ID: 969586704

View in Genome Browser
Species Human (GRCh38)
Location 4:8098031-8098053
Sequence GCTGGTCACCACCAGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969586702_969586704 -8 Left 969586702 4:8098016-8098038 CCCTCAGGACAACTTGCTGGTCA 0: 1
1: 0
2: 0
3: 4
4: 124
Right 969586704 4:8098031-8098053 GCTGGTCACCACCAGCTCAGAGG 0: 1
1: 0
2: 1
3: 51
4: 220
969586699_969586704 15 Left 969586699 4:8097993-8098015 CCAGGTAGGGAAGGGAACACTCG 0: 1
1: 0
2: 0
3: 11
4: 62
Right 969586704 4:8098031-8098053 GCTGGTCACCACCAGCTCAGAGG 0: 1
1: 0
2: 1
3: 51
4: 220
969586703_969586704 -9 Left 969586703 4:8098017-8098039 CCTCAGGACAACTTGCTGGTCAC 0: 1
1: 0
2: 2
3: 7
4: 123
Right 969586704 4:8098031-8098053 GCTGGTCACCACCAGCTCAGAGG 0: 1
1: 0
2: 1
3: 51
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969586704 Original CRISPR GCTGGTCACCACCAGCTCAG AGG Intronic
900015184 1:143847-143869 GCTGCTCACCTCCAGCTCTGTGG + Intergenic
900045452 1:502456-502478 GCTGCTCACCTCCAGCTCTGTGG + Intergenic
900067650 1:744186-744208 GCTGCTCACCTCCAGCTCTGTGG + Intergenic
900645515 1:3707045-3707067 TCTGGTCTCCAGCACCTCAGGGG + Intronic
902515434 1:16987206-16987228 CCTGGTCATCACCACCACAGTGG - Exonic
902728668 1:18353972-18353994 GCTGGTCGACACTAGCTCTGAGG + Intronic
903384235 1:22916300-22916322 GCTAGTGGTCACCAGCTCAGCGG - Intergenic
903842061 1:26250226-26250248 GCTGCTCACCTCCAGCTGTGTGG - Intronic
907273300 1:53303280-53303302 GCTGCTCCCCACCACCTCACTGG - Intronic
907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG + Intergenic
908263781 1:62359216-62359238 GCTTGTCACCACCTGCACAAGGG - Intergenic
910051077 1:82974586-82974608 ACTGGTGATGACCAGCTCAGTGG - Intergenic
911381548 1:97121181-97121203 GCAGGTCCTCACCTGCTCAGGGG - Intronic
912023126 1:105131968-105131990 ACTGGTGATGACCAGCTCAGTGG - Intergenic
914914030 1:151807350-151807372 GGTGGTCCCCACCAGCTCTTTGG - Exonic
915032818 1:152898361-152898383 ACTGGTGACAATCAGCTCAGTGG - Intergenic
915322130 1:155061947-155061969 GCTTCTCACCACCGGGTCAGCGG - Exonic
915781688 1:158558898-158558920 ACTGGCCACAACCAGCTCAGTGG + Intergenic
916242647 1:162655583-162655605 GCTGGTCACAACCAAATCAACGG - Intronic
916327794 1:163582514-163582536 GCTGATCACCATCAGTTGAGGGG - Intergenic
916870513 1:168909663-168909685 ACTGGTGACAACCAGCTCAGTGG + Intergenic
917669070 1:177255776-177255798 TCTGGGCACCTCCAGCTGAGGGG + Intronic
919812065 1:201414972-201414994 GCTGGTCACCACCTACTCTAGGG + Intronic
922103013 1:222489580-222489602 GCTGCTCACCTCCAGCTCTGTGG + Intergenic
922263334 1:223962068-223962090 GCTGCTCACCTCCAGCTCTGTGG + Intergenic
922776104 1:228214865-228214887 GCTGGTCCCCACCACCCCATGGG + Exonic
924345174 1:243067082-243067104 GCTGCTCACCTCCAGCTCTGTGG + Intergenic
924941646 1:248816387-248816409 GCTGGTCGGAACCAGCTCTGTGG - Intronic
1065992132 10:31022128-31022150 ACTGGCAACGACCAGCTCAGTGG + Intronic
1066731162 10:38437727-38437749 GCTGCTCACCTCCAGCTCTGTGG - Intergenic
1067615370 10:47756674-47756696 GCTGACCACCACCACCTCACTGG + Intergenic
1067659947 10:48227349-48227371 TCTGGTCTCCACCAGCTGGGTGG + Intronic
1067771797 10:49131855-49131877 GCTGGTCACCACCAACTACGGGG - Exonic
1068334847 10:55621464-55621486 GCAGGTCACCACCTGCTGTGAGG - Intronic
1071630772 10:87216625-87216647 GCTGACCACCACCACCTCACTGG + Intergenic
1072042317 10:91619825-91619847 ACTGGTGATGACCAGCTCAGTGG - Intergenic
1075270737 10:121047934-121047956 GATGATGACCACCAGCTCTGGGG + Intergenic
1075741503 10:124698978-124699000 GCCAGTCACTACCATCTCAGGGG + Intronic
1076134402 10:128035773-128035795 GCTGGGCAACTCCTGCTCAGAGG + Intronic
1076971778 11:138947-138969 GCTGCTCACCTCCAGCTCTGTGG + Intergenic
1077048664 11:556973-556995 TCTGAACACCAGCAGCTCAGGGG - Exonic
1077144813 11:1040117-1040139 GCTGGTCCCCATCAGATCAAAGG + Intergenic
1077267779 11:1660710-1660732 GCGGGTCACCACAGGCGCAGAGG + Intergenic
1077994854 11:7444343-7444365 GTCGGTCACGACCAGCACAGAGG - Intronic
1078244032 11:9556926-9556948 ACTGGTGACGACCAGCTTAGTGG + Intergenic
1081252745 11:40855719-40855741 GGTGGCCACCACCAACTCACAGG - Intronic
1081508905 11:43747961-43747983 GCTGGTCCCCAACAGTTCTGGGG + Intronic
1082700897 11:56429195-56429217 ACTGGTGACAACCAGCTCAGTGG + Intergenic
1084271061 11:68029492-68029514 GCTGGTCAGCAGGTGCTCAGAGG - Intergenic
1084474644 11:69381781-69381803 TGTGGTCACCACAAGCCCAGCGG - Intergenic
1085260866 11:75203954-75203976 GCTGGTCACTTTCAGCTCTGAGG + Intronic
1085460080 11:76688318-76688340 GCTGCTCACCACCTGCTCACAGG - Intergenic
1088096519 11:106106894-106106916 ACTGGTGATGACCAGCTCAGTGG - Intergenic
1088231578 11:107678512-107678534 CCTGGTCAGCGCCAGCCCAGGGG - Intergenic
1088356232 11:108946622-108946644 ACCGGTGACAACCAGCTCAGTGG - Intergenic
1090832313 11:130428155-130428177 CGTGGGCACCACCAGCTCCGAGG + Exonic
1095394009 12:41742384-41742406 GCTGGTCACCTCCTGCTGTGTGG + Intergenic
1096227860 12:49880961-49880983 GCTGGTCCCTGCCAGCTCTGAGG + Intronic
1096262637 12:50102737-50102759 GCTGGCCAGCAACAGCCCAGGGG + Intergenic
1099761390 12:86924308-86924330 AGTGGTTACCACCAGCACAGTGG + Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1101246360 12:102887510-102887532 ACTTGTCACCACCAGCTCCGTGG - Intronic
1102021230 12:109684475-109684497 GCTGGGCCCCACCAGGTCAGTGG + Intergenic
1103705480 12:122868985-122869007 GCTGGCCTCCACCACCACAGAGG + Intronic
1106794322 13:33188766-33188788 TCTGGTCAGTACCTGCTCAGAGG - Intronic
1107338398 13:39380390-39380412 GCTGCTCACCTCCTGCTCTGTGG - Intronic
1111822503 13:93229815-93229837 GCAGGTCACCACAGGGTCAGAGG + Intronic
1113478686 13:110604346-110604368 ACTGGCAACAACCAGCTCAGTGG - Intergenic
1113803014 13:113096239-113096261 CCTGGCCACGACCAGCTCCGGGG - Intronic
1113806943 13:113115501-113115523 GCTTGGCACCACCTGCTCCGTGG - Intronic
1113902182 13:113803581-113803603 TCAGGCCACCGCCAGCTCAGAGG + Intronic
1114636466 14:24189844-24189866 GCTGTGCACCATCAGCACAGTGG + Intronic
1115879847 14:37903239-37903261 TCTGGTCACCACCAGTTCAAAGG - Intronic
1116135299 14:40915482-40915504 TCTGGACACAAGCAGCTCAGGGG - Intergenic
1116821804 14:49634289-49634311 GATGGTGATCACCAGCTCATGGG + Exonic
1117164122 14:53017031-53017053 TCTGGGCCCCACTAGCTCAGGGG + Intergenic
1117787605 14:59303361-59303383 TCTGGTTACCACCACCCCAGTGG + Intronic
1120191429 14:81443579-81443601 GCTGCTCACCTCCTGCTGAGTGG - Intergenic
1122183935 14:99975041-99975063 CCTTGCCACCACCAGCTCCGTGG + Intronic
1123976065 15:25555751-25555773 GCGGGCCACCACCTGCTCTGTGG + Intergenic
1124381861 15:29173643-29173665 GATGGTCACCAGCACCTCGGAGG + Intronic
1124459868 15:29879344-29879366 GGTGGTGAAAACCAGCTCAGGGG - Intronic
1124725557 15:32153073-32153095 GCTGGACACCACAACCCCAGAGG - Intronic
1125441658 15:39709886-39709908 GCTGCTCACCACCTGCTGAGCGG + Intronic
1126887156 15:53163282-53163304 GCTGGTGACCATCAGTACAGAGG + Intergenic
1127769519 15:62219674-62219696 GCTGGTGAAGACCAGCTCAGTGG + Intergenic
1129470296 15:75750030-75750052 CCTGGGCACCCCCAGCCCAGAGG + Intergenic
1129844615 15:78762535-78762557 GCTGGACACCACCACCACAGGGG + Exonic
1131432336 15:92396705-92396727 GCTGGTCTCAATCACCTCAGGGG + Intronic
1133145447 16:3782273-3782295 GCTGGTCACTTCCAACTGAGGGG + Intronic
1135503655 16:23018051-23018073 TCTGGACACCAGAAGCTCAGAGG - Intergenic
1135981099 16:27148058-27148080 GCTGGCCAACAACAGCTCTGGGG + Intergenic
1136567888 16:31080822-31080844 GCTGGTGACTGCCAGCTCAATGG + Exonic
1139947225 16:70649658-70649680 GCTTGTCACCCCCAGCCCCGGGG - Intronic
1140189159 16:72800100-72800122 GCTTGGCATCACCATCTCAGGGG + Exonic
1142448469 16:90158575-90158597 GCTGCTCACCTCCAGCTCTGTGG - Intergenic
1142459016 17:76714-76736 GCTGCTCACCTCCAGCTCTGTGG + Intergenic
1142560798 17:807775-807797 GCTCGTCAGGACCAGCTGAGGGG - Intronic
1142591378 17:1007540-1007562 GCAGTTCACCATCAGTTCAGGGG - Intronic
1143279507 17:5742017-5742039 GCTGCTCACCTCCAGCTGTGTGG + Intergenic
1145191679 17:20846484-20846506 GCAGGTCACCACCTGCTGTGAGG - Intronic
1147157009 17:38549080-38549102 GCTGGTGACCACCACCTCTCCGG + Exonic
1147995491 17:44358087-44358109 GCTGGTCTCACTCAGCTCAGGGG + Intronic
1150220039 17:63491048-63491070 GCAGGTCCGCACCAGCCCAGGGG + Exonic
1150424126 17:65063745-65063767 GCTGGTCAACAGCAGCCCATAGG - Intergenic
1151154850 17:72117346-72117368 GCTGGACAGCAACAGCTAAGGGG - Intergenic
1152456924 17:80422028-80422050 GCAGGTCGCCACCACCACAGTGG + Intronic
1160648735 19:209227-209249 GCTGCTCACCTCCAGCTCTGTGG + Intergenic
1166669985 19:44703965-44703987 GCCGGACACCACCTGCTCTGAGG - Intronic
1166753869 19:45178920-45178942 GCTGGTCCCGAGCAGCTCACGGG + Intronic
1167998177 19:53423572-53423594 GATGTTCACCACCAGCTGACTGG - Intronic
1168007654 19:53504166-53504188 GATGTTCACCACCAGCTGACTGG - Intergenic
1168315754 19:55484138-55484160 GCTGCTGTCCAGCAGCTCAGTGG - Exonic
1168516226 19:57012332-57012354 GCTGGTCAGCAGCAGATCTGGGG + Intergenic
925154857 2:1640971-1640993 GCTGGGCCACACCTGCTCAGCGG + Intronic
925200169 2:1960810-1960832 GCATGTCACCTGCAGCTCAGAGG + Intronic
926291272 2:11532736-11532758 GCTTGTCCCCACTAGCGCAGTGG + Intergenic
926905168 2:17798869-17798891 GCTGGTGACAACCAGCTTGGGGG - Intronic
927198523 2:20564376-20564398 GCTGGTCACCAGCAGCCCTGAGG - Intronic
927914847 2:26929034-26929056 GCTGCTCACCTCCTGCTCTGCGG - Intronic
928117472 2:28557031-28557053 TGTGGTCACCACCTACTCAGGGG + Intronic
929862459 2:45691367-45691389 GCTGGTGTCCACCAGCTTGGTGG - Intronic
931430824 2:62207775-62207797 ACTGCTCACCACCAGCTGTGTGG + Intronic
934138749 2:89023561-89023583 GCAGGTTCCCACCAGATCAGTGG - Intergenic
934230497 2:90176999-90177021 GCAGGTTCCCACCAGATCAGTGG + Intergenic
936151497 2:110024482-110024504 ACTGTTCCCCACCACCTCAGAGG - Intergenic
936193177 2:110346887-110346909 ACTGTTCCCCACCACCTCAGAGG + Intergenic
936937038 2:117848539-117848561 CCTGGTCACCACCAGGTCGCGGG - Intergenic
942053935 2:172165120-172165142 GCTGCCCACCCCCAGCCCAGAGG - Intergenic
942307573 2:174624171-174624193 GTTGGTGACCACCTGCCCAGAGG - Intronic
942345529 2:174998620-174998642 GCATGTCACCAGCTGCTCAGTGG - Intronic
943223850 2:185144376-185144398 GCTGGCTCCTACCAGCTCAGTGG - Intergenic
944550872 2:200843783-200843805 ACTGGCAACAACCAGCTCAGTGG - Intergenic
946405582 2:219490372-219490394 GAGGGACACCACCGGCTCAGAGG - Intronic
948144485 2:235698289-235698311 GCTGCTCACCTCCAGCTGTGTGG + Intronic
948518666 2:238522217-238522239 GCATGCCACCACCTGCTCAGGGG + Intergenic
1168738478 20:166612-166634 GCTGCTCACCTCCTGCTCTGTGG - Intergenic
1170476015 20:16715209-16715231 GATGGTCAGCTCCAGCACAGCGG + Intergenic
1171285892 20:23937926-23937948 CCTGGCCCCCACCAGCTCTGGGG - Intergenic
1172605330 20:36209930-36209952 GCTGGGCACCGCATGCTCAGAGG + Intronic
1172623401 20:36334092-36334114 GCTGGGCACCAGAAGCACAGCGG + Intronic
1174373616 20:50111399-50111421 GCTGGCTACCACCAGCACACTGG + Intronic
1174400118 20:50271441-50271463 CATTGTCACCCCCAGCTCAGTGG - Intergenic
1175890152 20:62312391-62312413 GCTGCTCACCAGCAGGTCGGCGG + Exonic
1175908571 20:62393854-62393876 ACTGCTGACCACCAGCACAGAGG + Intronic
1176145187 20:63562318-63562340 GCTGGTCACCAGCATCGCACTGG - Exonic
1176146397 20:63567407-63567429 GGTGGTCACCACCACCTCCCAGG - Exonic
1176172404 20:63701884-63701906 GCTGGTCACCACCTTCTCTGGGG + Exonic
1177987299 21:27992564-27992586 ACTGGTGATGACCAGCTCAGTGG - Intergenic
1179596093 21:42444069-42444091 GCTTGTCCCTGCCAGCTCAGGGG - Intronic
1180352919 22:11818870-11818892 GCAGCTCACCCCCAGCTCTGGGG + Intergenic
1180385321 22:12173487-12173509 GCAGCTCACCCCCAGCTCTGGGG - Intergenic
1181468338 22:23122745-23122767 GCTGGGCACCTCCAGCTCCGAGG - Intronic
1184498515 22:44857942-44857964 GCAGGTCACCCTCAGCTCTGTGG - Intronic
949918786 3:8985539-8985561 GATGTTCCCCAACAGCTCAGCGG - Exonic
950526796 3:13529008-13529030 GCTGGTCACCACCATCACTTAGG + Intergenic
952877537 3:37959155-37959177 TCTGGTCACCACAGGCTTAGAGG - Intronic
954197267 3:49004176-49004198 GCTGTTCCGCACCAGCTCACTGG - Exonic
954387192 3:50250304-50250326 GCTGGTCAAAACAACCTCAGAGG - Intronic
954429102 3:50459784-50459806 GCTGCACCCCACCAGCTCACTGG + Intronic
956626792 3:71274441-71274463 GCTCGTCACCACCAGGAAAGGGG + Intronic
959033657 3:101334106-101334128 GCTGCTCACCTCCTGCTGAGTGG + Intronic
961658929 3:128458138-128458160 GGAGGTCACAGCCAGCTCAGAGG + Intergenic
961709674 3:128818387-128818409 GCTGGTCAGCACCAGGACAAGGG - Intergenic
962129208 3:132654656-132654678 GCTACCCACCACCAGGTCAGTGG + Intronic
962273604 3:133996113-133996135 GCTGTTCACCACCAGCCCCAAGG - Intronic
962286550 3:134091142-134091164 GCTGCTCACCACCTGCTCTGTGG + Intronic
963326751 3:143871623-143871645 TCTGGTCAGCACCAGCTGAGTGG + Intergenic
964741404 3:159970122-159970144 GCTGGTCTGCCTCAGCTCAGTGG - Intergenic
967188509 3:186965602-186965624 ACTGGTAATCACCAGCTCAGTGG - Intronic
968369115 3:198210888-198210910 GCTGCTCACCTCCAGCTCTGTGG - Intergenic
968509195 4:987935-987957 GCTTGTCACCACCAGGTGGGCGG + Exonic
968516046 4:1016091-1016113 ACCGGGCACCACCAGGTCAGGGG - Intronic
968627006 4:1630264-1630286 CCTGGTCACGGGCAGCTCAGAGG - Intronic
968725694 4:2246855-2246877 CGTGGTCACCACCAGCACAAGGG + Intergenic
969185022 4:5468459-5468481 CCTGGTCAGCATCAGCCCAGTGG + Intronic
969586704 4:8098031-8098053 GCTGGTCACCACCAGCTCAGAGG + Intronic
969685609 4:8672340-8672362 GGTGGGCACCACCAGGTAAGGGG + Intergenic
970696801 4:18687397-18687419 GTTGGTCACCACCATCCCACAGG - Intergenic
971426520 4:26521267-26521289 TCTGGTCAGCATCAACTCAGAGG + Intergenic
972373656 4:38449997-38450019 GCTGGTGACCAGCAGAGCAGAGG - Intergenic
972562819 4:40243712-40243734 GGTGGCCACCACCAGCACAGGGG - Exonic
974553883 4:63418382-63418404 GCTGCTCACCACCTGCTGTGTGG + Intergenic
974616393 4:64288602-64288624 ACTGGTGATGACCAGCTCAGTGG + Intronic
976705502 4:88015220-88015242 GCTGCTCACCTCCTGCTCTGCGG - Intronic
979257541 4:118620597-118620619 GCTGCTCACCTCCAGCTCTGTGG - Intergenic
979330809 4:119419950-119419972 GCTGCTCACCTCCAGCTCTGTGG + Intergenic
981039129 4:140205988-140206010 TCTGGACACCACAATCTCAGAGG + Intergenic
981575708 4:146202909-146202931 GCTGGTCACCCACAGGCCAGAGG + Intergenic
986889040 5:12277597-12277619 TCTGTTCACCTCCATCTCAGGGG - Intergenic
987788776 5:22536718-22536740 GCTGTTCACCACTAGTTTAGGGG - Intronic
987875296 5:23674361-23674383 CCTGGCCCCCACCAGCTCCGTGG - Intergenic
988558117 5:32255888-32255910 CCTGTTCAGAACCAGCTCAGAGG + Intronic
991602291 5:68365673-68365695 GTTGGTCCCTTCCAGCTCAGGGG + Intergenic
991941902 5:71861528-71861550 GCTGGGCAGCAGCAGCTCTGTGG + Intergenic
992025286 5:72663746-72663768 GGTGGCCACCACCAGCTCGGGGG - Intergenic
992307280 5:75454933-75454955 ACTGGTGACGACCAGCTCAGTGG + Intronic
993211703 5:84961145-84961167 GCTGGTCACCTCCTGCTGTGTGG + Intergenic
994669009 5:102744058-102744080 GCTGCTCACCTCCTGCTGAGTGG - Intergenic
995896041 5:117011988-117012010 ACTGGTGACAACCAGCTCAGTGG + Intergenic
998279909 5:140796223-140796245 TGCGGTCACCACCAGCTCATAGG - Exonic
998281114 5:140808446-140808468 CGCGGTCACCACCAGCTCATAGG - Exonic
998285559 5:140857304-140857326 CGCGGTCACCACCAGCTCATAGG - Exonic
999902147 5:156096138-156096160 GCTAGCCACCAGCAGCTCAGGGG + Intronic
1000263467 5:159612457-159612479 ACTGGTGTCAACCAGCTCAGTGG - Intergenic
1000353757 5:160373495-160373517 CCAGGTCACCACCAGCAAAGTGG - Intergenic
1002728391 5:181316473-181316495 GCTGCTCACCTCCAGCTCTGTGG - Intergenic
1003344429 6:5253947-5253969 ACTGGTGATGACCAGCTCAGTGG + Intronic
1003429510 6:6026058-6026080 GCTGCTCACCTCCAGCTCACTGG - Intergenic
1004101164 6:12613245-12613267 ACAGGTCACCAACAGCCCAGTGG - Intergenic
1004385630 6:15170392-15170414 GCTGTACAGCCCCAGCTCAGAGG + Intergenic
1004413724 6:15405420-15405442 GCTAGTCACCATCAGCTGACGGG - Intronic
1004655772 6:17658808-17658830 ACCGGTTACGACCAGCTCAGTGG + Intronic
1007508378 6:42356056-42356078 CCAGGTCACCTCCAGCTCTGTGG + Intronic
1008036325 6:46749172-46749194 GCTGGTCACCACCTACACAATGG + Intronic
1010805739 6:80234146-80234168 GCTGCTCACCTCCTGCTGAGTGG + Intronic
1012386458 6:98688942-98688964 GCTGTTCACCACCATCTCACAGG + Intergenic
1016222090 6:141686638-141686660 ACGGGCGACCACCAGCTCAGTGG - Intergenic
1017713575 6:157191219-157191241 GCCGGACACCAGCAGCACAGAGG + Intronic
1019048335 6:169164733-169164755 GCTGCTCACCCCCTGCTCTGGGG + Intergenic
1020713188 7:11635109-11635131 GCTGTTCACCAGAAGCGCAGAGG + Intronic
1021201129 7:17729545-17729567 TTTGGTCTCCACCATCTCAGGGG + Intergenic
1021456137 7:20831349-20831371 GCTGGTGACCACCATCTGAAGGG - Intergenic
1022226550 7:28369430-28369452 GCTGGACACTGACAGCTCAGGGG - Intronic
1023399525 7:39781872-39781894 GCTGCTCACCTCCAGCTCTGTGG - Intergenic
1023607022 7:41940435-41940457 TCTGATCTCCAGCAGCTCAGAGG - Intergenic
1023830760 7:44037869-44037891 CCTGTTCTCAACCAGCTCAGGGG - Intergenic
1023930466 7:44702278-44702300 GCAGCTCACCACTGGCTCAGAGG + Intronic
1024072463 7:45797661-45797683 GCTGCTCACCTCCAGCTCTGTGG - Intergenic
1024799867 7:53064459-53064481 GCTGGTTCACACCAGCTCAGAGG - Intergenic
1025093010 7:56078494-56078516 CCGGGTCACCACCAGGTAAGGGG + Intronic
1026045054 7:66901429-66901451 GCTGCTCACCACCAGCTCTGTGG - Intergenic
1026398984 7:69989785-69989807 GCTGCTCACCTCCTGCTCTGTGG - Intronic
1027687502 7:81295394-81295416 CCTGGTCTCCACCAGCTTTGTGG + Intergenic
1028484338 7:91341632-91341654 GCTGGTTATCACATGCTCAGTGG + Intergenic
1029741096 7:102492185-102492207 CCTGTTCTCAACCAGCTCAGGGG - Intronic
1029759088 7:102591355-102591377 CCTGTTCTCAACCAGCTCAGGGG - Intronic
1030069979 7:105689884-105689906 CTTGGCCCCCACCAGCTCAGTGG + Intronic
1031906612 7:127466862-127466884 GCTGGTCACCATCACCTTGGGGG - Intergenic
1032049855 7:128641366-128641388 GCTGCTCACCTCCAGCTCTGTGG - Intergenic
1032218736 7:129977937-129977959 GCTGGTCCCCACCATCTCTCTGG - Intergenic
1032491157 7:132325624-132325646 GCTGGCCACTACCAGCACAAAGG + Intronic
1032645247 7:133816860-133816882 GCTGCTCACCACCTGCTGTGCGG + Intronic
1032988810 7:137367666-137367688 GCTGCTCACCTCCTGCTCTGCGG - Intergenic
1033074542 7:138236219-138236241 GATGGTGACCACCATCTGAGTGG + Intergenic
1034265946 7:149780692-149780714 GGGGGTCACCTCCAGCTCAGGGG + Intergenic
1035011028 7:155714955-155714977 GCGGGTCACCACCAGGCCACTGG + Intronic
1035162024 7:156958238-156958260 GCTGGACAAGACCAGCTCAGGGG - Intronic
1038902428 8:31858539-31858561 ACTGGTGATGACCAGCTCAGTGG + Intronic
1039297445 8:36171734-36171756 CCTGGTCCCCACCAGCTTTGAGG + Intergenic
1040697318 8:50016198-50016220 ACTGGTGACTACCAGCTCAGTGG - Intronic
1045778751 8:105838697-105838719 GGTGGTCACAACGTGCTCAGTGG + Intergenic
1049103509 8:140596912-140596934 CCTGGTGCCCACCAGCCCAGGGG + Intronic
1049802420 8:144524152-144524174 GCTGGGCACCATCAGCCGAGAGG - Exonic
1050993812 9:12187645-12187667 TTTGGCCACCAACAGCTCAGGGG + Intergenic
1053093987 9:35308115-35308137 ACTGGCCACCAGCTGCTCAGAGG - Intronic
1056069100 9:82967485-82967507 GCTGGCCACCACCATCTGATTGG + Intergenic
1057792775 9:98135022-98135044 GCTGGTCACTGCCAGATCTGTGG - Intronic
1059535417 9:115075984-115076006 TCTGCCCAGCACCAGCTCAGTGG + Intronic
1061420944 9:130472561-130472583 GCTGGTGCCCTCCAGCTCTGTGG + Intronic
1061862085 9:133473313-133473335 GGGGGTCTCCAGCAGCTCAGCGG - Intronic
1062753456 9:138273572-138273594 GCTGCTCACCTCCAGCTCTGTGG - Intergenic
1203575967 Un_KI270745v1:8351-8373 GCTGCTCACCTCCAGCTCTGTGG - Intergenic
1187248933 X:17579711-17579733 GGTGGTCACCTGTAGCTCAGTGG + Intronic
1187526881 X:20062260-20062282 CCTGGCCACCAGCTGCTCAGTGG + Intronic
1187560982 X:20403454-20403476 GCTTGTCACCTTCAGCTCAATGG + Intergenic
1190325731 X:49205787-49205809 CCTGGGCAACACCACCTCAGCGG - Exonic
1191862080 X:65673956-65673978 TCATGTCACCACCAGCACAGAGG - Intronic
1192052586 X:67739638-67739660 TCTGGTCATCACCATTTCAGTGG + Intergenic
1194334946 X:92634002-92634024 ACCGGTGACCACCAGCTCAGTGG - Intergenic
1198317311 X:135481081-135481103 GCCAGCAACCACCAGCTCAGTGG - Intergenic
1198813943 X:140566836-140566858 GCTGGTCACCTCCTGCTGTGTGG + Intergenic
1200643423 Y:5751053-5751075 ACCGGTGACCACCAGCTCAGTGG - Intergenic