ID: 969588251

View in Genome Browser
Species Human (GRCh38)
Location 4:8106980-8107002
Sequence CAGGTTAAGGCAGCAGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 237}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969588251_969588264 12 Left 969588251 4:8106980-8107002 CCAACCACTGCTGCCTTAACCTG 0: 1
1: 0
2: 2
3: 17
4: 237
Right 969588264 4:8107015-8107037 CCTCAGGGGTCTCAGGGACAAGG 0: 1
1: 0
2: 3
3: 32
4: 276
969588251_969588259 5 Left 969588251 4:8106980-8107002 CCAACCACTGCTGCCTTAACCTG 0: 1
1: 0
2: 2
3: 17
4: 237
Right 969588259 4:8107008-8107030 ACCTTACCCTCAGGGGTCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 159
969588251_969588257 -3 Left 969588251 4:8106980-8107002 CCAACCACTGCTGCCTTAACCTG 0: 1
1: 0
2: 2
3: 17
4: 237
Right 969588257 4:8107000-8107022 CTGGCACGACCTTACCCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 76
969588251_969588256 -4 Left 969588251 4:8106980-8107002 CCAACCACTGCTGCCTTAACCTG 0: 1
1: 0
2: 2
3: 17
4: 237
Right 969588256 4:8106999-8107021 CCTGGCACGACCTTACCCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
969588251_969588258 -2 Left 969588251 4:8106980-8107002 CCAACCACTGCTGCCTTAACCTG 0: 1
1: 0
2: 2
3: 17
4: 237
Right 969588258 4:8107001-8107023 TGGCACGACCTTACCCTCAGGGG 0: 1
1: 0
2: 1
3: 1
4: 66
969588251_969588261 6 Left 969588251 4:8106980-8107002 CCAACCACTGCTGCCTTAACCTG 0: 1
1: 0
2: 2
3: 17
4: 237
Right 969588261 4:8107009-8107031 CCTTACCCTCAGGGGTCTCAGGG 0: 1
1: 0
2: 1
3: 24
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969588251 Original CRISPR CAGGTTAAGGCAGCAGTGGT TGG (reversed) Intronic
901209193 1:7515000-7515022 CAGGTGAAGGGAGCAGGGGAGGG - Intronic
902134839 1:14296241-14296263 CAGGCAAATGCTGCAGTGGTGGG + Intergenic
902707966 1:18219457-18219479 CAGGTGAAGGCAGAACAGGTGGG + Intronic
903670418 1:25032045-25032067 GAGGTCACGGGAGCAGTGGTGGG - Intergenic
903947223 1:26971530-26971552 CAGTTTAATGCTGCAGTGGAAGG + Intergenic
904734911 1:32624249-32624271 CAGGATAAGGTAAGAGTGGTTGG - Intronic
904991821 1:34599175-34599197 CAAGGAAAGGCAGGAGTGGTGGG - Intergenic
905062763 1:35153735-35153757 CAGCTGAAGGCAGTAGTAGTAGG + Intergenic
905172656 1:36118355-36118377 TAGGTTGAGGCAGCACAGGTGGG - Intronic
909819895 1:80049113-80049135 CAGGGTAGGGCAGCAGAGTTGGG - Intergenic
910607689 1:89104899-89104921 CAGGCGACGGCAGCAGTGGCTGG + Intergenic
910942768 1:92554908-92554930 CAGGTTGAGGCTGCAGTGAGTGG + Intronic
915164403 1:153940640-153940662 GGGGTTGAGGCAGCAGTGGGAGG + Intronic
917030326 1:170683290-170683312 GAGGATAGAGCAGCAGTGGTCGG + Intronic
917447020 1:175115116-175115138 CAGGGAAATACAGCAGTGGTTGG - Intronic
919299674 1:195744168-195744190 CACGTGAGGGAAGCAGTGGTGGG + Intergenic
921116986 1:212101081-212101103 CCCGGTAAGTCAGCAGTGGTGGG + Exonic
921584513 1:216931513-216931535 AAGGCTGAGGCAGCAGGGGTGGG - Intronic
921602402 1:217120583-217120605 CAGGATAAGGCAGGAGAGGTAGG - Intronic
922477565 1:225916972-225916994 AAGGTAAGGGCAGCAGTGCTCGG + Intronic
1064308389 10:14188833-14188855 GAGGTTAAGGCAGCAATGAGCGG + Intronic
1065599454 10:27354077-27354099 CAGATTAAGGCATCCGTGATTGG - Intergenic
1067247282 10:44557512-44557534 CCGGGAAAGGCAGCAGGGGTAGG - Intergenic
1067408904 10:46047676-46047698 CAGGTAAAGGCAGAAGTGTGTGG - Intergenic
1069960326 10:72075484-72075506 GAGGTTAAGGCAGCAGGGTTGGG - Intronic
1070560929 10:77566067-77566089 CAAGATCAGGCAGCAGTGATAGG + Intronic
1074558609 10:114515044-114515066 CAGGTCAATGCAGCAGGGGATGG + Intronic
1080583047 11:33658928-33658950 CAGGGCACAGCAGCAGTGGTGGG - Intronic
1080785232 11:35469392-35469414 CAGGTAGGGGCAGCAGTGGCTGG - Intronic
1082128490 11:48458596-48458618 GAAGTTAAGGCTGCAGTGATTGG - Intergenic
1082248920 11:49958825-49958847 GAAGTTAAGGCTGCAGTGATTGG + Intergenic
1082562037 11:54629518-54629540 GAAGTTAAGGCTGCAGTGATTGG - Intergenic
1083482663 11:62959689-62959711 CAGGTGGGGGCAGCAGGGGTTGG + Intronic
1083907889 11:65685940-65685962 CAGGTCCAGGCAATAGTGGTAGG - Intergenic
1083913716 11:65726489-65726511 CAGGTCCAGGCAATAGTGGTGGG - Intergenic
1085018584 11:73191075-73191097 CAGGGTAATGCAGGAGTGGCTGG + Intergenic
1085341544 11:75734691-75734713 CAGATAAAGGCAGCAGAGGATGG + Intergenic
1086232182 11:84583270-84583292 CAGGGAGAGGGAGCAGTGGTGGG - Intronic
1089209638 11:116791501-116791523 GAGGTTGAGGCAGCAGAGGCAGG + Intronic
1090059003 11:123447550-123447572 CAGGCTGAGGCAGCATGGGTTGG + Intergenic
1090077141 11:123586698-123586720 CAGGTCAAAGCAGCAGGGGCAGG - Intronic
1091994474 12:4982470-4982492 CAGGTGAGGGCTGCAATGGTGGG - Intergenic
1092611352 12:10176486-10176508 CAGGTGAAGGCTGGCGTGGTTGG + Intronic
1094139128 12:27162663-27162685 GAGGTTAAGGCTGCAGTGAGCGG - Intergenic
1094829583 12:34293957-34293979 GAGGTTGAGGCACCAGTGGAAGG - Intergenic
1094839871 12:34338365-34338387 TAGGTCAAGGCAGCGGTGGAAGG + Intergenic
1096760202 12:53835532-53835554 CAGGTCAAGGCTGCAGTGAGTGG - Intergenic
1096809771 12:54161855-54161877 CAGGCGGAGGCGGCAGTGGTAGG + Intergenic
1100773320 12:97948005-97948027 CAGCTGAAGGCAGCAGTAGAGGG + Intergenic
1101460628 12:104889158-104889180 TAGGTTCAGGCAACAGTAGTGGG - Exonic
1102036888 12:109775663-109775685 CAGGTAAGGGCAGGAGAGGTTGG - Intergenic
1102187898 12:110964258-110964280 CAGGTATATGCAGCATTGGTGGG - Intergenic
1102326850 12:111993106-111993128 CAGGTTAAGAGAGCAGTGGGGGG - Intronic
1104619776 12:130302263-130302285 CAGGATAAGGCAGATGTTGTGGG + Intergenic
1104664379 12:130637166-130637188 CAGGATGAGGCAGCAGAGGCAGG - Intronic
1110356520 13:74573873-74573895 CAGCCTAAGGCAGCCTTGGTGGG + Intergenic
1111748938 13:92303190-92303212 CAGGTAGGGGCAACAGTGGTTGG + Intronic
1112074093 13:95889761-95889783 CAGGTTAATGCAGGACTTGTGGG + Intronic
1113292645 13:108923422-108923444 CAGGTGAAGCCAGCACTGTTTGG + Intronic
1113937613 13:114002698-114002720 CAGGTTAAGGCAGCACTGAGTGG + Intronic
1114241697 14:20874198-20874220 GAGGATAAGGCTGCAGTGGAGGG - Intergenic
1117230633 14:53714073-53714095 CAGCTTAAGTAAACAGTGGTTGG + Intergenic
1117497429 14:56319546-56319568 CAGGTTAAGCCAGCTGTGGATGG - Intergenic
1119264237 14:73254712-73254734 CAGGGTCAGGCAGCAGGTGTGGG - Intronic
1119383985 14:74245826-74245848 CAGGTCAGGGCAGCAGTTGCTGG - Intronic
1121210648 14:92206080-92206102 CAGGGGAAGGAAGCAGTGGAAGG - Intergenic
1122314913 14:100820251-100820273 CGGTGGAAGGCAGCAGTGGTAGG + Intergenic
1122741606 14:103874862-103874884 CAGGTTAGGGCAGCAGAGAGTGG - Intergenic
1122768418 14:104086303-104086325 CCTGGTCAGGCAGCAGTGGTTGG + Intronic
1124433988 15:29632820-29632842 CAGGTAGAGGCAGCAGAGGGAGG - Intergenic
1126878531 15:53070162-53070184 CAGGTGAAGGAAGCACTGGGTGG + Intergenic
1127148176 15:56047416-56047438 AAGTTTAAGCCAGCAGAGGTTGG - Intergenic
1128307059 15:66605587-66605609 CAGGTGAAGGCAGAAGGGCTGGG - Intronic
1128569144 15:68720765-68720787 CAGAATAGGGCAGAAGTGGTGGG - Intronic
1129180231 15:73869622-73869644 CAGTAAAAGGCAGCTGTGGTGGG + Intergenic
1129245728 15:74277663-74277685 CATGTGCAGGCAGGAGTGGTGGG - Intronic
1130022889 15:80245770-80245792 CAGATTTGGGCAGCAGAGGTAGG - Intergenic
1130927492 15:88396463-88396485 CAGGCTAGGGCAGCAGAGGGAGG - Intergenic
1133737830 16:8629354-8629376 CATGTTAAGGGAGCAGAGGCTGG - Intronic
1133970286 16:10562854-10562876 CAGGGTCAGGCAGCAGTCATTGG - Intronic
1134240602 16:12503171-12503193 CAGCTCAGAGCAGCAGTGGTGGG - Intronic
1135591334 16:23706957-23706979 CAGGTTCAGCCAGCAGAGGCAGG - Intronic
1135992100 16:27224475-27224497 CAGCCTGAGGCAGCAGTGGCAGG + Intergenic
1136536503 16:30902741-30902763 GAGGTTGAGGCTGCAGTGCTGGG - Exonic
1138263606 16:55643696-55643718 CAGGTTGGGGCAGCAGTGAGGGG - Intergenic
1139255379 16:65536105-65536127 CAGGTGAAGACAGGAGTTGTGGG - Intergenic
1140047421 16:71451085-71451107 AAGGTTAATGCAGCAGTATTTGG - Intronic
1140053278 16:71501972-71501994 CAGGTCAAGGCTGCAGTGAGCGG - Intronic
1140055751 16:71524105-71524127 CAGGGTAAGGTAGCAGGAGTAGG + Intronic
1140947576 16:79784381-79784403 CAGGCTAAGGGAGCAGAAGTTGG - Intergenic
1141772612 16:86100130-86100152 CAGGTGAAGGCTGCAGTGAGTGG - Intergenic
1143806713 17:9434521-9434543 CAAATTAAGGCAGCAGAGGTGGG + Intronic
1144464715 17:15488176-15488198 CAGGCAGTGGCAGCAGTGGTAGG - Intronic
1147236995 17:39065470-39065492 GAGGTTGAGGCTGCAGTGGGGGG - Exonic
1148140381 17:45323807-45323829 GAGGTTGAGGCTGCAGAGGTTGG + Intergenic
1149299961 17:55296054-55296076 CAGGTTAATGCAAAATTGGTTGG + Intronic
1150470542 17:65433538-65433560 CAAGATAAGGCTGCAGTGGTTGG + Intergenic
1151382215 17:73733753-73733775 CAGTTTAAGGAAGCAGTGATGGG - Intergenic
1152863304 17:82708819-82708841 CAGGGCATGGCAGCAGTGGGTGG - Intergenic
1155591083 18:27428382-27428404 CAGGTGTCTGCAGCAGTGGTGGG - Intergenic
1160468912 18:79108661-79108683 CTGCTTAAGGGAGCAGTGCTTGG + Intronic
1162474621 19:10892526-10892548 CAGGTTACGGCAGGAGAGGGAGG + Intronic
1163128558 19:15257806-15257828 GAGGTTTAGGCAGCAGGTGTGGG + Intronic
1164838137 19:31371800-31371822 CAGGTGGTGGCAGGAGTGGTAGG + Intergenic
1165068108 19:33240669-33240691 CAGGTGAAGGCTGCAGGGGAGGG + Intergenic
1165756134 19:38294191-38294213 CAGGTTTAGGCAGGAGAAGTGGG - Intronic
1166699634 19:44874675-44874697 TAGGTGAAGGCAGCAGAGTTGGG + Intronic
1166916511 19:46199122-46199144 CAGGGTAGGGCAGCAGTTGGAGG + Intergenic
1168122216 19:54257821-54257843 CAGATTAAGACAGGAGTGGTTGG + Intronic
1168127007 19:54289836-54289858 CAGGTGAAGACAGGAGGGGTGGG + Intergenic
1168173444 19:54606624-54606646 CAGGTGAAGACAGGAGGGGTGGG - Intronic
1168209054 19:54875836-54875858 GAGGCTAAGGCAGTAGTAGTTGG - Intronic
1168509648 19:56964141-56964163 AAGGTTAAGGCTGCAGTTGGAGG + Intergenic
925244377 2:2367360-2367382 CAGTTTAGGGCAGCAGTAGGGGG - Intergenic
927519334 2:23689621-23689643 GAGGTGAAGGCAGCAGTGACTGG + Intronic
928593174 2:32837865-32837887 CAGGAAAAGGCAGCAGGGGCAGG + Intergenic
929847211 2:45542182-45542204 CAGGCTGAGGCAGCAGGGGCTGG + Intronic
931778965 2:65563764-65563786 CAGGTGATGGCAGCAGTGTGGGG + Intergenic
933388799 2:81645149-81645171 CAAGTTAATGCAGAAGTTGTTGG - Intergenic
937260784 2:120585841-120585863 CAGGTAATGGGAGCAGTGGCTGG + Intergenic
938149345 2:128868672-128868694 CAGGTGAAGGTAGAAGTGGGTGG - Intergenic
939959058 2:148550105-148550127 CAGTTAAAGCCAGCAGTGGTAGG + Intergenic
940291279 2:152079713-152079735 GAGGTTAAGGCCGCAATGGGCGG + Intronic
942168682 2:173267893-173267915 CAGCTTAGGGCAGAAATGGTGGG + Exonic
942732439 2:179075053-179075075 CAGGTGAGGGCAGGAGTGATGGG - Intergenic
944104891 2:196069095-196069117 GGGGTTAAGGCAGCAGTCCTGGG - Intergenic
946542081 2:220695764-220695786 TAAGTAAAGGAAGCAGTGGTGGG + Intergenic
947424208 2:229968536-229968558 AAGGTCAAGGCAGCAGTGAGTGG - Intronic
947537084 2:230946838-230946860 CAGGGCAAGGCAGCTGTGGCTGG + Intronic
947880922 2:233511006-233511028 CAAGTTAAGGGGGAAGTGGTTGG + Intronic
948547077 2:238740344-238740366 AAGGTTAATGCAGCCTTGGTTGG - Intergenic
948759803 2:240183577-240183599 CAGGATTAGACAGCAGAGGTGGG - Intergenic
948807367 2:240458869-240458891 TGGGTGAAGGCAGAAGTGGTCGG - Intronic
948819166 2:240529862-240529884 CAGGCTGGGGCAGCAGTGGGTGG + Intronic
1169699724 20:8432505-8432527 CATGTTAAAGCAGTAGTAGTTGG - Intronic
1170162010 20:13322871-13322893 CAGGTCAGGGCAGCGGGGGTGGG - Intergenic
1170593356 20:17787579-17787601 CAGGTTAAGGGAGCCTCGGTGGG - Intergenic
1172077733 20:32312173-32312195 GAGGTCAAGGCTGCAGTGATTGG - Intronic
1173069869 20:39753038-39753060 CAGGAAAAGCCAGCAGGGGTAGG - Intergenic
1173154984 20:40601101-40601123 CAGGTTAAGGCAGGGGAGGAGGG + Intergenic
1174892434 20:54410891-54410913 GAGGTTAAGGAAGGAGTGTTTGG - Intergenic
1175675525 20:60943409-60943431 CAGGGTAGGGCAGCGGTGGTAGG + Intergenic
1175801488 20:61803474-61803496 CATGTTAAGGTAGCTTTGGTCGG + Intronic
1178782880 21:35622821-35622843 CCAGCCAAGGCAGCAGTGGTTGG - Intronic
1182448880 22:30406498-30406520 AGGGATAAGGCAACAGTGGTCGG - Intronic
1182674878 22:32031178-32031200 GAGGTTGAGGCAGCAGTGAGTGG + Intergenic
1183337198 22:37256574-37256596 CAGGTGTAGGAAGCAGGGGTGGG - Intergenic
1184030910 22:41894096-41894118 CATGTTTAGCCAGCAGGGGTGGG - Intronic
1184261918 22:43322483-43322505 GATGTTAAGGAAGCAGTGGAAGG - Intronic
1185011378 22:48316537-48316559 CAGGTGCAGGCAGCTCTGGTTGG + Intergenic
1185214975 22:49593606-49593628 CAGGTGAAGGGTGCAGTGGCTGG - Intronic
1185297741 22:50062511-50062533 CAGGTTAAGGGAACAGCAGTAGG + Intronic
949698040 3:6721632-6721654 CAGGTGAAGGCAGCATTTCTGGG + Intergenic
950863798 3:16173249-16173271 GAAGTGAAGGCAGCAGTTGTAGG - Intergenic
953843451 3:46408018-46408040 CAGGATAAGGCAGCTGTCGGAGG + Intronic
954911512 3:54114554-54114576 CTGGGCCAGGCAGCAGTGGTGGG + Intergenic
955513564 3:59705403-59705425 CTGGTTAAGCCACCATTGGTGGG + Intergenic
956669104 3:71670037-71670059 CACGATAAGGCAGAAATGGTTGG - Intergenic
956728599 3:72176987-72177009 CAGGCAAAGCCAGCAGTTGTTGG + Intergenic
961554995 3:127691264-127691286 CAGGTTGGGCCGGCAGTGGTGGG - Exonic
964268875 3:154933280-154933302 TAAATAAAGGCAGCAGTGGTTGG + Intergenic
964641274 3:158912612-158912634 CAGGTCCAGGTAACAGTGGTGGG + Intergenic
968266270 3:197365883-197365905 CAGCTTAAGACAGCAGAGATGGG - Intergenic
968435684 4:587681-587703 CAGGGCAAGGCAGCAGGGATAGG - Intergenic
969210417 4:5683019-5683041 GATGTTATGGCAGCAGTGCTAGG + Intronic
969370013 4:6725309-6725331 CACGTGAAGGAAACAGTGGTCGG + Intergenic
969588251 4:8106980-8107002 CAGGTTAAGGCAGCAGTGGTTGG - Intronic
970172498 4:13303738-13303760 CAGGTTAAGTTAGGAGTGGCTGG - Intergenic
970274138 4:14379333-14379355 CAGCTTATGGCAGCATTGTTTGG + Intergenic
970567491 4:17346988-17347010 AAGGTGAAGGCAACACTGGTAGG + Intergenic
972987353 4:44780708-44780730 GAGGTTAAGGCTGCAGTGGGCGG - Intergenic
974450725 4:62054386-62054408 CTGCTTAAGCCAACAGTGGTAGG - Intronic
981303177 4:143213960-143213982 CAGATGAAGGCAGCTGTTGTTGG - Exonic
983517840 4:168675983-168676005 CAGGTCAAGGCAGAAGTAGCTGG + Intronic
987593528 5:19964576-19964598 GAGGTTGAGGCAGCAGTGAGTGG + Intronic
989272795 5:39552474-39552496 AATCTTAAGGTAGCAGTGGTGGG - Intergenic
991213816 5:64137714-64137736 CAGGTTAAGGGAGCCAGGGTAGG + Intergenic
993022267 5:82605754-82605776 CAAGTGAGGGCAGCAGTGGTAGG - Intergenic
994691590 5:103026328-103026350 CAGGTCAAGGCAGCCATGGCAGG + Intronic
998065914 5:139158539-139158561 CAGGTGGAGGGAGCAGGGGTGGG - Intronic
999223150 5:149998277-149998299 CAGATTATGGCAGAAGTGATGGG + Intronic
999542082 5:152584879-152584901 AAGGGTAAGGCAGCTGTGCTGGG + Intergenic
1000594869 5:163203113-163203135 CAGGTTAAAGAAGTAGTGGAGGG + Intergenic
1004872693 6:19923184-19923206 GAGGTTGAGGCTGCAGTGGGTGG - Intergenic
1005360277 6:25024552-25024574 CGGGCTCAGGCAGCAGTGGCAGG + Intronic
1005937844 6:30537450-30537472 CAGGTTGAGGCTGCAGTGAGTGG + Intergenic
1005961734 6:30698550-30698572 GAGGTCAAGGCTGCAGTGGGTGG - Intergenic
1006469386 6:34218294-34218316 GAGGTCAAGGCTGCAGTGGACGG + Intergenic
1006992909 6:38230660-38230682 CCGGTGAAGGAAGCAGAGGTTGG - Intronic
1008425359 6:51350043-51350065 CAGGCTAAGGAAACAATGGTCGG + Intergenic
1010854365 6:80819301-80819323 CAGGATAAGGCAGCAGACCTGGG + Intergenic
1013160144 6:107535383-107535405 CAGGTAAAGTCAGCAGTGGGAGG + Intronic
1015989280 6:138919510-138919532 CAGGGAAAGGTAGCAGTGGTAGG - Intronic
1016871631 6:148823540-148823562 CAGGATAAGGCAGCACCAGTAGG - Intronic
1017474057 6:154770498-154770520 GAGGTCAAGGCTGCAGTGATCGG + Intronic
1018444072 6:163839327-163839349 CAGGTTGAAGCAGCACTGGACGG - Intergenic
1018943858 6:168331221-168331243 CAGGTCAAAGCAGCAGGGATGGG - Intergenic
1020093161 7:5352677-5352699 CTGGGGAAGCCAGCAGTGGTGGG - Intronic
1021468246 7:20970102-20970124 CAGGTCTAGGCAGAAGTAGTGGG - Intergenic
1021926028 7:25534624-25534646 ATGGACAAGGCAGCAGTGGTGGG - Intergenic
1021974552 7:25999043-25999065 GAGGTTGAGGCTGCAGTGGGCGG - Intergenic
1022208906 7:28189283-28189305 CAGGGAAAGGCAGCAGGGGAGGG - Intergenic
1023354102 7:39349977-39349999 CAGATGAATGCAGCAGTGGAGGG + Intronic
1024213471 7:47227308-47227330 CAGGACAGGGCAGCAGTGGCAGG - Intergenic
1024270588 7:47638566-47638588 CAGGGTGAGGTAGCAGGGGTGGG - Intergenic
1026828461 7:73597587-73597609 GAGGGTAATGCAGCAGAGGTGGG + Exonic
1027208551 7:76124407-76124429 CACTTTGAGGCTGCAGTGGTGGG + Intergenic
1028437970 7:90827068-90827090 CAGGGACAGGCAGCAGGGGTGGG - Intronic
1028722846 7:94053058-94053080 CAGGTTAAGAAAGCAGAGATTGG + Intergenic
1029036079 7:97523418-97523440 CAGCTTAAGCCAGTATTGGTAGG - Intergenic
1029336989 7:99909545-99909567 AAGGTAATGGCAGAAGTGGTTGG - Exonic
1030632160 7:111907797-111907819 CAGGTTGAGGCTGCAGTGAGTGG - Intronic
1032059774 7:128714942-128714964 CAGGTTATGGAAGCAGTTGCAGG - Intronic
1032085675 7:128882266-128882288 CAGGCTAAGGAAGCCATGGTTGG - Intronic
1032703643 7:134403808-134403830 CAGGGTAAGGCAGCTGCTGTGGG + Intergenic
1033637211 7:143223082-143223104 GAGGCAAAGGCAGAAGTGGTTGG - Intergenic
1038055834 8:23856688-23856710 CAGGCTCAGGCAGCACTGGCTGG + Intergenic
1042721283 8:71829336-71829358 CAGGTTAAGGCAGAGGGAGTGGG + Intronic
1042834898 8:73070567-73070589 CAGGTGAAAGCAGAAGTGGGAGG + Intronic
1043289955 8:78586109-78586131 CAGGTTGAGGCAGAGATGGTAGG - Intronic
1043354474 8:79396104-79396126 GAGGTTAATGGAGTAGTGGTGGG + Intergenic
1044398176 8:91738575-91738597 CAGGTTCAGAAAGCAGTAGTAGG - Intergenic
1045049023 8:98306172-98306194 CAGGTTTAGGAAGCCGTGTTTGG - Intergenic
1045109511 8:98926895-98926917 AAGTTCCAGGCAGCAGTGGTGGG + Intronic
1045318413 8:101063100-101063122 CAGGTGAAGGCACCACGGGTGGG - Intergenic
1045337700 8:101223767-101223789 TAGGTTAAGGGAGCAGTGAAAGG + Intergenic
1045410667 8:101914380-101914402 AAGGTTAAATCAGCAGTGGCAGG - Intronic
1045683114 8:104683585-104683607 CAGGGTAGGGCAGTAGTAGTGGG + Intronic
1047793196 8:128226550-128226572 CAGAATAAGGCAGAAGTGATTGG + Intergenic
1049378826 8:142302022-142302044 CAAGTAAAGGTAGCAGTGGCCGG - Intronic
1049575343 8:143387210-143387232 GAGGTGAGGGCAGCAGTGATGGG - Intergenic
1052096934 9:24394744-24394766 CTGGTTGGTGCAGCAGTGGTTGG - Intergenic
1052219695 9:26004777-26004799 CAGGTTAACACAGCAGTGGTTGG + Intergenic
1053572847 9:39327808-39327830 CAGGTTAAGACAGCGGTGCCTGG + Intergenic
1054094410 9:60886517-60886539 CAGGTTAAGACAGCGGTGCCTGG + Intergenic
1054115880 9:61162429-61162451 CAGGTTAAGACAGCGGTGCCTGG + Intergenic
1054124297 9:61291203-61291225 CAGGTTAAGACAGCGGTGCCTGG - Intergenic
1054591875 9:67020115-67020137 CAGGTTAAGACAGCGGTGCCTGG - Intergenic
1055069919 9:72155584-72155606 CAGGATAAGGCAGGACAGGTAGG + Intronic
1056501606 9:87215180-87215202 GAGGTTTACGCAACAGTGGTTGG - Intergenic
1056679758 9:88706715-88706737 CAAGTTAACGCATCAGTTGTCGG + Intergenic
1058748197 9:108012693-108012715 CAGGTTAAGGAAGCAGATTTAGG - Intergenic
1060292619 9:122318405-122318427 CAGGGAAAGGCAGCAGTGAAAGG - Intronic
1060550673 9:124483592-124483614 TTGGTTATGGCAGCAATGGTTGG - Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061229630 9:129307354-129307376 GAGGTGAAGGAAGCAGAGGTTGG + Intergenic
1187308479 X:18118699-18118721 CAGGGCAAGCCAGCAGTGGTGGG + Intergenic
1187628397 X:21142035-21142057 CAGGTGAGGGCAGCAGTGGTTGG + Intergenic
1189706157 X:43760798-43760820 ATGGTTAAGGAAGAAGTGGTTGG + Intergenic
1190085700 X:47393629-47393651 GAGGTTAAGGCTGCAGTGAACGG - Intronic
1191744066 X:64466517-64466539 GAGGTTAAGGCTGCAGAGATTGG - Intergenic
1195447670 X:104972383-104972405 CAGGTTCAGGTAATAGTGGTGGG + Intronic
1197776024 X:130119263-130119285 CAAGTTAAGGCTGCAGAGATGGG - Intergenic
1200010227 X:153114813-153114835 CAGGTGAAGGGCGCAGTGGAAGG + Intergenic
1200029373 X:153285109-153285131 CAGGTGAAGGGCGCAGTGGAAGG - Intergenic
1200094182 X:153649631-153649653 CAGGTTCTGGCTCCAGTGGTCGG - Exonic
1201144272 Y:11054619-11054641 CAGGTAAAGGCAGCTGTGTTTGG + Intergenic