ID: 969583187

View in Genome Browser
Species Human (GRCh38)
Location 4:8077261-8077283
Sequence GACCCCGCTGTGCCTCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969583174_969583187 25 Left 969583174 4:8077213-8077235 CCTCAGAAGCTCCCCCTGCATAA 0: 1
1: 0
2: 1
3: 13
4: 166
Right 969583187 4:8077261-8077283 GACCCCGCTGTGCCTCCTATGGG No data
969583176_969583187 13 Left 969583176 4:8077225-8077247 CCCCTGCATAATTGCTATCTGCC 0: 1
1: 0
2: 2
3: 23
4: 116
Right 969583187 4:8077261-8077283 GACCCCGCTGTGCCTCCTATGGG No data
969583177_969583187 12 Left 969583177 4:8077226-8077248 CCCTGCATAATTGCTATCTGCCC 0: 1
1: 0
2: 0
3: 3
4: 108
Right 969583187 4:8077261-8077283 GACCCCGCTGTGCCTCCTATGGG No data
969583182_969583187 -9 Left 969583182 4:8077247-8077269 CCTGCCTCCCGGGCGACCCCGCT 0: 1
1: 1
2: 1
3: 17
4: 196
Right 969583187 4:8077261-8077283 GACCCCGCTGTGCCTCCTATGGG No data
969583175_969583187 14 Left 969583175 4:8077224-8077246 CCCCCTGCATAATTGCTATCTGC 0: 1
1: 0
2: 0
3: 6
4: 134
Right 969583187 4:8077261-8077283 GACCCCGCTGTGCCTCCTATGGG No data
969583178_969583187 11 Left 969583178 4:8077227-8077249 CCTGCATAATTGCTATCTGCCCT 0: 1
1: 0
2: 0
3: 8
4: 100
Right 969583187 4:8077261-8077283 GACCCCGCTGTGCCTCCTATGGG No data
969583181_969583187 -8 Left 969583181 4:8077246-8077268 CCCTGCCTCCCGGGCGACCCCGC 0: 1
1: 0
2: 0
3: 19
4: 229
Right 969583187 4:8077261-8077283 GACCCCGCTGTGCCTCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969583187 Original CRISPR GACCCCGCTGTGCCTCCTAT GGG Intronic
No off target data available for this crispr