ID: 969581996

View in Genome Browser
Species Human (GRCh38)
Location 4:8071146-8071168
Sequence CTGCCCCCACAGAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969581996_969582006 22 Left 969581996 4:8071146-8071168 CCCAGCTCCCTCTGTGGGGGCAG 0: 1
1: 1
2: 3
3: 38
4: 299
Right 969582006 4:8071191-8071213 GCTCTGCCACAGTTGCTGCCAGG No data
969581996_969582000 0 Left 969581996 4:8071146-8071168 CCCAGCTCCCTCTGTGGGGGCAG 0: 1
1: 1
2: 3
3: 38
4: 299
Right 969582000 4:8071169-8071191 CGCCATCCGTCCCCAGCAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969581996 Original CRISPR CTGCCCCCACAGAGGGAGCT GGG (reversed) Intronic
900318433 1:2070712-2070734 CTGACCCCACAGTGGGGGCCAGG + Intronic
900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG + Intergenic
900494711 1:2971220-2971242 CTGCCCCCACAGGAGGGGCTGGG - Intergenic
900979616 1:6039030-6039052 CCCCCCCCAGAGAGGGAACTGGG + Intronic
901787530 1:11634556-11634578 CTGCCCTCACAGAGGGAGTATGG - Intergenic
902477109 1:16694128-16694150 CTGGCGCCACGGCGGGAGCTGGG - Intergenic
903958611 1:27042146-27042168 CTGCCACCACAGGGTGACCTTGG - Intergenic
904593183 1:31626680-31626702 CCGCCCCCTCATAGGCAGCTTGG + Intronic
905284499 1:36870482-36870504 CTGGGCCCACAGAGGGCTCTGGG + Intronic
905340217 1:37272906-37272928 CAGCCCCCTCAGTGGGAGCAGGG + Intergenic
905908778 1:41639643-41639665 CTGACCACAGAGAGGGAGGTGGG - Intronic
906110989 1:43321815-43321837 CAGCCCCCACTGAGGGAGGTTGG - Intronic
906186087 1:43863129-43863151 CTTCCCCCAGACAGTGAGCTGGG - Intronic
909491411 1:76230969-76230991 CTTCCCTCACAGAAGGAGGTGGG - Intronic
910275928 1:85449180-85449202 GGGCCCCCACAGAAGGGGCTAGG + Intronic
911070365 1:93827452-93827474 CAGCCCTCTCGGAGGGAGCTGGG - Intronic
912390753 1:109300928-109300950 CTGCCCTCCCACAGGGAGCCGGG - Intronic
915089890 1:153416914-153416936 CTGCCCCCACAGAGGGAGGAGGG + Intronic
915964403 1:160293870-160293892 CTGCCCCCACTGAGGAAGAGGGG + Intronic
916754639 1:167757194-167757216 CTGACCCCACAGTGGCAGCAAGG + Intronic
921216865 1:212945162-212945184 CTGCACCCTCAGAGGGATCCTGG - Intergenic
922598130 1:226829360-226829382 CTGCCCCCTCAGAGAGTGCCTGG - Intergenic
922661354 1:227433147-227433169 CTCCTCCCACAGAATGAGCTGGG + Intergenic
922722316 1:227905303-227905325 CTGCCCTCCCAGAGGAAGCGGGG - Intergenic
923347768 1:233072884-233072906 CTGGCCCCACAGAATGAGTTAGG + Intronic
923525616 1:234770267-234770289 CTAGCCCTGCAGAGGGAGCTGGG + Intergenic
1063148583 10:3318161-3318183 CTGCCCACACAGAGGCTGCCGGG - Intergenic
1063148617 10:3318298-3318320 CTGCCCACACAGAGGCTGCAGGG - Intergenic
1063148653 10:3318435-3318457 CTGCCCACACAGAGGCTGCCGGG - Intergenic
1063148671 10:3318503-3318525 CTGCCCACACAGAGGCTGCCGGG - Intergenic
1063148689 10:3318571-3318593 CTGCCCACACAGAGGCTGCAGGG - Intergenic
1065237126 10:23664223-23664245 CTGCCCTCACAGAAGGAATTTGG - Intergenic
1067146434 10:43697432-43697454 CAGCCCCGACACAAGGAGCTAGG - Intergenic
1067187616 10:44043847-44043869 CTGCTCTCACCCAGGGAGCTGGG + Intergenic
1067233529 10:44427855-44427877 CTGCCCTCACAGAGGGATGAGGG - Intergenic
1067804295 10:49382456-49382478 CTGCATCCCCAGAGGTAGCTGGG - Intronic
1070548428 10:77470944-77470966 CTGCCCTCAGAGAGGCAGCCCGG + Intronic
1070909394 10:80104322-80104344 CTCCCGCCATGGAGGGAGCTAGG + Intergenic
1071519441 10:86319905-86319927 CTGCTGTCACCGAGGGAGCTAGG - Intronic
1072766458 10:98098492-98098514 CTGACCGCACAGCAGGAGCTGGG - Intergenic
1073057849 10:100713636-100713658 CTGGCCGCGCAGGGGGAGCTGGG + Intergenic
1073207692 10:101777235-101777257 CTGCTCCCACAGAAGCAGCATGG - Intronic
1073323742 10:102630803-102630825 CTGCCACCAGAGAAGGTGCTTGG + Exonic
1073603876 10:104873732-104873754 CTCCCACCACAGAGGCAGTTTGG + Intronic
1074948306 10:118302953-118302975 CTGCCCCCAGAGAGGGACCCTGG + Exonic
1075254843 10:120917596-120917618 CAGCCCCCACAGAAGCTGCTGGG + Intergenic
1075417026 10:122271697-122271719 CTGCCCGCCCACAGGGACCTTGG + Intronic
1075462874 10:122630534-122630556 GTGCCCCCAAAGAGGCAGCTGGG - Intronic
1076737270 10:132464492-132464514 CTGCTCCAAGGGAGGGAGCTGGG - Intergenic
1078539040 11:12198781-12198803 GTGCCACCACAGTGGGAGTTTGG - Intronic
1079030099 11:16980364-16980386 CTGGTCCCACAGAGAGAGCCTGG + Intronic
1079690094 11:23406630-23406652 CGGGCCCCACAGAGGGAGCGTGG - Intergenic
1083170862 11:60923506-60923528 CTGCCCCCACAGGGAGAAATTGG - Intergenic
1083302489 11:61746190-61746212 CCACCCTGACAGAGGGAGCTGGG + Exonic
1083399696 11:62415029-62415051 CTGCCCCAAGAAAGGTAGCTGGG - Intronic
1083805716 11:65072630-65072652 GTGCCCCTCCAGTGGGAGCTGGG - Intronic
1084332470 11:68438135-68438157 CTGCCACCACCGAGGGCCCTGGG + Intronic
1084420633 11:69058810-69058832 CTGCCCCAGCAAAGGGAGCGAGG + Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1085793080 11:79512886-79512908 CTGCCCCCACCAAGGCAGATTGG - Intergenic
1086462420 11:87018957-87018979 CTGCCACCACAGGGACAGCTAGG - Intergenic
1088373491 11:109116472-109116494 CTGCCTACAAAGAGGCAGCTAGG - Intergenic
1089627277 11:119759451-119759473 GTGCCCATCCAGAGGGAGCTGGG - Intergenic
1090441292 11:126727591-126727613 CAGACCCCCCCGAGGGAGCTGGG - Intronic
1090859739 11:130642272-130642294 CTGCCCTCCGAGAGGGGGCTGGG - Intergenic
1091122854 11:133070999-133071021 GTTCACCTACAGAGGGAGCTTGG + Intronic
1091187761 11:133661890-133661912 CTGCCACAGCAGAGGGAGCGGGG + Intergenic
1096237833 12:49942098-49942120 CTGTCCCCACAGTGGGAGCAAGG - Intergenic
1096526066 12:52211129-52211151 CGTCCCCCAGAGAGGGAGCATGG + Intergenic
1096617293 12:52840822-52840844 CTGCACCTTCAGAGGGAGCACGG + Intronic
1096812925 12:54183140-54183162 CTGCCCCCAGTGGGGGTGCTTGG - Intronic
1096888855 12:54746021-54746043 CTGGCCTCACAGAATGAGCTAGG + Intergenic
1102033837 12:109759834-109759856 CTGCCACCACCGAAGGTGCTTGG - Intronic
1102530918 12:113546138-113546160 ATGCTTCCACAGAGGGACCTGGG - Intergenic
1102956201 12:117060693-117060715 ATGCCCCCACTGGGTGAGCTGGG - Intronic
1103327795 12:120133076-120133098 CTGTCCCCACAGAGAAGGCTGGG + Intronic
1103828937 12:123763202-123763224 CCGCCTCCACAGAGGGTTCTGGG - Intronic
1104035173 12:125092758-125092780 CAGCCCCCACAGAGGGCCCTAGG - Intronic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104992911 12:132636225-132636247 CTGGCGCCACAAAGAGAGCTGGG + Intronic
1104994356 12:132644767-132644789 AGGACCCCACACAGGGAGCTAGG - Intronic
1104994376 12:132644821-132644843 AGGACCCCACACAGGGAGCTAGG - Intronic
1104994397 12:132644876-132644898 AGGACCCCACACAGGGAGCTAGG - Intronic
1104994475 12:132645093-132645115 AGGACCCCACACAGGGAGCTAGG - Intronic
1105529993 13:21210602-21210624 CTCCCACCCCAGAGGGAGCAGGG - Intergenic
1106433745 13:29706158-29706180 CTCCCCACACACAGGGAGCTGGG - Intergenic
1107285112 13:38781856-38781878 CTGAGCCCAGAGAGTGAGCTAGG + Intronic
1111683022 13:91467295-91467317 CTGTCACCACAGAGGGAGAAAGG + Intronic
1112259640 13:97866753-97866775 CTGAGACCACAGAGGCAGCTAGG + Intergenic
1113885222 13:113655280-113655302 CTCCCCCCTCAGAGGGCCCTCGG - Intronic
1113948747 13:114059587-114059609 CTGCGGGCACAGAGGGCGCTCGG + Intronic
1116192904 14:41682944-41682966 CTGGCCTCACAGAAGGAGTTTGG - Intronic
1116560949 14:46377499-46377521 CTTCCTCCACCCAGGGAGCTAGG + Intergenic
1118426259 14:65666659-65666681 CTGCCCTCACAGAATGAGTTAGG - Intronic
1121035038 14:90696178-90696200 CTGCTCACACTCAGGGAGCTCGG - Intronic
1122106814 14:99464161-99464183 CTGGCCCCACAGTGGAATCTTGG - Intronic
1122156736 14:99754471-99754493 CTCCTCCCACACAGGGAGCCAGG - Intronic
1122353653 14:101111361-101111383 CTGCCCACACACAGGGCCCTGGG - Intergenic
1122859656 14:104576855-104576877 CTCCTGCTACAGAGGGAGCTGGG + Intronic
1122867358 14:104613268-104613290 TCTCCTCCACAGAGGGAGCTGGG - Intergenic
1122870703 14:104636991-104637013 CTGCCCACACAGTGGGCGCTGGG + Intergenic
1122886461 14:104712591-104712613 CTGCCCTGATAGAGTGAGCTGGG + Intronic
1125130411 15:36278470-36278492 CTCTTCCCACAGAGGGAGCAGGG - Intergenic
1125673768 15:41491752-41491774 CTGCCCTCAGAGACGGGGCTGGG - Intergenic
1126505822 15:49403271-49403293 CTGGCCTCACAGAATGAGCTAGG + Intronic
1127358731 15:58226471-58226493 TTCCCTCCACAGAGGGACCTTGG - Intronic
1127774071 15:62252096-62252118 CTCCTCCCACAGTGGGGGCTGGG - Intergenic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1128368763 15:67023999-67024021 CCGCCCCCACAGGAGGAGCCAGG - Intergenic
1129878365 15:78991856-78991878 ATACCCCCACAGAGGCAGCTGGG - Intronic
1131320872 15:91389578-91389600 CTGGCCTCACAGAGTGAGTTTGG + Intergenic
1131800021 15:96059079-96059101 ATACCCCCACAGAGAGAGGTAGG + Intergenic
1132501832 16:287913-287935 CTGCCCCCAAGGAGGCAGCCTGG - Exonic
1132615681 16:840220-840242 CTGCCCCTCCACAGGGAGCAGGG - Intergenic
1133222463 16:4324596-4324618 CTGCCCTCACAGCGGTAGATGGG + Intronic
1134073791 16:11276556-11276578 CTGCCCTCACAGAGGAGGCTGGG - Intronic
1134088725 16:11377799-11377821 CTGGCCTCACAGAGTGAGTTTGG + Intronic
1137407700 16:48203059-48203081 CTTCCCTCACTGAGGGAGGTTGG - Intronic
1141198453 16:81879063-81879085 ATTCCCCCACTCAGGGAGCTCGG - Intronic
1142129479 16:88426146-88426168 CCGCCTCCACAGAGGCAGCAGGG + Intergenic
1142130347 16:88429202-88429224 CTGCCCCCACCGAGGGTAGTGGG + Exonic
1142211140 16:88809113-88809135 CTGCCCCGACACAGGCAGCCTGG + Exonic
1142533053 17:595534-595556 GTGCCCCCCCGGAGGAAGCTGGG + Intronic
1142565185 17:835748-835770 CAGCCCCCACAGAGGCCGCAGGG + Intronic
1142565217 17:835881-835903 CAGCCCCCACAGAGGCCGCAGGG + Intronic
1142565249 17:836014-836036 CAGCCCCCACAGAGGCCGCAGGG + Intronic
1142565263 17:836059-836081 CAGCCCCCACAGAGGCCGCGGGG + Intronic
1142565275 17:836104-836126 CAGCCCCCACAGAGGCCGCAGGG + Intronic
1142565288 17:836149-836171 CAGCCCCCACAGAGGCCGCAGGG + Intronic
1143012309 17:3872692-3872714 CTGCCCCCACCAAGGGAGGGGGG - Intronic
1144932224 17:18868974-18868996 CTGACGCCACATAGGGATCTTGG - Intronic
1145908887 17:28531459-28531481 CTGCCTCTAGAGAGGGAGCTGGG - Intronic
1146917849 17:36689561-36689583 CTGACCCCACAGAGGCAGGGTGG + Intergenic
1147139005 17:38451225-38451247 AAGTCCCCACAGAGGCAGCTGGG + Intronic
1147184038 17:38704215-38704237 CGCCCCCCACAGCGGGAGTTCGG - Intergenic
1147323535 17:39659663-39659685 CTGCCCCAAGAGAGGGAGCTGGG + Intronic
1147333949 17:39715789-39715811 CTGCGCTCACTGAGGGAACTGGG + Exonic
1147336080 17:39727604-39727626 CTGCCCCCACAGTGGACCCTGGG - Intronic
1148437998 17:47696978-47697000 CTGCCCCTCCATAGGGTGCTGGG + Intronic
1149085537 17:52710690-52710712 CTGCCTACAGAGAGGCAGCTGGG + Intergenic
1150335348 17:64326631-64326653 CTGCCCCCACAGAGAGAGAGCGG - Intronic
1150621658 17:66812312-66812334 CCGGCCCCACAGAGGCAGCAGGG + Intergenic
1151352874 17:73542158-73542180 CAGCCCCCAGAGAGGGACTTGGG - Intronic
1151589523 17:75034235-75034257 CTGCCCCGCCAGGTGGAGCTGGG - Intronic
1153922591 18:9804719-9804741 CTGTCCTAACAGAGGCAGCTGGG + Intronic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1156480350 18:37432341-37432363 CTGGGCCCAGAGGGGGAGCTTGG + Intronic
1156586596 18:38437889-38437911 TTGCCACCACAGAGAGAGATGGG - Intergenic
1157790896 18:50529969-50529991 CTGCTCCCACAGAGGGGGTGGGG - Intergenic
1160031940 18:75269556-75269578 CTGACTCCACAGAGGGAGCCTGG + Intronic
1160754366 19:750008-750030 CTGCCCTCATAGACGGCGCTAGG + Intergenic
1160800189 19:964089-964111 CTGCACCCACAGAGGGCCCTGGG + Intronic
1160931963 19:1575054-1575076 CTGCCGCCACAGAGGGTACCAGG - Intronic
1161290290 19:3490507-3490529 CTGCACCCACAACAGGAGCTGGG + Intergenic
1163011445 19:14429084-14429106 CTGCCTCCCCAGATGGAGCTGGG - Intergenic
1163152272 19:15422525-15422547 CAGGCCCCACAGAGGGAGCGTGG + Exonic
1163680004 19:18675858-18675880 GTCCCCCCACAGAGGGAAGTTGG - Intergenic
1165130872 19:33631149-33631171 CTGCCCACACAGGTTGAGCTGGG + Intronic
1165662676 19:37595246-37595268 CTGCACCCACAGAGGACACTCGG - Intronic
1165892880 19:39125497-39125519 CTTCCCCCCCAGAAGGAGTTAGG - Intergenic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1166228071 19:41409500-41409522 CTGGGCTCGCAGAGGGAGCTGGG + Intronic
1166348597 19:42182662-42182684 CTGCCCCATCCTAGGGAGCTAGG - Intronic
1167055666 19:47110729-47110751 CTGCCCCCGGAGAGGGGGCCCGG + Intronic
1167593640 19:50416860-50416882 CACCCCCCACAGAGGGTCCTCGG + Intronic
1167631694 19:50629735-50629757 GTTCCCACAGAGAGGGAGCTAGG - Intronic
1168128606 19:54301923-54301945 CTGCACCCACATTGGGAGCCTGG + Intergenic
1202711125 1_KI270714v1_random:19954-19976 CTGGCGCCACGGCGGGAGCTGGG - Intergenic
925231590 2:2237724-2237746 CTGCCTCCAAAGAGGGGGCCAGG + Intronic
925595898 2:5555404-5555426 CTGCCCCCACAGCCTGGGCTGGG + Intergenic
925637826 2:5959339-5959361 CAGCCCTGACAGAGGCAGCTGGG + Intergenic
927641766 2:24849935-24849957 GTGCCACCACTGAGGGTGCTGGG - Intronic
929064142 2:37956054-37956076 CTGACCTCACAGAATGAGCTTGG + Intronic
931220592 2:60285124-60285146 CTGCCCCCACGCAAGGTGCTGGG - Intergenic
934656225 2:96117927-96117949 CTGCTCCCATGGAGGGAGCAGGG - Intergenic
934857654 2:97739144-97739166 CTGCCCACACACAGGGTGCTGGG - Intronic
937301869 2:120847689-120847711 CTGGCCTCCCAGAGTGAGCTGGG + Intronic
937321885 2:120965896-120965918 CTGACCCCACAGAGGGGCCAGGG - Intronic
937973159 2:127565484-127565506 ATGCCCTCACTGAGGGAGGTGGG + Intronic
939232292 2:139444448-139444470 TTACCTCCACAGAGGCAGCTTGG + Intergenic
942792984 2:179781967-179781989 CTGGCCTCACAGAATGAGCTGGG - Intronic
942947673 2:181687329-181687351 CAGCCCTCCCAGAGGGAACTGGG + Intergenic
943302176 2:186216915-186216937 CTGCCACCACAGAGGTGGGTAGG - Intergenic
943812669 2:192209060-192209082 CTGCATCCTCAGAGGTAGCTTGG - Intergenic
946767320 2:223052803-223052825 CTGCCTCCACAGCAGGGGCTGGG - Exonic
946991073 2:225330292-225330314 CTGACTCCAGAGAGGGAGCATGG + Intergenic
947606671 2:231490529-231490551 CTGCCCACAGATAGGGAGCCAGG + Intergenic
947733856 2:232444969-232444991 CTTCACCCACAGTGGGTGCTCGG + Intergenic
948687373 2:239677609-239677631 CTGCCCCACCTCAGGGAGCTGGG + Intergenic
948876952 2:240834569-240834591 TTGCACCCACAGAGGGCGCAAGG + Intergenic
1169038074 20:2470072-2470094 CTTCCTTCACAGAGGTAGCTGGG - Intronic
1169389709 20:5179677-5179699 CTGCAACCTCAGGGGGAGCTAGG + Intronic
1169771946 20:9210541-9210563 CTGTCCCCTCAGAGAAAGCTTGG - Intronic
1170685886 20:18569027-18569049 CGGCCCCCACAAAGTGAGATTGG + Intronic
1170800236 20:19584515-19584537 CTGGCCACACTGAGGGAACTGGG + Intronic
1171413246 20:24960398-24960420 CTGCCCCCACTCAGGCAGCAGGG - Intergenic
1171532540 20:25861976-25861998 CGGCCCCCACTGAGTGAGATAGG + Intronic
1173262212 20:41446641-41446663 CTATCCCCACAGAGGGAGCTGGG - Intronic
1174352602 20:49979323-49979345 CTTCCCCTGCAAAGGGAGCTGGG + Intergenic
1175064602 20:56274123-56274145 CTTTCCTCCCAGAGGGAGCTGGG + Intergenic
1175108124 20:56628761-56628783 CTGTGCCCACGGAGGGAACTGGG + Intergenic
1176061124 20:63173472-63173494 CTGGCCCCACCTAGGGATCTTGG - Intergenic
1176300891 21:5098451-5098473 CTCACCCCACAGAAGGATCTGGG - Intergenic
1178366856 21:31995572-31995594 CTGCCCAGGCAGAGGGAGATGGG + Intronic
1178825280 21:36010359-36010381 CTGGCCTCACAGAGTGAGTTTGG - Intergenic
1179101096 21:38356165-38356187 CTGCCCCTGCGGAGGGAGCACGG - Intergenic
1179856145 21:44163502-44163524 CTCACCCCACAGAAGGATCTGGG + Intergenic
1179942602 21:44649588-44649610 CTGCCCCGACAGAGCCAGCTTGG - Intronic
1180698584 22:17769700-17769722 CTCCACACACAGAGGCAGCTGGG + Intronic
1181114538 22:20622930-20622952 TGGCCTCCTCAGAGGGAGCTGGG - Intergenic
1181478641 22:23183534-23183556 CCGCCCCCACATAGGGACTTAGG - Intronic
1182547229 22:31083319-31083341 CTGTCCCCACAGTGGGTGATGGG - Intronic
1183090693 22:35519943-35519965 CCTCCCCCACAGAGAAAGCTTGG - Intergenic
1183351205 22:37335648-37335670 CTGCCTCCAGGGAGGGAGCCTGG + Intergenic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
1185339242 22:50284245-50284267 CTGCCCCCACAGAGGGGCGTGGG + Intronic
949917451 3:8975746-8975768 CAGCCCCCAAAGAAGGAGCAAGG - Intergenic
950456066 3:13093441-13093463 CTTCCTCCACAGGAGGAGCTGGG + Intergenic
950673222 3:14539613-14539635 ATTCCTCCAAAGAGGGAGCTTGG - Intronic
951645996 3:24891919-24891941 CTGCACCCACAGAAGTAGATGGG + Intergenic
954116117 3:48467693-48467715 CTGCCCACACCCAGGGACCTGGG + Intergenic
954301903 3:49704752-49704774 CTGCCCCCACTGCGGCACCTGGG - Exonic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954628415 3:52035410-52035432 ATGTTCCCACAGAGGGAGCGAGG - Intergenic
954712668 3:52512805-52512827 CTGCACGCACACAGGGAGCAGGG - Intronic
954869401 3:53756341-53756363 CTGCCAACCCAGAGGGAGGTGGG + Intronic
955407273 3:58633409-58633431 CAGTCCCCACAGGGGTAGCTGGG + Intergenic
955538172 3:59947017-59947039 CTGGCCTCACAGAAGGAGTTAGG + Intronic
961449351 3:126995443-126995465 GTCCCCCTACAGAGGAAGCTGGG + Intronic
961624688 3:128253757-128253779 CTGCCCCCACAGAAGTAGCGGGG - Intronic
962472802 3:135728189-135728211 CTACCCTCACAGAGTGAGTTAGG + Intergenic
964821529 3:160775637-160775659 CTGGCTCCTCAGAGGAAGCTAGG + Intronic
967979871 3:195059332-195059354 CTGCCCCCTCAGCTGGAGCTGGG - Intergenic
968271635 3:197407703-197407725 CTGCCCCCACAGAGGGGGTGGGG - Intergenic
968485939 4:861787-861809 CTGCCCATACAGAGGAAGTTCGG + Intronic
968582548 4:1401801-1401823 CCTGCCTCACAGAGGGAGCTTGG - Intergenic
968870599 4:3240130-3240152 CTGCCTCCACCGAGCCAGCTTGG + Exonic
969031993 4:4222947-4222969 CTCCTCCCAGAGAGGCAGCTGGG + Intronic
969254059 4:5990636-5990658 CGGCCCCCAGAGAGGGAGTGCGG + Intergenic
969302775 4:6307080-6307102 CAGCCCCATCAGAGGGAGCTGGG + Intergenic
969502794 4:7563588-7563610 GTGCTCCCAGAAAGGGAGCTGGG - Intronic
969581996 4:8071146-8071168 CTGCCCCCACAGAGGGAGCTGGG - Intronic
970492078 4:16584937-16584959 CTGACCCCACATAGGAAGCTGGG - Intronic
979999618 4:127472622-127472644 CTTCCCCCACAAAGTGACCTGGG - Intergenic
980109152 4:128618188-128618210 CTGACCCCACAGAATGAGTTAGG - Intergenic
983030149 4:162790562-162790584 CTGCCTACACAGAGGTAGCTAGG + Intergenic
985643696 5:1075238-1075260 GTGCCCTCACAGGGGCAGCTGGG - Intronic
986095999 5:4554692-4554714 CTGACCTCCCAGTGGGAGCTCGG + Intergenic
987148730 5:15017690-15017712 CTCTCCCCACAGTGGGAGCGTGG - Intergenic
987611755 5:20213385-20213407 CTGGCCTCACAGAAGGAGTTAGG + Intronic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
989001558 5:36766080-36766102 ATTCCCCCACAGAAGTAGCTGGG - Intergenic
992726241 5:79610392-79610414 CTGGCCCCACAGAATGAGCTGGG + Intergenic
995570170 5:113471756-113471778 CTGCCCCCAGAGAGGCAGGCAGG + Intronic
997200108 5:132004801-132004823 CTGCCACCACAGACAGACCTAGG + Intronic
998168871 5:139860347-139860369 GGGCCCCCAATGAGGGAGCTGGG - Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999232455 5:150069775-150069797 CACCCCCCACCGAGGGAGCTGGG - Intronic
999320909 5:150614476-150614498 CTGACCCCTCAGAGGGAGCAGGG + Intronic
1000288404 5:159847336-159847358 CTGGCGCCAGAGTGGGAGCTGGG - Intergenic
1000342941 5:160291502-160291524 CTGCCCCCAAAGAGGGAGGAGGG - Intronic
1002280674 5:178128353-178128375 CTGGCCCCAAAGAGGGTGATGGG + Intergenic
1002383430 5:178847743-178847765 CCGCAACCACAGAGGGACCTGGG + Intergenic
1002928255 6:1617517-1617539 CTGCCCCCACAGAAGGCTGTGGG + Intergenic
1005952243 6:30640539-30640561 TTGCCCTCAGAGAGGGAGCAGGG - Exonic
1006425549 6:33960764-33960786 CAGCCCCAGCAGTGGGAGCTGGG + Intergenic
1006521168 6:34572081-34572103 CAGCCCCCACAGCGGGAGGGAGG + Intergenic
1007088718 6:39168663-39168685 CTGGCCTCCCATAGGGAGCTTGG - Intergenic
1007131280 6:39476509-39476531 CTGCACCATCAGAAGGAGCTGGG + Intronic
1007229509 6:40338500-40338522 CTGCCCCAACACAGGAATCTAGG - Intergenic
1007709123 6:43810520-43810542 CTGCTCCCACAGAGGGGCCCAGG + Intergenic
1008402261 6:51077883-51077905 CTGCCCCCATGGAGGTAGCAGGG + Intergenic
1010775848 6:79884524-79884546 CTGGCCTCACAGAGTGAGTTTGG - Intergenic
1012096349 6:94967584-94967606 CTGGCCTCACAGAGTGAGTTAGG - Intergenic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1014147855 6:118018728-118018750 CTGCCCCCATAGAGCTAGCTGGG + Intronic
1016230117 6:141793150-141793172 CTGGCCCCATAGAAGGAGTTTGG - Intergenic
1017067928 6:150547534-150547556 CTGCCCCTTGGGAGGGAGCTGGG + Intergenic
1017929125 6:158937472-158937494 ATTCCCTCACAGAGGAAGCTGGG - Intergenic
1018164186 6:161078257-161078279 CTGCCCACACTCAAGGAGCTGGG - Intronic
1018168230 6:161120767-161120789 CTGGCCTCACAGAGTGAGTTTGG + Intergenic
1019518842 7:1451612-1451634 CTGGCCCCACAGAGGGAGCTGGG + Intronic
1019712651 7:2524626-2524648 CGGCCCCCACAGATGGCCCTGGG + Intronic
1020109815 7:5441747-5441769 CTGCCCCCACAGCCAAAGCTTGG + Intronic
1021510376 7:21427520-21427542 CTGCCCCCGCGCAGGGAGCATGG - Intergenic
1022801505 7:33781142-33781164 CTCACCCCATAGAGGGAGCTGGG + Intergenic
1023889452 7:44381950-44381972 CTTCCCCCTCAGAGGGTGATGGG - Exonic
1024216727 7:47254622-47254644 CGGCACCCACAGAGGGCGCGCGG + Intergenic
1024229803 7:47355262-47355284 CCGGCCCCACAGGAGGAGCTGGG + Intronic
1026985977 7:74555428-74555450 CTGCCCCCAGAGAGGGATTCCGG + Exonic
1028175919 7:87657900-87657922 CTGCTCCCACAGGGGAAGGTGGG - Intronic
1030412864 7:109203628-109203650 TAGCGCCCACAGAGGGAGCATGG + Intergenic
1030866842 7:114710565-114710587 CTGCCCACACAAAGGCAGGTGGG - Intergenic
1031547168 7:123065011-123065033 CTGCCCTCATAGAATGAGCTGGG + Intergenic
1031892588 7:127311938-127311960 CTGGCCTCACAGAAGGAGTTTGG - Intergenic
1032406035 7:131656108-131656130 CGGCCCCCACAGAGAGAGTGCGG + Intergenic
1034627306 7:152503512-152503534 TTGCCCCCACCGGGGGTGCTCGG + Intergenic
1034689979 7:153006579-153006601 GTGCCCTCACAGAGACAGCTGGG + Intergenic
1035198561 7:157243564-157243586 CTGGCCCCTCCCAGGGAGCTTGG + Intronic
1035455625 7:159006810-159006832 TTCCCGCCACAGAGGGAGGTTGG + Intergenic
1035917555 8:3641672-3641694 TTGCCCCAACAGAGGGGGCCAGG + Intronic
1036124671 8:6052009-6052031 CTGCCTCCACCGTGGGAGCCCGG + Intergenic
1037722306 8:21455290-21455312 CTGAACCCACAAAGGGACCTCGG + Intergenic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1038765404 8:30423403-30423425 CTGTCCCCTCCGAGGTAGCTAGG - Intronic
1039115069 8:34083957-34083979 CAGGCCCAAGAGAGGGAGCTGGG - Intergenic
1040573457 8:48629360-48629382 CTTCCCCAACAGACAGAGCTAGG + Intergenic
1041297963 8:56380076-56380098 CTGCCCTCATAGAGTGAGTTGGG + Intergenic
1041783256 8:61602091-61602113 CAGACCCCACAGAAGGAGTTGGG - Intronic
1042940464 8:74101938-74101960 GTGGCCCCACAGTGGGAGCATGG + Intergenic
1047080275 8:121452658-121452680 CTTCCCCCATAGTGGGAGCCTGG + Intergenic
1047940296 8:129822672-129822694 CTGGTCTGACAGAGGGAGCTGGG + Intergenic
1048326530 8:133443408-133443430 CCGCCACCACATAGTGAGCTTGG + Intergenic
1049040059 8:140105764-140105786 CTCCCCCCACAGGGTGAGTTAGG - Intronic
1049588193 8:143441470-143441492 CTGGCAGCACAGAGGGAGCCCGG + Intronic
1050162342 9:2731701-2731723 CTGCCCTCCCATAAGGAGCTAGG + Intronic
1050578304 9:7023146-7023168 CTGGCCTCACGGAGTGAGCTTGG + Intronic
1051891776 9:21949674-21949696 CTGGCCTCACAGAAGGAGTTGGG - Intronic
1052826608 9:33180773-33180795 CTGCCTCCATGGTGGGAGCTAGG + Intergenic
1058349855 9:104009061-104009083 CTTCCCCCACTGAGGGAGATGGG - Intergenic
1059455804 9:114399358-114399380 CTGCACTCACAGCGGGACCTTGG - Intergenic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1061064216 9:128267384-128267406 CTCCTCCCACAGCGGGGGCTGGG - Intronic
1061625445 9:131838450-131838472 CTGCCCCCTCAGGACGAGCTGGG - Intergenic
1061796315 9:133087664-133087686 CTGCAGTCAGAGAGGGAGCTGGG + Intergenic
1062046214 9:134425646-134425668 CTGTCCCCACAGGGGGACCTTGG - Intronic
1062232836 9:135491698-135491720 CTCCCCCTACATAGGGAGGTGGG - Intergenic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1188542680 X:31267023-31267045 CCGCCCCCACCTAGGGACCTGGG + Intronic
1188708189 X:33361157-33361179 CTGGCCTCACAGAATGAGCTGGG - Intergenic
1190445473 X:50519690-50519712 CAGCCCCCACTGAGGTGGCTAGG - Intergenic
1192074811 X:67982590-67982612 CAGCCCTTACAGAGGTAGCTGGG - Intergenic
1193245856 X:79228499-79228521 CTGGCCTCACAGAGTGAGTTTGG + Intergenic
1193403489 X:81073958-81073980 CTGGCATCACAGAGTGAGCTTGG + Intergenic
1194553232 X:95326917-95326939 CTGCCCACATAGAAGGAGTTTGG + Intergenic
1194953686 X:100155031-100155053 CTGACCTCATAGAGGGAGTTTGG + Intergenic
1195704468 X:107729010-107729032 CTGCCCACTCAGAGGCAGTTTGG - Intronic
1196794419 X:119490768-119490790 CTGCACCTGCAGAGGGAGATTGG - Intergenic
1197561268 X:128024853-128024875 CTGCACACACAGAGGGACCCTGG + Intergenic
1200012196 X:153127488-153127510 CTGTCCCCGCACAGGGAGCCTGG + Intergenic
1200027404 X:153272431-153272453 CTGTCCCCGCACAGGGAGCCTGG - Intergenic
1200942927 Y:8804351-8804373 CTCCACCCACAGAGGGAAGTCGG + Intergenic