ID: 969583414

View in Genome Browser
Species Human (GRCh38)
Location 4:8078442-8078464
Sequence GCTCATTTATGGAGACTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969583414_969583417 -1 Left 969583414 4:8078442-8078464 CCTCCGAGTCTCCATAAATGAGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 969583417 4:8078464-8078486 CTACAGAGAAAAGCCGTCTGCGG 0: 1
1: 0
2: 1
3: 6
4: 129
969583414_969583418 0 Left 969583414 4:8078442-8078464 CCTCCGAGTCTCCATAAATGAGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 969583418 4:8078465-8078487 TACAGAGAAAAGCCGTCTGCGGG 0: 1
1: 0
2: 0
3: 6
4: 121
969583414_969583420 11 Left 969583414 4:8078442-8078464 CCTCCGAGTCTCCATAAATGAGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 969583420 4:8078476-8078498 GCCGTCTGCGGGGTCATCCCTGG 0: 1
1: 0
2: 1
3: 5
4: 65
969583414_969583419 1 Left 969583414 4:8078442-8078464 CCTCCGAGTCTCCATAAATGAGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 969583419 4:8078466-8078488 ACAGAGAAAAGCCGTCTGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969583414 Original CRISPR GCTCATTTATGGAGACTCGG AGG (reversed) Intronic
900900307 1:5511353-5511375 GCACATTTATGGGGACTCATAGG - Intergenic
909829754 1:80173252-80173274 GCTCATTCACGGAGACACCGAGG + Intergenic
914328424 1:146643709-146643731 GCCCATTACTGGAGGCTCGGGGG - Intergenic
915403743 1:155643517-155643539 TCTCCATTATGGAGACTCTGAGG - Intergenic
922579347 1:226685508-226685530 GCTCATCTGTGGAGGCTCTGTGG - Intronic
1065086631 10:22185162-22185184 GCTCATTATTGAAGACTGGGAGG - Intergenic
1075154525 10:119963553-119963575 GTTCCTTTCTGGAGACTCTGAGG - Intergenic
1078498056 11:11841060-11841082 CTTCCATTATGGAGACTCGGCGG - Intergenic
1079770987 11:24459574-24459596 GTTCATTTATGGAGAATCTAGGG + Intergenic
1083698513 11:64458315-64458337 GCCCATTGATGGAGCCTGGGCGG + Intergenic
1087713149 11:101577700-101577722 GCTCATTTATGGAGTCTCCTGGG - Intronic
1088363308 11:109013467-109013489 GCCAATTTATGGAGACACAGGGG + Intergenic
1099975991 12:89545952-89545974 GCTCATTTATGGAGCCTGCTGGG - Intergenic
1101315327 12:103623615-103623637 GCTCCTTTTTGGAGACTCTGGGG - Intronic
1104124163 12:125829597-125829619 GCTCATTGATGGAGACGTAGGGG + Intergenic
1104364598 12:128165599-128165621 GCTCCTTTCTGGAGGCTCTGGGG + Intergenic
1106833127 13:33606802-33606824 GCTCCTTTCTGGAGGCTCCGGGG + Intergenic
1115447617 14:33509602-33509624 GCTCAGTTAAGGAGACCTGGAGG + Intronic
1117693633 14:58336688-58336710 GTTTATTCATGGAGACTTGGTGG + Intronic
1120036058 14:79699826-79699848 ACTCATTTTTGTAGACTTGGTGG - Intronic
1125245228 15:37628946-37628968 GCTAATTTATCAAGACTCAGTGG - Intergenic
1132495455 16:261146-261168 GCCCGTGTATGGAGACTCGGTGG - Intronic
1133986325 16:10671380-10671402 ATCCATTTATGGAGACTTGGTGG - Intronic
1140005140 16:71067233-71067255 GCCCATTACTGGAGGCTCGGGGG + Intronic
1150898182 17:69238225-69238247 GTTCATTTTTGGATACTCAGAGG - Intronic
1152989247 18:348012-348034 GGTCATTTATGTAGAGTCAGGGG + Intronic
1155606377 18:27610933-27610955 GCACATTTATTGAGACCCTGTGG + Intergenic
1159124609 18:64208400-64208422 GTTCATTTCTGGAGGCTCTGGGG - Intergenic
1160860380 19:1235047-1235069 CCTCATTGAAGGAGACCCGGCGG + Exonic
1163562920 19:18031216-18031238 GTTGATTTATGAAGACTCTGTGG + Intergenic
929661462 2:43789645-43789667 GCTCACTTTTGGGAACTCGGTGG + Exonic
933635966 2:84709213-84709235 GCACATCTGTGGAGACTGGGAGG + Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
1169759593 20:9076520-9076542 CTTCATTTATGGAGACACAGAGG + Intronic
1172220273 20:33269245-33269267 GCTCATTATTGGAGACAAGGGGG + Intergenic
1172870161 20:38130783-38130805 GCTCATGTGTGGACATTCGGAGG + Intronic
1173570177 20:44070899-44070921 GCTCAGTTGTGGAGGCTGGGAGG + Intergenic
1174043104 20:47713924-47713946 GCTCATTACTGGAGTCTCGGAGG - Intronic
1180931168 22:19592954-19592976 TCTCATTTCTGTAGACTCTGGGG - Intergenic
1181373856 22:22440646-22440668 ACTCATTAATGGAAACTCTGGGG + Intergenic
957964133 3:87300358-87300380 ACTCTTTTTTGGAGACTGGGAGG - Intergenic
961154837 3:124670883-124670905 GCTCAGGTTTGGAGACTCGGAGG - Intronic
968660010 4:1794955-1794977 GCGCATTGATGGCGGCTCGGCGG + Intronic
969583414 4:8078442-8078464 GCTCATTTATGGAGACTCGGAGG - Intronic
971435544 4:26618860-26618882 GGTTATTTAGGGAGACTTGGGGG + Intronic
973108031 4:46364523-46364545 GCTCCTTTCTGGAGCCTCTGGGG + Intronic
974289106 4:59908245-59908267 GGTTATTTCTGGAGACTCTGAGG - Intergenic
977124099 4:93142336-93142358 TCTCATTTATGGATGCTAGGAGG + Intronic
982798719 4:159675431-159675453 TGTCATTTATGGAGACTAGGAGG + Intergenic
995955972 5:117776695-117776717 GATCATTTCTGGAGGCTCCGGGG + Intergenic
1001677893 5:173533680-173533702 GCTGATTTAAAGAGACTCTGTGG - Intergenic
1005902965 6:30235129-30235151 GCTGCTTTATGGAGACAAGGTGG - Intergenic
1006300462 6:33191334-33191356 GCCCATTTCTGGAGACACTGAGG - Intronic
1010833285 6:80556588-80556610 GCTGATTTATGAAGACTGTGTGG - Intergenic
1022328365 7:29354224-29354246 GCCCATTTATGAAGACTTGAGGG - Intronic
1029417923 7:100455126-100455148 GCTCATCTCTAAAGACTCGGAGG + Intergenic
1031210450 7:118818782-118818804 GCTCATTTGTGGAGACTTCAAGG + Intergenic
1031225031 7:119025144-119025166 TCTCATTTAGAGACACTCGGAGG - Intergenic
1031765094 7:125768246-125768268 GATCACTTATGGAGTCTTGGGGG - Intergenic
1035870139 8:3129071-3129093 GCTCATTGATGTTGACTCCGTGG - Intronic
1038423519 8:27450185-27450207 GCTCATTCATGGACACACGTGGG + Intronic
1040068804 8:43172466-43172488 GCTCATTTCTGGAGTTTCTGGGG - Intronic
1043711428 8:83423484-83423506 GCTCATTTATGGACAATCTGTGG - Intergenic
1051890225 9:21934053-21934075 GCTGATTCATGGAGACTCCAGGG + Intronic
1053355465 9:37441918-37441940 ACTCATCTATGGAGGGTCGGAGG + Exonic
1061907466 9:133705988-133706010 CCACATTTCTGGAGACTGGGAGG - Intronic
1187673564 X:21692591-21692613 GCTCTTTTTTGGAGGCTCTGGGG - Intergenic
1194075883 X:89393315-89393337 GCTCTTATATGGAGGCTCTGGGG - Intergenic
1198847594 X:140929417-140929439 TCTCACATATGGAGACTCAGAGG - Intergenic
1200731489 Y:6747475-6747497 GCTCTTATATGGAGGCTCTGGGG - Intergenic
1200876618 Y:8162780-8162802 GCTTATTGATGGAGACTCAATGG - Intergenic