ID: 969576463

View in Genome Browser
Species Human (GRCh38)
Location 4:8038895-8038917
Sequence GCTCCCAGTCACTCACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969576461_969576463 1 Left 969576461 4:8038871-8038893 CCACTTAGCACTCAAGTCCTTTC 0: 1
1: 0
2: 0
3: 13
4: 148
Right 969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG 0: 1
1: 0
2: 0
3: 17
4: 235
969576460_969576463 6 Left 969576460 4:8038866-8038888 CCATGCCACTTAGCACTCAAGTC 0: 1
1: 0
2: 0
3: 10
4: 118
Right 969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG 0: 1
1: 0
2: 0
3: 17
4: 235
969576459_969576463 14 Left 969576459 4:8038858-8038880 CCACTTATCCATGCCACTTAGCA 0: 1
1: 0
2: 0
3: 9
4: 124
Right 969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG 0: 1
1: 0
2: 0
3: 17
4: 235
969576458_969576463 15 Left 969576458 4:8038857-8038879 CCCACTTATCCATGCCACTTAGC 0: 1
1: 0
2: 0
3: 8
4: 76
Right 969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG 0: 1
1: 0
2: 0
3: 17
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969576463 Original CRISPR GCTCCCAGTCACTCACAGCC TGG Intronic
902245313 1:15116986-15117008 GCTCCCCATCCCTGACAGCCAGG + Exonic
903765257 1:25729904-25729926 GGTCCCCGTGGCTCACAGCCAGG + Intronic
906419001 1:45647626-45647648 GCACCCAGTTCCTCAAAGCCAGG + Intronic
906688482 1:47777773-47777795 GCTCCCCGGGACTCAGAGCCTGG + Intronic
910140782 1:84025297-84025319 ACTCCCAGTCACTCATAGCAGGG - Intergenic
911042010 1:93598669-93598691 GCTCCCTGTCCCTCCCAGCTTGG + Intronic
911507283 1:98768588-98768610 GCTCTCAGCCAGTGACAGCCTGG - Intergenic
913236004 1:116784096-116784118 GCTCCCAACCAGTCACACCCAGG - Intergenic
913334653 1:117698134-117698156 GTTCCCAATCCCACACAGCCAGG - Intergenic
917968653 1:180193940-180193962 GGTGCCTGTCACTCACACCCAGG - Intronic
919802900 1:201364282-201364304 GCTAGGGGTCACTCACAGCCAGG + Exonic
922612250 1:226939528-226939550 GCCCGCAGTCGCTGACAGCCGGG - Exonic
922796271 1:228341282-228341304 GCTCCCTGTCCCTCAGCGCCGGG + Intronic
922998419 1:229985235-229985257 CCACCATGTCACTCACAGCCAGG + Intergenic
924589119 1:245386566-245386588 CCTCCCCCTCACTCACACCCTGG + Intronic
1064758734 10:18597091-18597113 GGTCCCAGTCAGAAACAGCCAGG - Intronic
1065550045 10:26860927-26860949 GCTCCGAGCACCTCACAGCCCGG + Exonic
1067177698 10:43961810-43961832 GCACCCAGCCACTCGCAGGCTGG - Intergenic
1067805018 10:49386339-49386361 GCCTCCTGTCAGTCACAGCCAGG - Intronic
1068690209 10:59906482-59906504 GCGCCCACTCATTCGCAGCCCGG - Exonic
1073069899 10:100786797-100786819 GCTGCAATTCCCTCACAGCCTGG - Intronic
1076048627 10:127314759-127314781 GCTTCCAGACACTGACAGACAGG - Intronic
1076648617 10:131971776-131971798 GCACCCACACACCCACAGCCAGG + Intronic
1076805876 10:132858494-132858516 GCTGCCAGCCACTCCCACCCTGG - Intronic
1076852205 10:133098757-133098779 GCGCCCCGGCACTCACCGCCTGG - Exonic
1077009414 11:373510-373532 CCCCACAGTCACTCACCGCCTGG - Exonic
1077226947 11:1442743-1442765 CCTCCCAGTACCCCACAGCCTGG + Intronic
1077435623 11:2537597-2537619 GCTCCCAGGCACCCTCTGCCAGG + Intronic
1079964476 11:26964420-26964442 GCTCCCAGAAACTCAGATCCTGG + Intergenic
1088834554 11:113566958-113566980 GCTTCCAGCCACTCCCAGCATGG + Intergenic
1089791029 11:120944059-120944081 ACTCCCTGTTACTCACAGGCTGG + Intronic
1090235005 11:125140522-125140544 CCTGCCAGTCTCCCACAGCCAGG + Intergenic
1090627574 11:128619719-128619741 TCACCCAGTCACTCAGACCCAGG - Intergenic
1091430615 12:430687-430709 GCTCACATTCACCTACAGCCTGG - Exonic
1091846833 12:3662717-3662739 GCTCCTGCTCACACACAGCCTGG - Intronic
1096182998 12:49560825-49560847 CCTCCCAGCCCCTCACAGCGTGG - Intronic
1097363237 12:58680802-58680824 GCTCCCAGCCACTCCCTGTCAGG + Intronic
1097392160 12:59028296-59028318 GCACCCACTCACACACAGCAAGG - Intergenic
1098640734 12:72835736-72835758 ACTTTCAGTCACACACAGCCTGG + Intergenic
1098984184 12:76992908-76992930 GGTCTCAGGCACTCACAGGCTGG + Intergenic
1100221411 12:92508247-92508269 GCTCTAAGTCACCCAGAGCCAGG + Intergenic
1102024650 12:109707387-109707409 TATCCCTGCCACTCACAGCCTGG + Intergenic
1102031381 12:109741894-109741916 GCACCCAGCCACTCCCTGCCTGG + Intronic
1102441620 12:112967992-112968014 GCTCCCAGGCATACACAGTCAGG - Exonic
1102811509 12:115828203-115828225 GCTCACAGCCACTCACAGTCCGG + Intergenic
1102811598 12:115828905-115828927 GCTCACAGCCACTCATAGTCCGG - Intergenic
1103997946 12:124842189-124842211 GCCCCGTGTCACTCCCAGCCAGG + Intronic
1104960689 12:132487376-132487398 GCTCCCGGAGACACACAGCCCGG + Intergenic
1105341679 13:19532141-19532163 CCTCCCAGCCACTCATAGACAGG + Intronic
1108527301 13:51296804-51296826 GCTTCCTGTCACTCACAATCAGG + Intergenic
1109808227 13:67471577-67471599 GCTCCCAGCCAATCCCAGCTAGG + Intergenic
1113914350 13:113861910-113861932 CCTCCCATCCTCTCACAGCCTGG - Intronic
1114485811 14:23061083-23061105 GCTCCCACTGACTGACAGCCAGG - Exonic
1117421119 14:55546588-55546610 GCTCCCAGCACCTCATAGCCTGG - Intergenic
1121106654 14:91284331-91284353 CCTCCCAGCCACTCAAAGTCTGG + Intronic
1122275134 14:100587233-100587255 GCTCGCAGGTACTCACCGCCCGG + Intronic
1122879753 14:104685479-104685501 GCCCCCAGTCACCTCCAGCCAGG - Intergenic
1124187729 15:27544600-27544622 GGTCACATTCACACACAGCCTGG + Intergenic
1124218000 15:27825477-27825499 TCTCCCCGCCACTCCCAGCCGGG - Intronic
1124354567 15:28985147-28985169 TCTCCCAGCCAGTCAGAGCCTGG - Intronic
1125558120 15:40603230-40603252 TCTCCCAGTCCCTCACCCCCTGG + Intronic
1125875179 15:43137899-43137921 GCTCCGAGTCATTCTCTGCCGGG + Intronic
1127433165 15:58932180-58932202 GCTACAAGTCACCCAAAGCCTGG + Intronic
1127501424 15:59557338-59557360 GCTCCCAGACCCTCCCAGACTGG + Intergenic
1128658269 15:69478467-69478489 GCTCCTAAGCACTCAAAGCCCGG - Intergenic
1128701298 15:69806402-69806424 TCTCCCAGACCCTAACAGCCAGG - Intergenic
1129514757 15:76150596-76150618 CCTCCCAGCCACAGACAGCCTGG + Intronic
1129683579 15:77671905-77671927 GCCAGCAGTCACTCAGAGCCAGG - Intronic
1131065989 15:89435485-89435507 GGCCCCAGCCACCCACAGCCTGG - Intergenic
1132516905 16:370242-370264 GCTCGCAGTCAGTCGCAGCCTGG + Intronic
1132748978 16:1448680-1448702 CCTCACACTCACTCACTGCCAGG - Exonic
1134684683 16:16150360-16150382 GCTCCCTGGCCCTCACAGCTGGG + Intronic
1135572165 16:23557641-23557663 GCCCCTAATCTCTCACAGCCCGG - Exonic
1140326355 16:74006474-74006496 GCTCCTAGTCTATCCCAGCCAGG + Intergenic
1144832384 17:18139013-18139035 GGCCCCAGACATTCACAGCCAGG + Intronic
1145737551 17:27243633-27243655 ACTCACAGCCACTCAGAGCCAGG + Intergenic
1145996717 17:29109064-29109086 GGTCCCACCCACCCACAGCCAGG - Intronic
1147754932 17:42761640-42761662 GCTCCTTGTCACTCACACCCAGG - Intronic
1147769292 17:42856590-42856612 GCTCCCCATCCCTCACACCCTGG - Exonic
1147772026 17:42874409-42874431 GCTCCCCATCCCTCACACCCTGG - Intergenic
1152279353 17:79376218-79376240 GGTCCCAGGGACTCCCAGCCTGG + Intronic
1152960293 18:75771-75793 GCTCCGCGGCACTCACAGCGGGG + Intergenic
1153527655 18:6013105-6013127 CCTTCCAGTCACTCACTGCAGGG + Intronic
1153959838 18:10131458-10131480 GCTCCCCTTCTCTCCCAGCCTGG + Intergenic
1155957003 18:31962674-31962696 TCTCCCACTCAGTCACAGCAGGG - Intergenic
1156281924 18:35647667-35647689 TCTCCCAGCCACCCACAGCCAGG - Intronic
1158856720 18:61550165-61550187 GCTCCCAGTCAGTTTGAGCCGGG + Exonic
1159869187 18:73741205-73741227 GGTCCCAGTCCCTTACAGGCAGG + Intergenic
1160549624 18:79685341-79685363 TTTCCCAGTCACTCACAGGGAGG + Intronic
1161042552 19:2117696-2117718 GCTCCAACTCAGACACAGCCAGG + Intronic
1161398634 19:4058181-4058203 GGTCTCTGTTACTCACAGCCAGG - Intronic
1162576536 19:11502555-11502577 ACTACAAGTCACACACAGCCTGG - Intronic
1162725696 19:12688824-12688846 TCTCCCAGTCACTCCCATGCAGG + Intronic
1162736806 19:12751597-12751619 CCTCCCAGTCGCTCACTGGCAGG - Intergenic
1165648672 19:37467377-37467399 GCTCCCAATCTCTCAGAGCTGGG - Exonic
1166779184 19:45331556-45331578 GCTCGCAGTCAATCAGAGGCTGG - Intergenic
1166867957 19:45852466-45852488 TCTGTCAGTCACTCACATCCAGG + Exonic
1166979131 19:46622342-46622364 TCGCCCAGTCACACAGAGCCAGG - Intronic
1167773506 19:51538680-51538702 GCTCCCAGCCAATCCCAGCCAGG + Intergenic
1168309889 19:55455102-55455124 CCTCCCTCCCACTCACAGCCAGG - Exonic
1168354496 19:55692824-55692846 TCTCCCACTCACTCCCACCCGGG - Intronic
925336161 2:3100755-3100777 GCTCTCAGGGGCTCACAGCCTGG + Intergenic
925534332 2:4900466-4900488 ATTCCATGTCACTCACAGCCAGG - Intergenic
927264049 2:21124338-21124360 TCTCACACTCACACACAGCCTGG - Intronic
927694325 2:25230058-25230080 TCTACCAGTCAATCACACCCAGG + Exonic
927843883 2:26461565-26461587 GCTTCCAGTCCATCAGAGCCAGG - Intronic
928262111 2:29777362-29777384 GCTGCCAGTGACTCACTGTCAGG - Intronic
929423722 2:41821442-41821464 TTTCCCAGTCAGTCACATCCTGG + Intergenic
930805468 2:55485088-55485110 AGTCCCAGCCACTCGCAGCCAGG - Intergenic
933428476 2:82144024-82144046 GGTCTCAGTCAGTCATAGCCTGG + Intergenic
933522406 2:83390303-83390325 GCTAGCAGTCACTCAAAGACAGG + Intergenic
934989995 2:98914283-98914305 GCTCCCAGCCCCCCACAGCAAGG + Intronic
935106271 2:100046779-100046801 ACTCCCACACACTCTCAGCCAGG + Intronic
935132834 2:100274260-100274282 TCTCTCAGTCACTCAGAGCAGGG - Exonic
936015395 2:108955013-108955035 TGTGCCAGTCACTCATAGCCTGG - Intronic
937076999 2:119114301-119114323 GCTCCCCGTCACCCACACCAGGG + Intergenic
937472741 2:122188047-122188069 GCTCCCACCCACTCTGAGCCAGG - Intergenic
937987176 2:127643102-127643124 GCCCCCACTCCCACACAGCCTGG + Intronic
940108778 2:150127567-150127589 GCTCTCAGGGACTCAGAGCCTGG + Intergenic
940293559 2:152099617-152099639 GCTGCGAGTCACACACATCCAGG + Intergenic
940516645 2:154691816-154691838 GCTCCCAGCCACTGACAACTCGG + Intergenic
940626328 2:156179898-156179920 GCACCCAGTCATTCACTGGCTGG + Intergenic
941443227 2:165565004-165565026 TTTCCCAGTCACTCACAGTGAGG - Intronic
944367789 2:198944611-198944633 GCTCCCATTTACTAACAGTCAGG - Intergenic
944949237 2:204728095-204728117 CCTCACTTTCACTCACAGCCGGG + Intronic
946186391 2:217983086-217983108 GGTCCCTGTCACTCACAGACTGG - Intronic
946186397 2:217983129-217983151 CATCCCTGTCACTCACAGACTGG - Intronic
946429124 2:219615239-219615261 GCTCCCTGACACGCACAGCAGGG - Exonic
947710065 2:232308372-232308394 CCTCCTTGACACTCACAGCCAGG + Intronic
948061480 2:235045783-235045805 CCTCCCAGAGAGTCACAGCCAGG + Intronic
948702270 2:239767760-239767782 GCTCCCAGCCAGTCACTCCCAGG - Intronic
948964854 2:241371148-241371170 GCTCTCAGTGACTTACTGCCAGG - Intronic
1169501776 20:6167415-6167437 GCTCCCAGTGAGTGACAGCATGG + Intergenic
1172078074 20:32314976-32314998 ACTCCCTCTCACTTACAGCCAGG + Intronic
1172822070 20:37745672-37745694 CCTCTCAGTCACTCTCAGTCAGG + Intronic
1173170824 20:40722220-40722242 GCTCCCTGTCACTCAGAGAACGG - Intergenic
1173410674 20:42806875-42806897 CCTCTCTGTCACTCACTGCCTGG + Intronic
1173750349 20:45470781-45470803 GCTTCCGGGCACGCACAGCCGGG + Intronic
1174589702 20:51635353-51635375 GCTCAGGGTCTCTCACAGCCTGG - Intronic
1175752591 20:61509391-61509413 GCTCACAGTCACCCACCTCCTGG - Intronic
1176010987 20:62895373-62895395 GCTCCCATTTGCTCACAGCAGGG - Intronic
1176045701 20:63091516-63091538 ACTCGGAGTCACTCACAGACCGG + Intergenic
1176548806 21:8212937-8212959 CCTCCCCGTCTCTCTCAGCCGGG - Intergenic
1176556701 21:8257146-8257168 CCTCCCCGTCTCTCTCAGCCGGG - Intergenic
1176567737 21:8395972-8395994 CCTCCCCGTCTCTCTCAGCCGGG - Intergenic
1176575640 21:8440188-8440210 CCTCCCCGTCTCTCTCAGCCGGG - Intergenic
1177881032 21:26695245-26695267 GCTCCCAGCCACGGACAGTCTGG + Intergenic
1179722868 21:43325256-43325278 GCTCCCTGCCATGCACAGCCAGG - Intergenic
1179780288 21:43695439-43695461 GCACCCTGTCACTCCCAGCCGGG - Exonic
1181013140 22:20053881-20053903 CATCCCAGTCACTCCAAGCCAGG - Intronic
1182418786 22:30238525-30238547 GCTCCCTGCCTCTCTCAGCCTGG - Intergenic
1182555698 22:31127293-31127315 GCTCCCAGTGCCTCACCTCCTGG + Intronic
1183045137 22:35213309-35213331 GCTCCTGGTCACAGACAGCCTGG - Intergenic
1183183571 22:36278171-36278193 GGTCCCGGCCACTCACAGCCCGG + Intergenic
1184350864 22:43943366-43943388 GCTCCCAGACAGTGACAGGCAGG + Intronic
1184410321 22:44322485-44322507 GCTCCCTGTCACCCACTGCATGG + Intergenic
1184567155 22:45298932-45298954 GCTCCCAGATACTCGCTGCCTGG + Intergenic
1184729421 22:46364668-46364690 CCTCACTGTCACTCTCAGCCAGG + Exonic
1184770212 22:46592531-46592553 GAACTCAGTCATTCACAGCCGGG + Intronic
1185375899 22:50482433-50482455 GCCCCCATCCACACACAGCCTGG - Intronic
1203253691 22_KI270733v1_random:129242-129264 CCTCCCCGTCTCTCTCAGCCGGG - Intergenic
1203261747 22_KI270733v1_random:174321-174343 CCTCCCCGTCTCTCTCAGCCGGG - Intergenic
950658524 3:14452312-14452334 GGTCCCAATGACTCACAGCCTGG + Intronic
951680849 3:25293077-25293099 TCTCCTAGTTATTCACAGCCTGG + Intronic
953232298 3:41075898-41075920 GGTCCCAGTCCCTCAGTGCCTGG + Intergenic
961654734 3:128435091-128435113 GCTGCCAGGGAGTCACAGCCAGG - Intergenic
961803303 3:129469360-129469382 GTCCCCAGTCAGCCACAGCCAGG - Exonic
962260141 3:133896688-133896710 GCTCTCACTCACTCACAACTTGG - Intergenic
966752137 3:183332323-183332345 GCTCTCAGTCACCCAAACCCTGG - Intronic
969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG + Intronic
972838862 4:42907883-42907905 ACTCCCAGTCACTCACATGGAGG - Intronic
974091295 4:57314226-57314248 GCATCCACTCACTCCCAGCCTGG - Intergenic
976335789 4:83884511-83884533 GTCCCCAGTCTCTCAAAGCCTGG - Intergenic
977971259 4:103217218-103217240 GCTCCCTGTCACTCTCAGGTGGG - Intergenic
978111106 4:104964590-104964612 GCTCCCAGCCAATGCCAGCCAGG + Intergenic
979218445 4:118193671-118193693 GTTCAAAGTCATTCACAGCCAGG + Intronic
980517237 4:133878548-133878570 GCTCCATGTCACTCTCAGCTGGG + Intergenic
988509821 5:31855441-31855463 CCTGCCCGTCACACACAGCCGGG - Intronic
992593226 5:78317755-78317777 GCTCCAAGTCACCCAGAACCAGG + Intergenic
993092350 5:83441920-83441942 GCCTCCAGTCACTCACCACCTGG + Intergenic
995362413 5:111312461-111312483 CTACCCAGTTACTCACAGCCAGG - Intronic
995870552 5:116739291-116739313 ACTTCCAGCCACTCAGAGCCTGG + Intergenic
998040526 5:138948446-138948468 GCCCCCAAACCCTCACAGCCTGG + Intronic
999897979 5:156055014-156055036 GCTCCCTGTCACACACAACAGGG - Intronic
1002092812 5:176814771-176814793 GCTCTGAGTCACTGCCAGCCAGG + Intronic
1002490393 5:179572159-179572181 GCTTCCAGTCAGTCGCAGCTCGG + Intronic
1003091142 6:3104614-3104636 GCTCGGAGTGACTTACAGCCAGG + Intronic
1003218532 6:4136085-4136107 GCTCGCAGTTACTCGGAGCCAGG - Intergenic
1003642852 6:7889937-7889959 GGTCCCAGTCACCGACAGCCAGG - Intronic
1006820068 6:36886022-36886044 GGCCCCAGTCACTCACATGCGGG - Exonic
1006931728 6:37692761-37692783 GGTCCCAGCAGCTCACAGCCAGG + Intronic
1008393708 6:50982274-50982296 TCTCCTAGTCACTCACTACCAGG - Intergenic
1010140285 6:72606343-72606365 GGGCCCAGTCATTTACAGCCTGG + Intergenic
1013696713 6:112710890-112710912 CCACCCAGTCACACACAGACAGG - Intergenic
1018798785 6:167207150-167207172 CCTTCCAGTCAGTGACAGCCAGG - Intergenic
1018945206 6:168343142-168343164 TCTCACAGCCACTCACAGCAAGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019571876 7:1716690-1716712 AGCCCCAGTGACTCACAGCCAGG + Intronic
1019994541 7:4715652-4715674 CCTGCCAGTCAGTCACAGCAGGG - Intronic
1020028218 7:4914601-4914623 GTGCCCAGTCAATCACAACCAGG + Intronic
1020103297 7:5407509-5407531 GCTCCCAGTTACTCCCCACCTGG + Intronic
1020105015 7:5418819-5418841 GCTCCCATTCACTCTCTGCTTGG - Intronic
1024118675 7:46216086-46216108 GCTCCCAGACATTCACAGGAAGG - Intergenic
1026487771 7:70836137-70836159 GCTCCCAGTCTCTCTCATCATGG + Intergenic
1027439799 7:78207453-78207475 CCTCCCATTCTCCCACAGCCTGG + Intronic
1029489931 7:100865631-100865653 GCTCCCACACACTGACAGCAAGG - Intronic
1031984874 7:128157544-128157566 GCTCCCATCCACTCCCACCCTGG - Intergenic
1032481080 7:132247744-132247766 GCTCCAAGGCCCTCACTGCCAGG + Intronic
1032932386 7:136688682-136688704 GCACCTGGTCACTCACAGCCTGG + Intergenic
1032932971 7:136695212-136695234 GCTCCCATGGACTCAGAGCCAGG + Intergenic
1034133913 7:148747510-148747532 GCTCTCAGCCCCTCCCAGCCAGG - Intronic
1034536148 7:151727287-151727309 GGTCCCAGTCCCCCACAGGCAGG - Intronic
1035402422 7:158576199-158576221 ACACCAAGTCACTCACAGCCAGG + Intronic
1036956321 8:13191750-13191772 GGCCACAGTCACACACAGCCTGG - Intronic
1037886741 8:22599588-22599610 GCCCCCAGACACTCCCAGCGGGG - Intronic
1038053358 8:23834106-23834128 GCTCCAAAGCAATCACAGCCTGG - Intergenic
1038515992 8:28188162-28188184 ACTCCCAGGCACAGACAGCCGGG + Intronic
1039934555 8:42030325-42030347 GCTCCAAGCCAATCCCAGCCAGG + Intronic
1041972824 8:63761962-63761984 GCTCCATGTCACTCCCAGGCGGG + Intergenic
1042793345 8:72633205-72633227 GCTCCCACCCACTGCCAGCCAGG - Intronic
1044560321 8:93606135-93606157 CCTCCAAGGCCCTCACAGCCAGG - Intergenic
1045271987 8:100670043-100670065 GCCCAAAGTCACACACAGCCAGG + Intergenic
1047563737 8:126017685-126017707 ACTCCCAGTTCCACACAGCCAGG - Intergenic
1048843193 8:138582664-138582686 GCTCCCTGCCACTCAGAGCGGGG - Intergenic
1049058051 8:140254453-140254475 GGTCACAGACACTCACAGCTGGG - Intronic
1049207292 8:141369487-141369509 GACCCCAGTCACAGACAGCCTGG - Intergenic
1049307182 8:141910316-141910338 GGGCCCAGGCACTCACAACCAGG + Intergenic
1051227799 9:14920950-14920972 TTTCCCAGTCAGTCACATCCTGG - Intergenic
1053752421 9:41269574-41269596 GCTCCCAGTCTCGCAGAACCAGG - Intergenic
1054257949 9:62833906-62833928 GCTCCCAGTCTCGCAGAACCAGG - Intergenic
1056737574 9:89223029-89223051 GCTCCCAGAAACTGGCAGCCAGG + Intergenic
1057688800 9:97263897-97263919 TCTCCCAGCCACTCATAGACAGG - Intergenic
1060790187 9:126480667-126480689 GCTCTCAGTCACTCAGACCCAGG - Intronic
1061068509 9:128294272-128294294 GCTCCCACCCACTCAGAGCCTGG - Intergenic
1061389921 9:130311790-130311812 GGTACCAGTCACTCCCCGCCTGG + Intronic
1061821174 9:133227905-133227927 GCTGGCAGACACTCACAGCATGG + Intergenic
1061828226 9:133274962-133274984 GGTCCCAGGCACCCACAGCGCGG + Intronic
1061834275 9:133318459-133318481 GCTGGCAGACACTCACAGCATGG - Intergenic
1061960157 9:133983761-133983783 AGTCCCTGTCACTAACAGCCAGG + Intronic
1062238082 9:135522171-135522193 GCTGGCAGACACTCACAGCATGG - Exonic
1062391675 9:136336373-136336395 ACCCCCAGTCACTCACTCCCTGG + Intronic
1062513651 9:136921472-136921494 GCCCCTCGTCACCCACAGCCTGG + Intronic
1062737807 9:138147943-138147965 GCTCCGCGGCACTCACAGCGGGG - Intergenic
1202800827 9_KI270719v1_random:174474-174496 GCTCCCAGTCTCGCAGAACCAGG + Intergenic
1203470091 Un_GL000220v1:112390-112412 CCTCCCCGTCTCTCTCAGCCGGG - Intergenic
1203477912 Un_GL000220v1:156362-156384 CCTCCCCGTCTCTCTCAGCCGGG - Intergenic
1185456035 X:311338-311360 GCACTCAGACACACACAGCCAGG - Intronic
1189182072 X:39014044-39014066 TATCCCAGACCCTCACAGCCAGG + Intergenic
1189500415 X:41551232-41551254 GCACCCAGGTACACACAGCCTGG - Intronic
1190337360 X:49270324-49270346 GCCCCCAGGCACCCACACCCCGG - Exonic
1190877793 X:54471770-54471792 GCTCACAGCCACCCCCAGCCTGG - Intronic
1191210700 X:57882293-57882315 GCTCTGAGTCAATCCCAGCCAGG - Intergenic
1194689354 X:96963643-96963665 GCTCCCAGCTAATCACAGCCAGG + Intronic