ID: 969584143

View in Genome Browser
Species Human (GRCh38)
Location 4:8082286-8082308
Sequence CACTGAGCGTATTCCTCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 72}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969584132_969584143 30 Left 969584132 4:8082233-8082255 CCAGGGCCCGACGTGCTGGGTAC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 969584143 4:8082286-8082308 CACTGAGCGTATTCCTCCTGCGG 0: 1
1: 0
2: 1
3: 5
4: 72
969584141_969584143 -4 Left 969584141 4:8082267-8082289 CCCACTATGCGCTGGGTCACACT 0: 1
1: 0
2: 0
3: 4
4: 62
Right 969584143 4:8082286-8082308 CACTGAGCGTATTCCTCCTGCGG 0: 1
1: 0
2: 1
3: 5
4: 72
969584140_969584143 -3 Left 969584140 4:8082266-8082288 CCCCACTATGCGCTGGGTCACAC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 969584143 4:8082286-8082308 CACTGAGCGTATTCCTCCTGCGG 0: 1
1: 0
2: 1
3: 5
4: 72
969584139_969584143 -2 Left 969584139 4:8082265-8082287 CCCCCACTATGCGCTGGGTCACA 0: 1
1: 1
2: 1
3: 5
4: 74
Right 969584143 4:8082286-8082308 CACTGAGCGTATTCCTCCTGCGG 0: 1
1: 0
2: 1
3: 5
4: 72
969584133_969584143 24 Left 969584133 4:8082239-8082261 CCCGACGTGCTGGGTACAAATCC 0: 1
1: 0
2: 2
3: 27
4: 276
Right 969584143 4:8082286-8082308 CACTGAGCGTATTCCTCCTGCGG 0: 1
1: 0
2: 1
3: 5
4: 72
969584134_969584143 23 Left 969584134 4:8082240-8082262 CCGACGTGCTGGGTACAAATCCT 0: 1
1: 0
2: 0
3: 5
4: 127
Right 969584143 4:8082286-8082308 CACTGAGCGTATTCCTCCTGCGG 0: 1
1: 0
2: 1
3: 5
4: 72
969584137_969584143 3 Left 969584137 4:8082260-8082282 CCTGGCCCCCACTATGCGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 193
Right 969584143 4:8082286-8082308 CACTGAGCGTATTCCTCCTGCGG 0: 1
1: 0
2: 1
3: 5
4: 72
969584142_969584143 -5 Left 969584142 4:8082268-8082290 CCACTATGCGCTGGGTCACACTG 0: 1
1: 0
2: 1
3: 9
4: 92
Right 969584143 4:8082286-8082308 CACTGAGCGTATTCCTCCTGCGG 0: 1
1: 0
2: 1
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969584143 Original CRISPR CACTGAGCGTATTCCTCCTG CGG Intronic
900217682 1:1490409-1490431 CACTCACCGTTTTCCTTCTGTGG - Exonic
902173853 1:14634819-14634841 CCCTGAGTGGATTCCTGCTGAGG - Intronic
905429991 1:37914910-37914932 CACTGAGCTTAATCTGCCTGGGG - Intronic
905649135 1:39644928-39644950 CAGTGAGCAAATTCTTCCTGAGG - Intergenic
906101481 1:43266530-43266552 CACTGATCGTATCCCTCCTGTGG - Intronic
920279135 1:204829727-204829749 GACTGAGCAGACTCCTCCTGGGG + Intronic
921200319 1:212799084-212799106 CACTGAGCTTATTCCTACCTTGG - Intronic
1063395906 10:5687243-5687265 CAGGGAACGCATTCCTCCTGGGG - Intronic
1063598432 10:7458587-7458609 CACTGGGCGCAGTCCTGCTGTGG - Intergenic
1066198784 10:33126924-33126946 CACAGACGGTATTTCTCCTGCGG - Intergenic
1067715008 10:48684387-48684409 CAATGAGGGGAGTCCTCCTGCGG - Intergenic
1075244652 10:120810491-120810513 AAATGTGAGTATTCCTCCTGGGG - Intergenic
1076585835 10:131546901-131546923 CACTGAGTGTAATACTCTTGGGG - Intergenic
1078028904 11:7728416-7728438 CAGTGAGCCTATTCCTTCTGTGG + Intergenic
1080392824 11:31864324-31864346 CCCTGATTGTTTTCCTCCTGTGG - Intronic
1082570441 11:54731851-54731873 CTCTGAGCATATTCCTAGTGAGG - Intergenic
1085036459 11:73303144-73303166 CACTGAGCTAATGCCTTCTGAGG - Intergenic
1087797135 11:102466551-102466573 CATGTAGCGTATTCCTCCTGTGG - Intronic
1092049616 12:5458748-5458770 CACGGAGCTTATTCCTTCTTTGG + Intronic
1095572248 12:43696636-43696658 CACTGAGGGTATTGCTCCTTAGG - Intergenic
1096517259 12:52163882-52163904 CACTGAGCCTGTGCCTGCTGGGG + Intergenic
1107365206 13:39664912-39664934 AACTGAGTGTGTTCCTCCAGTGG + Intronic
1122510472 14:102262936-102262958 CACTGAGCCAATTGTTCCTGGGG - Intronic
1124346394 15:28924190-28924212 AACTGGGCATTTTCCTCCTGAGG - Intronic
1125376875 15:39039605-39039627 CATTGAGCTTCTCCCTCCTGTGG + Intergenic
1135755038 16:25090160-25090182 CACTGAGTTTATTCTGCCTGAGG - Intergenic
1137599074 16:49743946-49743968 ATCTGAGTGTACTCCTCCTGGGG - Intronic
1140601658 16:76483342-76483364 CACTGAACAAATTACTCCTGGGG + Intronic
1145716100 17:27023249-27023271 CACTGAGCGTAATTCACCTCAGG - Intergenic
1145828736 17:27897853-27897875 CACTGAGCTTCGTCCTGCTGGGG + Intergenic
1157615893 18:48987538-48987560 CCCTGAGCGTTTTCCTCCCCTGG + Intergenic
1162523176 19:11193769-11193791 CACTCAGCCTATTCCTACTGCGG - Exonic
1163066397 19:14799412-14799434 CACAAAGCGTTTTCCACCTGTGG - Exonic
1166635460 19:44447657-44447679 CACTGAGAGATTTCCCCCTGTGG - Intronic
925939452 2:8802046-8802068 CACTGAGCTTGTTCCTGCTGTGG - Intronic
927718080 2:25365327-25365349 CGCTGAGGGTATTCCTGCTCGGG - Intergenic
946791302 2:223303104-223303126 TACTGAACCTATTCCTTCTGAGG + Intergenic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1175790712 20:61738379-61738401 CACAGAGGGAAATCCTCCTGGGG - Intronic
1178627844 21:34233195-34233217 CACTGGGTGGGTTCCTCCTGAGG + Intergenic
1182407081 22:30144296-30144318 AACTGAGAGAAGTCCTCCTGTGG - Intronic
952156642 3:30650533-30650555 CATAGAGCACATTCCTCCTGTGG + Intronic
956863238 3:73345382-73345404 AGCTGAGCTTATTCTTCCTGAGG - Intergenic
964123210 3:153207784-153207806 CTTTGAGCCTATTCATCCTGAGG + Intergenic
969447763 4:7255378-7255400 CACTGAGCCCATTCATACTGAGG - Intronic
969584143 4:8082286-8082308 CACTGAGCGTATTCCTCCTGCGG + Intronic
973713377 4:53651182-53651204 CACTCAACAAATTCCTCCTGGGG + Intronic
983045914 4:162985828-162985850 ACCTGAGCCTATTCCTCCTCTGG - Intergenic
985213805 4:187627179-187627201 CACTGAGAAAATTCCTTCTGAGG - Intergenic
985346899 4:189015679-189015701 AACTTAGCGTTTTCCTCCTTTGG - Intergenic
988654106 5:33189167-33189189 AACTCAGGGTATTCCTTCTGGGG + Intergenic
990128454 5:52548655-52548677 CACACAGAGTTTTCCTCCTGTGG + Intergenic
991988166 5:72310925-72310947 CACTGAGAGTATTCTGGCTGGGG + Intronic
998214219 5:140225317-140225339 CACTGTGGGGATTCCTGCTGGGG + Intronic
998801357 5:145872814-145872836 CTGTGAGGGTATTCCTCCTTTGG + Exonic
1000635362 5:163637800-163637822 CACTGAGGGTTTTCCTTCTCTGG + Intergenic
1000767958 5:165315542-165315564 CACTGAGAATGTTCCTCGTGTGG - Intergenic
1003856551 6:10281914-10281936 CACTCAGCGTAATCCTTCAGTGG - Intergenic
1014912581 6:127112121-127112143 CACTGAGGGTATTCACCTTGAGG + Intergenic
1015608243 6:134984035-134984057 TCCTGAGTGTGTTCCTCCTGAGG - Intronic
1017135219 6:151142007-151142029 CACTGAAGGCACTCCTCCTGGGG - Intergenic
1019393800 7:805579-805601 GACTGAGCGTGTTCATTCTGGGG + Intergenic
1019571135 7:1712902-1712924 CACTGAACGCTTCCCTCCTGAGG - Intronic
1026074623 7:67155434-67155456 CCGTGAGTGTATGCCTCCTGAGG + Intronic
1026702243 7:72656735-72656757 CCATGAGTGTATGCCTCCTGAGG - Intronic
1031591928 7:123604091-123604113 CACTGAGCTTTTTCTTCCAGAGG - Exonic
1034353528 7:150432944-150432966 CACTGAGCTTGATCCTGCTGGGG + Intergenic
1036585809 8:10122247-10122269 CACTGAGCATTTTCCTCCACAGG - Intronic
1042107746 8:65347297-65347319 CAATGAGCATACTCCTCCTTGGG + Intergenic
1043794460 8:84518889-84518911 GACTGAGTGAATTTCTCCTGTGG + Intronic
1043828974 8:84964897-84964919 CAGTGACCGTATTCCTCCGTGGG - Intergenic
1044039352 8:87347033-87347055 CACTGAGAGTATTGCTCTTTGGG + Intronic
1048582260 8:135739337-135739359 CACAGAGTTTATTCCTTCTGAGG - Intergenic
1048989621 8:139753519-139753541 CACTGGGAGTATTTCCCCTGAGG - Intronic
1056687587 9:88779176-88779198 CACTGAGAATATTCATCCTCAGG + Intergenic
1061857055 9:133447880-133447902 CACTGAGCCTATTTCTTTTGAGG + Intronic
1062111744 9:134785681-134785703 AACTCAGCGTGTTCATCCTGGGG - Intronic
1187681239 X:21769844-21769866 CACTTAGCGTATACCTGCTATGG - Intergenic
1189910608 X:45806877-45806899 CACAGAGCGTATTGCTGGTGTGG + Intergenic