ID: 969579156

View in Genome Browser
Species Human (GRCh38)
Location 4:8053993-8054015
Sequence GCAATAATACAGATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969579156_969579160 19 Left 969579156 4:8053993-8054015 CCTTGTTCCATCTGTATTATTGC 0: 1
1: 0
2: 2
3: 12
4: 181
Right 969579160 4:8054035-8054057 CCCTCCCCACCTCCTAAGCCTGG 0: 1
1: 0
2: 2
3: 67
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969579156 Original CRISPR GCAATAATACAGATGGAACA AGG (reversed) Intronic
900320801 1:2082728-2082750 GCAAAAAAACAAATGGAACCAGG - Intronic
903537463 1:24076474-24076496 GAAATAAAACAGATGGAACCTGG - Intronic
905401440 1:37706536-37706558 GCAATAATAGAGATGTTAAAGGG + Intronic
907088874 1:51705754-51705776 ACAAAAATATATATGGAACAAGG - Intronic
907973323 1:59406591-59406613 GCAAGAATACACATGAAACAGGG + Intronic
908152884 1:61322434-61322456 GCAGTAAGACAGAAGGAACCTGG - Intronic
908896192 1:68902922-68902944 CCAGTAATAAAGTTGGAACAAGG - Intergenic
909431591 1:75593682-75593704 GCAACAATGCAGATGGAACTCGG + Intronic
910316340 1:85888197-85888219 GCAATAATCCAGATAAAAAATGG - Intronic
912171497 1:107106030-107106052 GAAAGAATACAAATGGAAAAAGG - Intergenic
912199682 1:107442532-107442554 GCAAAAATGCAGATGGTATAAGG + Intronic
912256591 1:108065681-108065703 GCAAGAAGACAGATGGATCTTGG - Intergenic
913664771 1:121037262-121037284 GCAGAAAGACAGAAGGAACAGGG - Intergenic
914161618 1:145140471-145140493 GCAGAAAGACAGAAGGAACAGGG + Intergenic
916651158 1:166835878-166835900 GCCAAAAGACAGAAGGAACACGG + Intergenic
918311583 1:183289153-183289175 GCAAGGACACAGATGGGACATGG + Intronic
919037261 1:192329718-192329740 GCAATAGTACAGATGAGAAAAGG + Intronic
919405728 1:197180630-197180652 GCTATAAAACAGATGGATCAAGG - Intronic
920526123 1:206667885-206667907 GCCATAATCCAGATGGAAGCTGG + Intronic
922400486 1:225249244-225249266 GAAATAAAAAAGATGGATCAAGG + Intronic
923847087 1:237746607-237746629 CCTATATTACAGATGAAACAGGG - Intronic
1063147001 10:3304576-3304598 ACAATAATAAAAATTGAACATGG - Intergenic
1063612916 10:7578138-7578160 GCAATAAAACAGAAGGAGCTTGG + Intronic
1066252483 10:33648124-33648146 GGAATAATAGAGGAGGAACAGGG - Intergenic
1067467518 10:46511901-46511923 GATATAATACAGATGAAACTGGG + Intergenic
1067619668 10:47872704-47872726 GATATAATACAGATGAAACTGGG - Intergenic
1068642035 10:59420046-59420068 GCAATAACATGGATGGAACTGGG + Intergenic
1071460710 10:85891928-85891950 GAAATAATGCAGATGGTAGATGG + Intronic
1073564023 10:104520041-104520063 GCAATAACATGGATGGAACTGGG + Intergenic
1077988525 11:7380137-7380159 GCAACAACACAGATGGAACTGGG + Intronic
1078971892 11:16423539-16423561 GCAATAATACATAAAGAAAAAGG + Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079357649 11:19743348-19743370 GCAACAAGACAGATGGCAGAAGG + Intronic
1080606074 11:33865986-33866008 GGAATTTTACAGATGGAAGAAGG - Intronic
1083916939 11:65752673-65752695 GCAATAAAATGGATGGAACTGGG - Intergenic
1085293410 11:75416436-75416458 GAAATAATCAAGATGGAAAATGG - Intronic
1087122632 11:94590767-94590789 GCATTAATGCAGTGGGAACAGGG - Intronic
1088553331 11:111036782-111036804 GCAAGAGTACACATGGCACATGG - Intergenic
1088743897 11:112788386-112788408 GCCACAAACCAGATGGAACAGGG - Intergenic
1097036293 12:56126650-56126672 GCAGAACTACAGAAGGAACATGG - Exonic
1098406305 12:70130264-70130286 GCAATTATACACATGGTATATGG - Intergenic
1098442492 12:70533395-70533417 GCACTAATAAATATGGAGCAGGG - Intronic
1098713843 12:73802983-73803005 GTAACAACACAGATGGAACTTGG - Intergenic
1099085041 12:78235365-78235387 GCAATAATCCAGAAGAAAGATGG + Intergenic
1099170620 12:79359563-79359585 GAAATGATAGAGAGGGAACAGGG + Intronic
1100591060 12:96030027-96030049 GCAAGAAGCCAGATGGAAGAAGG - Intronic
1100657793 12:96666144-96666166 GCAAAAACAAAGATGGAAAAAGG + Intronic
1100875291 12:98955531-98955553 GCAATAATACAGACAGGAGATGG + Intronic
1100995890 12:100300793-100300815 GCAACAACATAGATGGAACTGGG - Intronic
1104566746 12:129892030-129892052 GCAAGAAAACAGACAGAACAAGG + Intronic
1106293400 13:28387657-28387679 GGAATAATTGAAATGGAACAGGG - Intronic
1107328604 13:39272503-39272525 TTAAAAATCCAGATGGAACATGG + Intergenic
1109154947 13:58897717-58897739 GGAAAAATAAAAATGGAACATGG + Intergenic
1109652466 13:65347527-65347549 ATAATTATAGAGATGGAACATGG - Intergenic
1110870644 13:80449047-80449069 GCAACATTAGAGATGGAAAATGG - Intergenic
1115051265 14:29066491-29066513 GCAGTAATATGGATGGAACTGGG - Intergenic
1115147764 14:30245532-30245554 ACAATAATACCTATGGAAGAGGG - Intergenic
1115751271 14:36492971-36492993 GCAATAAAACAGAGGAAGCAGGG - Intronic
1117670422 14:58100532-58100554 GTAATTATAAAGATGGACCAGGG + Intronic
1118430153 14:65710244-65710266 TAAATAATACATATGGTACATGG + Intronic
1118450723 14:65899162-65899184 GCAATTATGCAGTTGGAAAAGGG + Intergenic
1120613387 14:86671158-86671180 GCAACAACATAGATGGAACTGGG - Intergenic
1123146208 14:106132981-106133003 GAAATAATAGAGATGACACATGG + Intergenic
1126058734 15:44757856-44757878 GCAATAATAATTATGGACCATGG + Intronic
1131666210 15:94573406-94573428 GCAGTAATACAGGAGGAAGAGGG - Intergenic
1132027951 15:98418966-98418988 GCAAAAATGCAGATAGTACAAGG - Intergenic
1133398486 16:5466985-5467007 GCCATAAGACAGAAGGAAGATGG - Intergenic
1134410824 16:14001902-14001924 GTAATAATTGAGTTGGAACAAGG - Intergenic
1135161803 16:20102906-20102928 GCAATGATACTGATGGAGAAGGG - Intergenic
1136692851 16:32048474-32048496 GAAATAATAGAGATGACACATGG - Intergenic
1136793346 16:32991699-32991721 GAAATAATAGAGATGACACATGG - Intergenic
1136876507 16:33862357-33862379 GAAATAATAGAGATGACACATGG + Intergenic
1154279084 18:12985208-12985230 GACATAATACAAATGGAAAAGGG - Intronic
1155869136 18:31004008-31004030 GTAATAATACAAAAGGAACTTGG + Intronic
1158191871 18:54839008-54839030 GTAATAATAAATATGGAAAAAGG + Intronic
1159985951 18:74841116-74841138 GCAATAATCCAGATAGTAAAGGG - Intronic
925674863 2:6351381-6351403 GCAATTAAACAGATGGTACCGGG - Intergenic
927583335 2:24275347-24275369 AAAATAATACAGCTGGAACTGGG - Intronic
929657132 2:43745011-43745033 GCAATAATATATATAGAACTAGG + Intronic
930363831 2:50413875-50413897 GCAACAACACAGATGGAACTGGG + Intronic
930848109 2:55927171-55927193 GCAATAATACAGTTGGAAAATGG - Intergenic
931575032 2:63709896-63709918 GCAATGATTCAGAGGGCACATGG + Intronic
935244809 2:101208979-101209001 GCAGCAATATAGATGGAACTGGG - Intronic
938583006 2:132664470-132664492 GCCATAATGTAGATGCAACATGG + Intronic
938691652 2:133796223-133796245 GCAATAATACAGGTGAACCTTGG - Intergenic
939562122 2:143744448-143744470 GCAAGAATTCAGATTCAACAAGG + Intronic
939753945 2:146085889-146085911 GCAATAATACAAAATGAAAAGGG - Intergenic
941087208 2:161131736-161131758 GCAATCATACACATGTAATATGG + Intergenic
942022420 2:171880124-171880146 GCTGTAATACAGATGAAGCAAGG + Intronic
942367840 2:175247334-175247356 GCAAGAGCAGAGATGGAACATGG + Intergenic
944214334 2:197239023-197239045 GCAGCAAGACAGATGGAACCTGG - Intronic
944298108 2:198090962-198090984 GTAATAATACAGATGAGAAAAGG - Intronic
1170412888 20:16109385-16109407 GGAAGAATACATATTGAACAAGG - Intergenic
1175395197 20:58652684-58652706 GCAATTATTCACAGGGAACAAGG - Intronic
1179638640 21:42732035-42732057 GAAGAAAGACAGATGGAACACGG - Intronic
1181551953 22:23644579-23644601 GCAATAATAAAAATGGAGCTGGG - Intergenic
1182198756 22:28547241-28547263 GCACACATACACATGGAACATGG + Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
951543121 3:23801759-23801781 GAAATAATACAGTTGAAAGAGGG - Intergenic
952388064 3:32857163-32857185 GAAGTAAAACAGAGGGAACAGGG - Intronic
952752589 3:36837309-36837331 CCCATAATAAACATGGAACAGGG + Intronic
954010296 3:47630486-47630508 GCAATAATCCAGCTGGCATAGGG + Intronic
955249404 3:57263555-57263577 GCAATAAGATATATGGAACATGG - Intronic
955778222 3:62456239-62456261 ACTATAATACAGATGGTTCATGG - Intronic
955858541 3:63300816-63300838 GAAATAATAGAGAGGGAAGAAGG - Intronic
956143295 3:66167163-66167185 GGACTAATACAGATGGTAAAGGG + Intronic
956156147 3:66299575-66299597 GCAATAATAAATATGGACTACGG - Intronic
958269003 3:91475267-91475289 GCAAGAATACACAGTGAACAAGG - Intergenic
958674430 3:97249771-97249793 GCATTAATAGAGATTGAAGATGG + Intronic
964162169 3:153658677-153658699 TCAATAATTCAGAGGGAAGAGGG + Intergenic
964462117 3:156944713-156944735 GCAACAACACAGATGAAACTGGG - Intronic
964510495 3:157445155-157445177 GCAACAATACAGAAGAAGCATGG + Intronic
967311708 3:188112311-188112333 ACAATAAGAAAGAAGGAACATGG + Intergenic
967727622 3:192876646-192876668 GCAAGAATTGAGAGGGAACAGGG - Intronic
969579156 4:8053993-8054015 GCAATAATACAGATGGAACAAGG - Intronic
970705548 4:18797319-18797341 GGAATAAAACAGAAGGACCATGG + Intergenic
971645489 4:29195515-29195537 GCAACAACACAGATGAAACTGGG - Intergenic
972985597 4:44760673-44760695 GCAGTGAAATAGATGGAACAGGG + Intergenic
973230411 4:47834627-47834649 ACAATAATAAAGATGGCAGAAGG + Intronic
974015434 4:56644658-56644680 GCATAAATACACATGCAACAGGG - Intergenic
976032365 4:80771663-80771685 GCAATAACATAGAAGGAGCATGG - Intronic
978982244 4:114960975-114960997 GCAATAATAAAGAAGGAAGGAGG + Intronic
983880926 4:172931656-172931678 GTAATAAGTCAGATGGAAAAAGG + Intronic
984498726 4:180531917-180531939 GTAAAAATACAGATGGAATTTGG - Intergenic
984930480 4:184842777-184842799 GAAAAAAAACAGATGGATCATGG + Intergenic
986915485 5:12614290-12614312 GCAAAAATAAAAATGCAACATGG + Intergenic
988441746 5:31241623-31241645 GCTGTAAGACAGATGGAGCAGGG - Intronic
990174704 5:53094155-53094177 GAAATATTAAAGATGGATCAGGG - Exonic
990764575 5:59168092-59168114 ACAAAAATACAGAAGGAAGACGG + Intronic
991416295 5:66396482-66396504 AGAATAATACAGATGTGACAGGG + Intergenic
992006312 5:72481500-72481522 GAAATGATAGAGATGTAACAAGG - Intronic
992126429 5:73646882-73646904 GCAAGAAAATAGAAGGAACATGG - Intronic
995305064 5:110636105-110636127 GCAGTAATATGGATGGAACTGGG + Intronic
997023869 5:130034912-130034934 GAAATATTAAAGAAGGAACAGGG + Intronic
997683370 5:135771651-135771673 GCAATATTACAGGAGGAAGAGGG + Intergenic
999058537 5:148608536-148608558 GATACAATATAGATGGAACAGGG + Intronic
1003711323 6:8594023-8594045 GCAGCAACACAGATGGAACTGGG + Intergenic
1007089178 6:39171530-39171552 GCAATAAGGCAGAAGGCACATGG - Intergenic
1007593174 6:43035759-43035781 GCTATAATACAGAGGGCAGAGGG - Intergenic
1008488721 6:52063396-52063418 GCAATAATACACTAGGACCAAGG + Intronic
1008804294 6:55408950-55408972 TCAATAATAGAGAAAGAACATGG + Intergenic
1008986230 6:57546469-57546491 GCAAGAATACACAGTGAACAAGG + Intronic
1009174187 6:60439024-60439046 GCAAGAATACACAGTGAACAAGG + Intergenic
1009435193 6:63609692-63609714 GCAATAACATGGATGGAACTGGG + Intergenic
1010009189 6:71030465-71030487 GCAAGAACTCAGATGAAACATGG - Intergenic
1011917539 6:92526756-92526778 GCAATAATTCAGCTGGCTCAGGG - Intergenic
1011993652 6:93556731-93556753 GCAATAAGAGAGAAGCAACAAGG + Intergenic
1012512570 6:100020598-100020620 GCAGCAATATAGATGGAACTGGG + Intergenic
1012882612 6:104808835-104808857 AGAATAATAGATATGGAACATGG - Intronic
1013638807 6:112053677-112053699 GAAAAAATACAGATGGAGCAGGG - Intergenic
1013729180 6:113143058-113143080 GCAATACTACAGGTAGAACAGGG + Intergenic
1014218907 6:118780456-118780478 GCAACAAGACAGAAGGAACCTGG + Intergenic
1014594358 6:123314690-123314712 GCAGTGACACAGATGGAACAAGG + Intronic
1015748049 6:136531808-136531830 GCAATAGTCCAGATGAAAGATGG + Intronic
1016071518 6:139744847-139744869 GAAATATTACAGTTGGAAGAGGG - Intergenic
1017056554 6:150441867-150441889 GAAATATTACAGATGGAACAGGG + Intergenic
1017661808 6:156682229-156682251 CCACTAATACAGATGAAACTTGG + Intergenic
1017790027 6:157789932-157789954 GCAACAAGACAGAAGGAACCTGG - Intronic
1020632422 7:10655379-10655401 ACAAAAATACAGATCAAACATGG + Intergenic
1022355197 7:29608270-29608292 GCAATAATTCAGGTGGAGCCTGG - Intergenic
1022740558 7:33116355-33116377 GCAACAACATAGATGGAACTGGG - Intergenic
1023412139 7:39898711-39898733 TGAAAAATACAGATGTAACAAGG + Intergenic
1023507311 7:40913492-40913514 GCAAAAATGCAGTTGGAATATGG - Intergenic
1027545050 7:79517125-79517147 GAAATAATACAGATGGTCTAAGG - Intergenic
1032337737 7:131042146-131042168 GTAAAAATACAGAGGGAAGAAGG + Intergenic
1033849593 7:145479410-145479432 GCATAAATACAGAGTGAACAGGG - Intergenic
1035038790 7:155912640-155912662 ACAAAAACACAGATGAAACAAGG + Intergenic
1035526955 8:321459-321481 GAAATTAAACAGAGGGAACAAGG - Intergenic
1038703523 8:29873257-29873279 GGACTAATACAGAGGGAATATGG + Intergenic
1039299035 8:36189438-36189460 GTAAGAATACAGGTGGAATATGG - Intergenic
1041379767 8:57242532-57242554 TAAATAATACAGTTGGATCATGG - Intergenic
1042672114 8:71275741-71275763 GCAATAATACAGATTCAAGGAGG + Intronic
1046690573 8:117280021-117280043 GAAATAATTGAGAAGGAACAAGG - Intergenic
1048458502 8:134600595-134600617 GCAATAATACAGATGTTCCCGGG + Exonic
1048705921 8:137153932-137153954 GCAACAACACAGATGGAACTGGG - Intergenic
1051641559 9:19229494-19229516 GCAAAAATACAGATTAAATAAGG + Intergenic
1053010172 9:34628392-34628414 GTGAAAATAGAGATGGAACAGGG + Intergenic
1055013796 9:71594524-71594546 GCTATAATACAGCTGGAATTTGG - Intergenic
1056333480 9:85541440-85541462 GCAATCATACAGATGACATAAGG + Intergenic
1060383388 9:123198744-123198766 ACAAAAATCAAGATGGAACAAGG - Intronic
1187215715 X:17274578-17274600 ACAAAAATACATATGCAACAAGG - Intergenic
1187498395 X:19815828-19815850 GCAATAAAACAGAATGAACTCGG - Intronic
1188129317 X:26411681-26411703 GCAATAAGACAGCTGGAAAAAGG - Intergenic
1188133507 X:26466940-26466962 GCAAAAATACACTTGGAAGAGGG - Intergenic
1188705225 X:33319890-33319912 GCAATAATTTAGATTGAAAAAGG + Intronic
1188787977 X:34372349-34372371 GAAAAAATAAAGATAGAACAGGG - Intergenic
1189665698 X:43352311-43352333 ACCACAATACAGATGGAAAAAGG - Intergenic
1190437622 X:50441778-50441800 GCAATAATACAAAATGAATATGG - Intronic
1192735648 X:73847230-73847252 GCAGTAATGCAAATGGAGCAAGG + Intergenic
1193202094 X:78703703-78703725 GAAATAATACATTTGAAACAAGG - Intergenic
1195310978 X:103631444-103631466 GCAATATTAAAGCTGGAAGAAGG - Intergenic
1197912164 X:131494836-131494858 GAAATAATAAAAATGGAATAAGG + Intergenic
1199238906 X:145524205-145524227 GCAATAATCCAGATAGACAATGG + Intergenic
1200327671 X:155259607-155259629 GCTATAATCCTGAGGGAACATGG - Exonic
1201549023 Y:15199469-15199491 GCAGCAAGACAGATGGAACTGGG + Intergenic