35542160 TCACAGCCAAGAGGAGACTAGGG - Intronic
1067355877 10:45525897-45525919 TCATAGCCAAGAGGAGCCTAAGG + Intronic
1067774354 10:49151712-49151734 TCACAACCAAGAGGAGCCTAAGG + Intergenic
1068185439 10:53579676-53579698 TCACAGCCGAAAGCAGCCTAAGG - Intergenic
1068350844 10:55843126-55843148 TCACAGCCAAGAGAAGCCTAGGG - Intergenic
1068563717 10:58547255-58547277 TCACAGCCAAGAGGAGCCAAGGG - Intronic
1068714100 10:60168494-60168516 TCACAGCCCAGAGGAACCTAAGG - Intronic
1069095578 10:64255474-64255496 TCACAGCCAAGAGGAACCTAAGG - Intergenic
1069530351 10:69213657-69213679 TCACAGCCAAGAGGAGCTTAAGG - Intergenic
1069817512 10:71207803-71207825 TCACAGCCAAGGGGAGCCTGAGG + Intergenic
1070839910 10:79477890-79477912 TCACAGCCAAGAGGAGGCTAAGG + Intergenic
1071382511 10:85082224-85082246 TCAGAGCCAAGAGGAGCCTGAGG + Intergenic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1072474165 10:95743107-95743129 TCACAGCCAAGAGGAGCCTAAGG - Intronic
1073708037 10:106009537-106009559 TCACAGCCCAGAGGACCCTATGG - Intergenic
1074569028 10:114607791-114607813 TCACAGCCAAGAGGAGCCTACGG + Intronic
1076084677 10:127616071-127616093 CCGCAGCCAAGAGGAGCCTGAGG + Intergenic
1076549110 10:131266751-131266773 TCTCAGCAGAGAGGAGGCCTTGG + Intronic
1077948592 11:6929479-6929501 TCACAGCCAAGAGAAGCCTAAGG - Intronic
1078571647 11:12463336-12463358 TCACAGCCAAGAGAAGCCTAAGG - Intronic
1078683583 11:13505060-13505082 TCACAGTCAAGAGGAGCCTAAGG + Intergenic
1078890306 11:15549701-15549723 TCACAGCCAAGAGGAGCCTAAGG - Intergenic
1079593624 11:22213321-22213343 TCCCAACCAAGAGGAGCCTGAGG - Intronic
1079652406 11:22946269-22946291 TCACAGCCAAGACGAGCCTAAGG - Intergenic
1080820129 11:35797759-35797781 TCAGAGCCGAGAGGAGCCTATGG + Intronic
1080989581 11:37514892-37514914 TCACAGCCAAGGGGAGCCTAAGG - Intergenic
1081597255 11:44467650-44467672 TCCCAGCAGAGAGGGGCCATGGG - Intergenic
1083096665 11:60257949-60257971 TCACAGCCTAGAGGGGCCTAAGG - Intergenic
1083836838 11:65275180-65275202 TTGCAGCCAGGAGGAGCCCTAGG + Intronic
1085346553 11:75771783-75771805 TCTCAGCCTAGATGAGCCCTTGG - Intronic
1085759422 11:79228982-79229004 TCATAGCCAAGAGGAGCCTGAGG - Intronic
1086413007 11:86560821-86560843 TCAAAGCCAAGAGGAGCCTAAGG - Intronic
1086612137 11:88770199-88770221 TTACAGCCAAGAGGAGCCTAAGG + Intronic
1086870023 11:92026791-92026813 TCACAGCCAAGAGGAGCTTAAGG + Intergenic
1087100347 11:94357752-94357774 TCACAGCTGAGAGGAGCTTAAGG + Intergenic
1087211022 11:95446662-95446684 TCTCAGCAGAGAGGAGACCTTGG + Intergenic
1087451831 11:98333116-98333138 TCACAGCCAAGAAGAGCCTAAGG - Intergenic
1088183419 11:107137352-107137374 TCACAGCCAAGAGGAGCCTAAGG + Intergenic
1088802528 11:113319320-113319342 TCGCAGCCTAGAGAAGCCTAAGG + Intronic
1088986152 11:114910217-114910239 TTGCAGCTGTGAGGTGCCTTGGG + Intergenic
1089370000 11:117948594-117948616 TCACAGCCAAGAGGAGCCTATGG + Intergenic
1089717477 11:120375817-120375839 TCACAGCCAAGAGGAGGCTAAGG - Intronic
1090052218 11:123389486-123389508 TGTCAGCCAAGAGGAGCCTAAGG + Intergenic
1091176551 11:133563587-133563609 TAGCAGCTGAGAAGAGGCTTAGG - Intergenic
1092354168 12:7780984-7781006 TCATAGCCGAGAGGAGCCAAAGG + Intergenic
1092699784 12:11215419-11215441 TCACAGCCAAGAGGAACCTAAGG + Intergenic
1093164128 12:15786393-15786415 TCACAGCCAAGAGGAGCCTAGGG + Intronic
1093393823 12:18655868-18655890 TCACAGCCAAGAGGAGCTTCAGG + Intergenic
1094241184 12:28226794-28226816 TCACAGCCAAGAGCAGCCTAAGG - Intronic
1096017262 12:48288243-48288265 CCACAGCCGAGAGGAGTCTAAGG - Intergenic
1097796186 12:63864718-63864740 TAGTAGCCAAGAGGAGCCTAAGG + Intronic
1098390250 12:69962084-69962106 TCACCGCCGAGAGGAGCTTAAGG + Intergenic
1098465587 12:70783268-70783290 TCTCAGCAGAGAGGAGGCTCTGG + Intronic
1098966045 12:76789883-76789905 TCACAGCCAAGAGTAGCCTAGGG + Intronic
1099382890 12:81976721-81976743 TCACAGCCAACAGGAGCCTAAGG - Intergenic
1100083893 12:90883690-90883712 TCATAGCCAAGAGGAGCCTAAGG + Intergenic
1100672784 12:96835045-96835067 TCTCAGCAGAGAGGAGGCTGTGG + Intronic
1101397690 12:104362996-104363018 CCGCAGCAGAGAGAAGCCTCAGG - Intergenic
1102541626 12:113623828-113623850 TCACAGCCAAGAGGAGCCTCAGG - Intergenic
1102708778 12:114906828-114906850 CCACAGCCAAGAGGAGCCTAAGG - Intergenic
1104080860 12:125429559-125429581 TCACAGCCAAGAGGAGCCTCAGG - Intronic
1104124789 12:125836000-125836022 TCACAGCCAAGAGGAGCCTAAGG - Intergenic
1105761915 13:23522898-23522920 TCACAGTCAAGAGGAGCCTCAGG + Intergenic
1105887896 13:24658090-24658112 TCACAGCCAAGAGGAGCCAAAGG + Intergenic
1106127986 13:26916402-26916424 TCACAGCCCAGAGGAGCCTAAGG - Intergenic
1106269869 13:28142069-28142091 TCACAGAAAAGAGGAGCCTTAGG - Intronic
1106361944 13:29039065-29039087 ACCCAGCCAGGAGGAGCCTTGGG + Intronic
1106377642 13:29204514-29204536 TCCCAGCCAGGAGGAGCCTTGGG + Intronic
1106730946 13:32540894-32540916 TCGCAGCCAAAAGGAGCCTAAGG - Intergenic
1106898303 13:34329088-34329110 TCACAGCCAAGAGGAGGCTGAGG - Intergenic
1107630703 13:42340161-42340183 TCTCAGCCAAGAGGAGCCTATGG - Intergenic
1107768838 13:43767806-43767828 TAGCAGCCGGCAGGAGCCTGAGG + Intronic
1108334419 13:49424443-49424465 TCACAGCCAAAAGGAGCCTAAGG + Intronic
1110429226 13:75404429-75404451 TCACAGCCAAGAGGAGCTTAGGG - Intronic
1111380584 13:87445067-87445089 TCGCAGCCAAGAAAAGCCTGTGG + Intergenic
1113970728 13:114186224-114186246 TCTCAGCAGAGAGGAGACCTTGG - Intergenic
1114467241 14:22931764-22931786 TCATAGCCAAGAGGAGCCTAAGG - Intergenic
1114973516 14:28064839-28064861 TCACAGTCAAGAGGAGCCTAAGG - Intergenic
1115503082 14:34066392-34066414 TCACAGCCAAAAGGAGCCTAAGG + Intronic
1115925461 14:38428548-38428570 TCACAGCCAAGAGGAGCCTGAGG - Intergenic
1116541492 14:46107462-46107484 TCTCAGCAGAGAGGAGACTGGGG + Intergenic
1116902602 14:50375995-50376017 TCACAGCCAAGAGGAGGCTGCGG + Intronic
1118014844 14:61649770-61649792 TCACAGCCAAGAGGAGCCTGAGG + Intronic
1118455500 14:65942422-65942444 TCACAGCCTAGAGGATCCTAAGG - Intergenic
1118882204 14:69838861-69838883 TCGCAGCCAAGAGGAAGCTAAGG - Intergenic
1118883286 14:69846712-69846734 TCACAGCCAAGAGAAGCCTATGG - Intergenic
1119623461 14:76150953-76150975 TCAGAGCCAAGAGGAGCCTAAGG - Intergenic
1120403067 14:84056596-84056618 TCACAGCCGAGAGAAGTCTAAGG + Intergenic
1120716052 14:87841804-87841826 TCACAGCCAAGAGGAACCTAAGG - Intronic
1121488212 14:94337391-94337413 TCACAGCCAAGAGAAGCCTAAGG - Intergenic
1121677211 14:95763250-95763272 TCACAGCCAAGAGGAGCCTAAGG + Intergenic
1122439488 14:101720195-101720217 TCACCGTCGAGAGGAGCCTAGGG + Intergenic
1122737593 14:103852241-103852263 TCACAGCCAAGAGGAGTCTAAGG - Intergenic
1122755767 14:103978559-103978581 CCACAGCCAAGAGGAGCCTAAGG - Intronic
1122849374 14:104519156-104519178 TCACAGCCAGGAGGAGCCTAAGG + Intronic
1122851061 14:104531396-104531418 TCACAGCCGAGAGGCACCTAAGG - Intronic
1124162943 15:27290698-27290720 TCACAACCAAGAGGAGCCTAAGG + Intronic
1125111177 15:36036422-36036444 TCACAGCCAAGAGGACCCTAAGG + Intergenic
1126267619 15:46773218-46773240 TTGCAGCCGAAAGGTGCCCTTGG - Intergenic
1127280840 15:57491005-57491027 TCACAGCCAAGAGGAGCCTGAGG + Intronic
1127280930 15:57491953-57491975 TCACAGCCAAGAGGAGCCTGAGG + Intronic
1127322283 15:57858371-57858393 CCCCAGAAGAGAGGAGCCTTTGG - Intergenic
1128361715 15:66966368-66966390 TCACAGCCAAGAGGAGCCTATGG - Intergenic
1128406504 15:67345696-67345718 TCACAGACCAGAGGAGCCTAAGG + Intronic
1128840302 15:70845299-70845321 TCACAGCCAAGAGGAGCCTCAGG - Intronic
1128851614 15:70963433-70963455 TCACAGCCAAGAGGAGCCTCAGG + Intronic
1131055272 15:89371234-89371256 GCGCTGCCGAGAGGAGGCTGCGG + Intergenic
1131391592 15:92053553-92053575 TCACAGCCAAGAGGAGCCAAAGG - Intronic
1131633684 15:94207125-94207147 TCGCAGAGCAGAGGAGCCTGGGG + Intergenic
1131928036 15:97407723-97407745 TCACAGCCAAAAGGAGCCTAAGG - Intergenic
1132706429 16:1245469-1245491 TCACAGCCAAGAGGAGCCGGAGG - Intergenic
1132775841 16:1593558-1593580 TCATAGCCCAGAGGAGCCTGAGG - Intronic
1134349530 16:13423836-13423858 TTGGAGCTGAGAGCAGCCTTTGG - Intergenic
1134373813 16:13651286-13651308 CCACAGCCAAGAGGAGCCTAAGG - Intergenic
1137528510 16:49260684-49260706 TTACAGCCAAGAGGAGCCTAAGG + Intergenic
1138628328 16:58271540-58271562 TCTCAGCCAAGAGGAGCTTAAGG - Intronic
1138880460 16:61007865-61007887 TCACCGCCTAGCGGAGCCTTAGG - Intergenic
1140029497 16:71323794-71323816 TCACAGCCAAGAGGAGCCTAAGG + Intergenic
1141152040 16:81570892-81570914 TCACAGCCCAGAGGAGCCTGCGG + Intronic
1141857911 16:86697195-86697217 TCACAGCCAAGAGGAGCCTGGGG - Intergenic
1142873921 17:2839617-2839639 TCACAGCCAAGAGGAGTCTAAGG - Intronic
1144667307 17:17110840-17110862 TTGCAGCCAAAAGGAGCCTCAGG + Intronic
1144872222 17:18378350-18378372 TCCCAGCCAAGTAGAGCCTTGGG - Intronic
1147349882 17:39834001-39834023 TCCCAACCAAGAGGAGCCTAAGG - Intronic
1147358251 17:39914372-39914394 TCACAGCCAAGAGGAGCCTAAGG + Intronic
1148167047 17:45490822-45490844 GCGCAGCCCGAAGGAGCCTTGGG + Intergenic
1148910057 17:50937353-50937375 TCACAGCCAAGAGGAGCCTCAGG - Intergenic
1148975331 17:51522697-51522719 TCACAGCCAAGAGGAGCCTAAGG - Intergenic
1149309028 17:55376313-55376335 TCCTAGCCAAGAGGAGCCTAAGG + Intergenic
1150398225 17:64837227-64837249 GCGCAGCCCGAAGGAGCCTTGGG + Intergenic
1151190749 17:72395990-72396012 TTGCATCCAAGTGGAGCCTTGGG + Intergenic
1151749047 17:76026672-76026694 TCCCAGCCAAGTAGAGCCTTGGG + Intronic
1151868540 17:76820893-76820915 ATGCTGCCGAGAGGGGCCTTGGG + Intergenic
1152001485 17:77648240-77648262 TCACAGCCAAGAGGAGTCTAAGG - Intergenic
1152340904 17:79724015-79724037 TCACAGCCAAGAGGAGTCTGAGG + Intergenic
1153821649 18:8837281-8837303 TCTCAGCAGAGAGGGGCCATGGG + Intergenic
1153930721 18:9876653-9876675 TCACAGCTGAGAGAAGCCTAAGG + Intergenic
1153950718 18:10055442-10055464 AGGCAGCCGCGAGGAGCCGTGGG - Intergenic
1154347518 18:13555132-13555154 TCACAGCCAAGAGGAGCCTAAGG + Intronic
1155082800 18:22427467-22427489 TCACAGCCAAGAGGGGCCTAAGG - Intergenic
1155715623 18:28940053-28940075 TTGGAGCCTAGAGGAGCCTAAGG + Intergenic
1156369486 18:36459925-36459947 TCACAGCCAAGAAGAGCCTAAGG - Intronic
1157356258 18:46937326-46937348 TCACAGCCTAGAGGAGACTAAGG + Intronic
1157945732 18:51978440-51978462 TCACAGCCAAGAGGAGGCTAAGG + Intergenic
1158444116 18:57503930-57503952 TCTCAGCCTAGAGGGGCCTAAGG - Intergenic
1158919820 18:62178962-62178984 TCACAGCCAAGAGAAGCCTAAGG - Intronic
1159501503 18:69277135-69277157 TCACAGCCAAGAGGAGCCTAAGG - Intergenic
1160039537 18:75333214-75333236 TCCCAGCCCAGAGGAGCTTCTGG + Intergenic
1160732261 19:646662-646684 GCGGAGCCGAGAGAAGCGTTGGG - Intergenic
1160837152 19:1130090-1130112 TCACAGCCCAGAGGGGCCTGAGG + Intronic
1161173161 19:2823533-2823555 TCTCAGCAGAGAGGAGGCCTAGG + Intronic
1161567658 19:5012536-5012558 TCCCAGCCCAGAGGAGCCTGAGG - Intronic
1161824117 19:6551142-6551164 TCTCAGCAGAGAGGAGGCCTTGG + Intergenic
1162043211 19:7982773-7982795 TCATAGTCGAGAGGAGCCTGAGG - Intronic
1162288492 19:9759899-9759921 TTGCAGCAGTGGGGAGCCTTTGG + Exonic
1163753644 19:19093559-19093581 TCTCAGCCCAGAGGAGTCTAAGG - Intronic
1165103522 19:33455035-33455057 TCACAGCCCAGAGGAGGCTAAGG + Intronic
1166355903 19:42227141-42227163 TCACAGCCCAGAGAAGCCTTAGG - Exonic
1166585303 19:43941353-43941375 TCACAACCAAGAGGAGCCTAGGG - Intergenic
1167179188 19:47889246-47889268 TCACAGCCAAGAGGAGCCCAAGG - Intergenic
1168456507 19:56514460-56514482 TCACAGCTAAGAGGAGTCTTAGG - Intronic
1168649439 19:58084449-58084471 TCGCATCCGAGGGGAGCCGCCGG - Intronic
925142943 2:1562459-1562481 TCGCAGACGAGAGGCTCCTGGGG + Intergenic
925541513 2:4972645-4972667 TCACAGTCGAGAGGAGCCTGAGG - Intergenic
927013616 2:18932524-18932546 TCACAGCCAAGAGGAGCCTAAGG - Intergenic
927121449 2:19967985-19968007 TCACACCCCAGAGGAGCCTAAGG - Intronic
929069609 2:38016272-38016294 TCACAGTGGAGAGGAGCCCTTGG + Intronic
931318542 2:61154365-61154387 TCACAGCCAAGAGGAGCCTAAGG + Intronic
931425612 2:62168454-62168476 TCACAGCCAAGAGGAGCCTAAGG + Intergenic
931709380 2:64975039-64975061 TCACAGCCAAGAGGAGCCTAAGG - Intergenic
933948035 2:87304620-87304642 TCACAACCAAGAGGAGCCTGAGG + Intergenic
933982909 2:87568117-87568139 TCACAGCCAAGAGAAGCCTAAGG + Intergenic
934763142 2:96867215-96867237 TGGCACCCGAGTGGAGCCTGTGG + Intronic
935518727 2:104078139-104078161 TCTCAGCAGAGAGGAGGCCTTGG + Intergenic
935846483 2:107171335-107171357 TCACAGCCAAGAGGAGCTTAAGG - Intergenic
936310931 2:111382677-111382699 TCACAGCCAAGAGAAGCCTAAGG - Intergenic
936332165 2:111556976-111556998 TCACAACCAAGAGGAGCCTGAGG - Intergenic
936382647 2:112000410-112000432 CCACAGCCAAGAGGAGCCTAAGG - Intronic
936479454 2:112871529-112871551 TGGAAGCTCAGAGGAGCCTTGGG + Intergenic
936916078 2:117640258-117640280 TAGCAGCCAAGAGGAGCAGTGGG + Intergenic
937685937 2:124697365-124697387 TCAGAGCCAAGAGGAGCCTAAGG - Intronic
937790501 2:125955909-125955931 CCACAGCCAAGAGGAGCCTAAGG - Intergenic
937951652 2:127392654-127392676 TCACAGCCAAGAGAAGCCTAAGG - Intergenic
938209822 2:129458251-129458273 TTGCAGCTGGCAGGAGCCTTTGG - Intergenic
940283302 2:152009282-152009304 TCACAGTCAAGAGGAGCCTAAGG + Intronic
940454093 2:153873571-153873593 TAGCAGAGGAGAGGAGCTTTGGG + Intronic
940771901 2:157848011-157848033 TCACAGCCAAGAGGAACCCTAGG + Intronic
941043644 2:160649247-160649269 TCTCAGCAGAGAGGAGACTCTGG - Intergenic
941064000 2:160880167-160880189 TCACAGCCCAGAGGTGCCTAAGG - Intergenic
941974217 2:171385719-171385741 TAGCAGCCAAGAGGACCCTTAGG - Intronic
942979164 2:182058190-182058212 TCATAGCCAAGAGGAGCCTAAGG - Intronic
942980184 2:182071231-182071253 TCACATCCCAGAGGAGCCTAAGG - Intronic
943431634 2:187810061-187810083 TCACAGCCAAGAGGAGCCTAAGG + Intergenic
944282874 2:197918304-197918326 TCACAGCCGAGAGGAGCCTAAGG + Intronic
945204959 2:207321539-207321561 TCACAGCCAAGGGGAGCCTAAGG + Intergenic
945262402 2:207855820-207855842 TCACACCCAAGAGGAGCCTAGGG + Intronic
945330096 2:208529667-208529689 TCTCAGCAGAGAGGAGGCTCTGG + Intronic
945372134 2:209032205-209032227 TCACAGTCAAGAGGAGCCTAGGG + Intergenic
945716425 2:213362990-213363012 TCTCAGTCCAGAGGAGGCTTAGG + Intronic
946002543 2:216494838-216494860 TCACAGCCAAGAGGAGCGTAAGG - Intergenic
946799148 2:223391663-223391685 TCACAGCCAAGAGGAGCCTAAGG - Intergenic
948585262 2:239015265-239015287 TGGCAACCGAGAGGTGCCTGGGG + Intergenic
1169418241 20:5436321-5436343 TCACATCCAAGAGGAGCCTAAGG - Intergenic
1170015455 20:11776282-11776304 TCACAGCCAAGAGGAGCCCGAGG + Intergenic
1174728259 20:52888258-52888280 TCACAGCCAGGAGGAGCCTATGG + Intergenic
1174940837 20:54925085-54925107 TCTCAGCCAAGAGGATCCTGGGG - Intergenic
1174981247 20:55397598-55397620 TCACAGTCAAGAGGAGCCTAAGG + Intergenic
1175019072 20:55825362-55825384 TCACAGCCTAACGGAGCCTTCGG + Intergenic
1175471748 20:59235030-59235052 CCGGGGCTGAGAGGAGCCTTAGG - Intronic
1175485356 20:59342262-59342284 TCGCAGCTGAGCAGAGCTTTGGG + Intergenic
1179501313 21:41810723-41810745 GCGCAGCCTGAAGGAGCCTTCGG - Intronic
1180018442 21:45103122-45103144 TCACAGCCAAGAGGGGCCTAGGG + Intronic
1180116562 21:45709836-45709858 TCACAGCCAAGAGGAGCCTGAGG - Intronic
1181828489 22:25539414-25539436 TCACAGCCAAGAGGAGCCTGGGG - Intergenic
1182254740 22:29030541-29030563 CTGCAGCCGACGGGAGCCTTTGG + Intronic
1182536897 22:31010648-31010670 TCACAGCCAAGGGGAGCCTAAGG + Intergenic
1182578497 22:31289969-31289991 ACGCAACCGAGAGGGGCCTTGGG - Intronic
1183024936 22:35058023-35058045 TCTCAGCAGAGAGGAGACCTTGG + Intergenic
1183993852 22:41618608-41618630 GGGCAGCTGAAAGGAGCCTTAGG - Intronic
1184312305 22:43654658-43654680 TCACAGCCAAGGGGAGCCTCAGG + Intronic
1184613638 22:45622704-45622726 TCGCAGCAGAGAGGAGGCCCTGG - Intergenic
1184969626 22:48006549-48006571 TCACAGACCAGAGGAGCCTCAGG - Intergenic
1185165645 22:49260770-49260792 TGGCAGCCAGGAGGACCCTTTGG + Intergenic
949739928 3:7220519-7220541 TCATAGCCAAGAGGAGCCTAAGG + Intronic
949833741 3:8245433-8245455 TGACAGCCAAGAGGAGCCTAAGG - Intergenic
949980949 3:9501378-9501400 TCCCAGCAGAGAGGAGGCCTGGG + Exonic
950128434 3:10525629-10525651 TCCCAGCCGAGAGGAACCTAAGG - Intronic
950933833 3:16818567-16818589 TCACAGCCTAGAGGAGTCTAGGG + Intronic
951337352 3:21440463-21440485 TCACAGTCTAGAGGAGCCTAAGG + Intronic
952280864 3:31922070-31922092 TCGCAGTCAAGAGGAGCCTAAGG + Intronic
952400891 3:32962221-32962243 TCACAGCCAAGGGGAGCCTAAGG + Intergenic
952703783 3:36355036-36355058 TCACAGCCAAGAGGAGCCTAGGG - Intergenic
955240749 3:57175998-57176020 TCACAGCCAAGGGGAGCCTAAGG - Intergenic
959404849 3:105948698-105948720 TCATAGCCAAGAGGAGCCTAAGG - Intergenic
960250978 3:115453100-115453122 TTGCAGCCAAGAGGAGCCTAAGG - Intergenic
961734810 3:128994704-128994726 TAGCAGACGAGCGGAGGCTTTGG - Intronic
962496779 3:135947853-135947875 TCACAGCCAAGAGGATCCTAAGG - Intergenic
962685218 3:137841169-137841191 TCACAGTCTAGAGGAGCCTAAGG + Intergenic
963073740 3:141327557-141327579 TCAAAGCCCAGAGGAGCCTAAGG + Intronic
963203414 3:142607756-142607778 TCACAGCCAAGGGGAGCCTAAGG - Intronic
963787478 3:149549508-149549530 TCACAGCCAAAAGGAGCCTAAGG + Intronic
963945223 3:151138562-151138584 TCACAGCCAAGAGAAGCCTAGGG - Intronic
967793018 3:193569349-193569371 TCACAGCCAAGATGAGCCTAAGG + Intronic
969573439 4:8023322-8023344 TCGCAGCCGAGAGGAGCCTTGGG - Intronic
970042107 4:11808603-11808625 GCACAGACGAGAGGAGGCTTAGG - Intergenic
972358248 4:38303063-38303085 TCTCAGCAGAGAGGAGGCTCTGG + Intergenic
972439044 4:39067180-39067202 TCACAGCCAAGAGGAGGCTAAGG - Intronic
973306789 4:48660926-48660948 TCACAGTCTAGAGGAGCCTAAGG + Intronic
975473985 4:74800956-74800978 TCACAGCCAAAAGGATCCTTAGG - Intergenic
976920063 4:90428861-90428883 TCACAGCCAAGAGGAGCCTAAGG + Intronic
980306236 4:131064753-131064775 TCTCAGCAGAGAGGAGACTCTGG + Intergenic
981268422 4:142815222-142815244 TCACAGCCAAGAGAAGCCTCAGG + Intronic
981353808 4:143764104-143764126 TCACAGCTAAGAGGAGCCTAAGG - Intergenic
981492904 4:145359648-145359670 TCACAGCCAAGAGAAGCCTAAGG + Intergenic
984929165 4:184831358-184831380 TCACAGCCAAGAGGAACCTAAGG - Intergenic
985194543 4:187414585-187414607 TCACAGCCAAGAGGAGCCCAAGG - Intergenic
985211491 4:187600131-187600153 TGACAGCCAAGAGGAGCCTGAGG + Intergenic
985649499 5:1100820-1100842 TCACAGCCAAGAGGAGCCCGAGG + Intronic
986085461 5:4440770-4440792 TCACAGCTGAGAGGAGCCTAAGG + Intergenic
986532399 5:8752111-8752133 TCACAGTCAAGAGGAGCCTGAGG + Intergenic
986605682 5:9520842-9520864 TCACAGCCAAGAGAAGCCTAAGG + Intronic
986730824 5:10633671-10633693 TCACAGCCAAGAGGAGCCTGAGG - Intronic
987049997 5:14141322-14141344 TCACAGCCAAGAGGAGCCTGAGG - Intergenic
987427855 5:17794034-17794056 TCACAGCTAAGAGGAGCCGTAGG + Intergenic
988011148 5:25487849-25487871 TCAGAGCCGAGAGGAGCCTAAGG - Intergenic
988328858 5:29808473-29808495 TCTCAGTCAAGAGGAGCCTAAGG - Intergenic
991584088 5:68185321-68185343 TCACAGCCAAGTGGAGCCTAGGG + Intergenic
992082477 5:73248105-73248127 TCACAGCCAAGAGGAGCCGAAGG - Intergenic
994916564 5:105988046-105988068 TCAAAGCCAAGAGGAGCCTAAGG + Intergenic
998436939 5:142118301-142118323 TCACAGCCAAGAAGAGCCTAAGG - Intronic
998792310 5:145778277-145778299 TCTCAGCAGAGAGGAGGCTCTGG - Intronic
999049873 5:148510851-148510873 TAACAGCCAAGAGGGGCCTTAGG + Intronic
1001407398 5:171485667-171485689 TGGCAGCCGAGGGGTGGCTTGGG + Intergenic
1001430953 5:171661896-171661918 TCACAGCCAAGAGGAACCTGAGG - Intergenic
1002210783 5:177597896-177597918 TCACAGCCAAAAGGAGCCTAAGG - Intergenic
1002795501 6:468055-468077 ACAGAGCTGAGAGGAGCCTTGGG + Intergenic
1002843595 6:926371-926393 TCACAGCCAAGAGGAGCCTGAGG + Intergenic
1003469786 6:6418567-6418589 TCACAGCCAAGAGGAACCTAAGG - Intergenic
1004357019 6:14938637-14938659 TCACAGCCAAGAAGAGCCTAAGG - Intergenic
1004745875 6:18508614-18508636 TCACAGCCCAGAGGAGTCTAAGG - Intergenic
1005877417 6:30022420-30022442 TCACAGCCAAGAGGAGCCTAAGG + Intergenic
1006225918 6:32535833-32535855 TCTCAGCAGAGAGGAGACCTTGG - Intergenic
1006882333 6:37351264-37351286 TCACAGCCAAGAGGAGCCTAAGG + Intergenic
1007117780 6:39356052-39356074 TCACAGCCAAGAGGAGCCTAGGG - Intronic
1007851900 6:44811170-44811192 TCATAGCCAAGAGGAGCCTAAGG - Intronic
1010064751 6:71669147-71669169 TCACAGCCAGGAGGAGCCTAAGG - Intergenic
1010200975 6:73281830-73281852 CCACAGCCAAGAGGAGCCTAAGG - Intronic
1010783562 6:79973068-79973090 TCATAGCCAAGAGGAGCCTAAGG + Intergenic
1013185741 6:107756492-107756514 TCCCAGCCCAGAGGAGCTTAAGG + Intronic
1013283648 6:108662118-108662140 TCACAGCCTAGAAGAGCCTAAGG - Intronic
1013402950 6:109816394-109816416 TCACTGCCCAGAGGAGCCTAAGG + Intronic
1014070344 6:117174552-117174574 TCTCAGCCAAGAGGAGCCTAAGG + Intergenic
1014148449 6:118025191-118025213 TCACAGCCAAGAGGGGCCTAAGG - Intronic
1015434759 6:133172786-133172808 TCTCAGCAGAGAGGAGACTCTGG - Intergenic
1015455609 6:133424032-133424054 TCTCAGCAGAGAGGAGGCTCTGG + Intronic
1017037092 6:150276489-150276511 TCTCAGCCCAGAGGAGGCTGAGG + Intergenic
1018461305 6:164001695-164001717 TCACAAGCGAGAGAAGCCTTTGG - Intergenic
1019443042 7:1056960-1056982 TCGCAGCCCACAGGAGGCTCTGG - Intronic
1021333757 7:19372465-19372487 TCACAGCCAAGTGGAGCCTAAGG - Intergenic
1021440617 7:20670114-20670136 TAACAGCCAAGAGGAGCCTAAGG + Intronic
1021874319 7:25034293-25034315 CCACAGCCAAGAGGAGCCTAAGG - Intergenic
1021887871 7:25157696-25157718 TCACAGCCAAGAGGAACCTAAGG + Intronic
1023663706 7:42497061-42497083 TCACAGCCAAGAGAAGCCTAAGG - Intergenic
1023663716 7:42497203-42497225 TCACAGCCAAGAGAAGCCTAAGG - Intergenic
1023934496 7:44729862-44729884 TCTCAGCTGAGAGGGGACTTGGG - Intergenic
1026144019 7:67730003-67730025 TGGCAGCCGGGAGGAGCCTAAGG + Intergenic
1027679437 7:81201419-81201441 TCATAGCCAAGAGGAGCCTACGG + Intergenic
1029856850 7:103526110-103526132 TGGCAGCCGAGAGGTGGCATGGG + Intronic
1030269432 7:107654558-107654580 TCACAGCCAAGTGGAGCCTAAGG + Intergenic
1030310200 7:108061171-108061193 TCGCAGCCAAGAGGAGCCTCAGG + Intronic
1030339781 7:108363891-108363913 TCACAGCCAAGAGGATCCTAGGG + Intronic
1031136949 7:117894916-117894938 TTGCAGTCGAGAAGAGACTTTGG - Intergenic
1032120961 7:129156057-129156079 TCACAGCCAAGAGGAACCTAAGG - Intronic
1033413388 7:141140656-141140678 TCACAGCCAAGAGGAGCCCAAGG - Intronic
1034481274 7:151321750-151321772 TCTCAGCAGAGAGGAGGCTCTGG - Intergenic
1034519071 7:151604785-151604807 TCGCAGCCAGGAGGAGCCCGAGG - Intronic
1034582548 7:152057928-152057950 TCACAGCCAAGAAGAGCCTAAGG - Intronic
1034727142 7:153347270-153347292 TCGCAGCTGACAGAAGCCTAAGG - Intergenic
1035434518 7:158849680-158849702 TCTCAGCGGAGAGGAGGCTCTGG + Intergenic
1036774463 8:11600675-11600697 TTACAGCCAAGAGGAGCCTCAGG - Intergenic
1037854913 8:22365044-22365066 TTGCAGGCGAGAGGTGACTTTGG + Intergenic
1037895309 8:22648378-22648400 TCACAGCCAAGCGGAGCCTCGGG - Intronic
1038033526 8:23665584-23665606 TCACAGCCAAGAGGAGCCTCAGG - Intergenic
1038436804 8:27541889-27541911 CCCCAGCCCAGAGGAGCGTTAGG + Intronic
1038756802 8:30349283-30349305 TCACAGCCAAGAGGAGCCTAAGG - Intergenic
1039006308 8:33041468-33041490 TCACAGCCAAGAGGAACCTAAGG - Intergenic
1039196733 8:35040495-35040517 TTGCAGCCAAGAGGAACCTAAGG + Intergenic
1039559094 8:38498289-38498311 TCACAGCCAAGAGGACCCTATGG + Intergenic
1039559221 8:38499298-38499320 TCACAGCCAAGAGGAGCCTGAGG - Intergenic
1039944172 8:42115924-42115946 TCGCAGCTGAGTCCAGCCTTTGG - Intergenic
1040459890 8:47637189-47637211 TGACAGCCAAGAGGAGCCTGAGG - Intronic
1040934659 8:52770013-52770035 TCACAGCCAGGAGGAGCCTAAGG - Intergenic
1041440691 8:57893201-57893223 TCACAGCCAAGAGGAGCCTAAGG - Intergenic
1043148333 8:76682459-76682481 GCGCCGCCGAGAGCAGCCCTCGG - Intronic
1043811073 8:84741467-84741489 TGGAAGCGGAGAGCAGCCTTTGG - Intronic
1045237858 8:100371737-100371759 TCACAGCCAAGAGGAGTCTAAGG - Intronic
1045416549 8:101973264-101973286 TCACAGCCAAGAGGAGCCTATGG - Intronic
1046058961 8:109113473-109113495 TCCCAGCCCAGAGGAACCTAAGG + Intronic
1047247820 8:123160145-123160167 TCACAGCCAAGAAGAGCCTAAGG - Intergenic
1047603729 8:126453301-126453323 TCACAGCCTAGAGGAGGCTAAGG - Intergenic
1048564084 8:135575950-135575972 TCACAGCCAAGAGCAGCCTAAGG - Intronic
1048640369 8:136351722-136351744 TAACAGCCCAGAGGAGCCTAAGG + Intergenic
1050409201 9:5343966-5343988 CCACAGCCAAGAGGAGCCTAAGG + Intergenic
1050778022 9:9292721-9292743 TCGCAGCCAAGAGGAACCTAAGG - Intronic
1051261142 9:15265940-15265962 TCACAGCCAAGAGGAGCCTAAGG + Intronic
1052011145 9:23410816-23410838 TCACAGCCAAAAGGAGCCTAAGG + Intergenic
1053074124 9:35118337-35118359 TCACAGCCAAGAGGAGCCAAAGG - Intergenic
1053328349 9:37177860-37177882 TCACAGCCAAGAGGAGCCTAGGG + Intronic
1053791391 9:41688661-41688683 AAGCAGCAGAGAGGAGGCTTTGG - Intergenic
1054153765 9:61626109-61626131 AAGCAGCAGAGAGGAGGCTTTGG + Intergenic
1054179740 9:61900354-61900376 AAGCAGCAGAGAGGAGGCTTTGG - Intergenic
1054473550 9:65557229-65557251 AAGCAGCAGAGAGGAGGCTTTGG + Intergenic
1054657801 9:67680466-67680488 AAGCAGCAGAGAGGAGGCTTTGG + Intergenic
1054857195 9:69913941-69913963 TCACAGCCTAGAGGAGCCTGAGG + Intergenic
1055431714 9:76250663-76250685 TCACAGCCGAAAGGAGCCTAAGG + Intronic
1056364074 9:85885403-85885425 TCACAGCCAAGAGGAACCTAAGG - Intergenic
1057931652 9:99198873-99198895 TCACAGCCAAGAGGAGGCTAAGG - Intergenic
1058527735 9:105877154-105877176 TCACAGCCAAGAGGAGCCTAAGG + Intergenic
1058534010 9:105936217-105936239 TCACAGCCAAGAGGAGCCTAAGG + Intergenic
1186398634 X:9235956-9235978 TCCCAGCCAAGAGGAGACTGAGG + Intergenic
1186424151 X:9450363-9450385 TCACAGCCCAGAGGAGCCCAAGG - Intergenic
1188504510 X:30867154-30867176 TCACAGCCAAGAGGAGTCTAAGG + Exonic
1188859844 X:35243932-35243954 TCTCAGCAGAGAGGAGGCCTTGG + Intergenic
1189138319 X:38573688-38573710 TCACAGCCAAGGGGAGCCTAAGG - Intronic
1189164646 X:38848864-38848886 TCACAGCCAAGAGGAACCTAAGG + Intergenic
1189776617 X:44475552-44475574 TAGAAGCCAAGAGGAGCCTCTGG + Intergenic
1190561061 X:51685574-51685596 TCCCAGCCAAGAGGAACCTAAGG - Intergenic
1190563230 X:51707747-51707769 TCCCAGCCAAGAGGAACCTAAGG + Intergenic
1192226923 X:69235522-69235544 TCACAGCCAAGAGGAGACTAAGG - Intergenic
1192607901 X:72538972-72538994 ACACAGCCAAGAGGAGCCTAAGG + Intronic
1192845088 X:74898427-74898449 TCACAGTCAAGAGGAGCCTAAGG + Intronic
1194589876 X:95786875-95786897 TCACAGCCAAGAGGAGCCCAAGG - Intergenic
1196262064 X:113594573-113594595 TCACAACCAAGAGGAGCCTAAGG - Intergenic
1197421300 X:126238638-126238660 TCTCAGCAGAGAGGAGGCCTTGG - Intergenic
1197631109 X:128859434-128859456 TCACAGCCAAGAGAAGCCTAAGG + Intergenic
1198857846 X:141036638-141036660 TCACAGCCAAGAGGAGCCTAAGG - Intergenic
1198904850 X:141550734-141550756 TCACAGCCAAGAGGAGCCTAAGG + Intergenic
1199584287 X:149397095-149397117 ACACAGCCAAGAGGAGCCTAAGG + Intergenic
1200099272 X:153681576-153681598 TCACAGCCAAGAGGAGCCTCAGG + Intronic