ID: 969590304

View in Genome Browser
Species Human (GRCh38)
Location 4:8118229-8118251
Sequence TTGCACACTGACTGCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969590293_969590304 30 Left 969590293 4:8118176-8118198 CCCTGAGCCCAGCACACAGCATG 0: 1
1: 0
2: 6
3: 61
4: 534
Right 969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG 0: 1
1: 0
2: 0
3: 17
4: 216
969590295_969590304 23 Left 969590295 4:8118183-8118205 CCCAGCACACAGCATGAGCTCAA 0: 1
1: 0
2: 28
3: 327
4: 1622
Right 969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG 0: 1
1: 0
2: 0
3: 17
4: 216
969590294_969590304 29 Left 969590294 4:8118177-8118199 CCTGAGCCCAGCACACAGCATGA 0: 1
1: 1
2: 10
3: 76
4: 521
Right 969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG 0: 1
1: 0
2: 0
3: 17
4: 216
969590301_969590304 -6 Left 969590301 4:8118212-8118234 CCAGGGCTTAGGGATCCTTGCAC 0: 1
1: 0
2: 3
3: 43
4: 342
Right 969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG 0: 1
1: 0
2: 0
3: 17
4: 216
969590296_969590304 22 Left 969590296 4:8118184-8118206 CCAGCACACAGCATGAGCTCAAC 0: 1
1: 1
2: 8
3: 90
4: 490
Right 969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG 0: 1
1: 0
2: 0
3: 17
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969590304 Original CRISPR TTGCACACTGACTGCCATCT GGG Intronic
900944024 1:5819555-5819577 TCACACACTGACTCGCATCTCGG - Intergenic
902986215 1:20155821-20155843 TTGCATACTGTCTTTCATCTGGG - Intergenic
904615782 1:31748828-31748850 GTGCACAGTGACTGGCATGTAGG - Intronic
905628475 1:39504776-39504798 TTGATCACTGTCTACCATCTCGG + Intronic
907426841 1:54385129-54385151 CTGCCCACTGCCTGCCATCAGGG - Intronic
908433612 1:64082909-64082931 TTGCACTTTGAATTCCATCTTGG + Intronic
914388508 1:147196127-147196149 TTTCACATTCTCTGCCATCTTGG + Intronic
915941267 1:160119975-160119997 TTGCACACTGCATTCCATCCTGG + Intronic
916067317 1:161146658-161146680 TTGATCACTGTCTGCCATTTAGG + Intergenic
921102165 1:211938009-211938031 TTGCAAATTGCCTGCTATCTTGG + Intergenic
921492519 1:215795652-215795674 TTGCACCCTCCCTGCCACCTTGG + Intronic
923895894 1:238269310-238269332 TTGCACACTGCCTTCTTTCTGGG - Intergenic
924263445 1:242255070-242255092 GGGCACCCTGACTTCCATCTGGG + Intronic
1066339784 10:34519925-34519947 ATCCACACTGGCTGCCACCTTGG + Intronic
1066721352 10:38343400-38343422 GGGCACCCTGACTTCCATCTGGG - Intergenic
1067477729 10:46577865-46577887 ACGCACACTGACTGCCCCCTAGG + Intergenic
1070914124 10:80141935-80141957 TCGCACACTGACCCCCACCTGGG + Intronic
1071792232 10:88966986-88967008 TGGCACACAGCCTGCCCTCTTGG - Intronic
1072155596 10:92720884-92720906 TTTCACACTGTCTGGCAGCTGGG + Intergenic
1073638239 10:105221247-105221269 TTGGACAGTGACTGCTATTTGGG - Intronic
1075137403 10:119796340-119796362 TAGCACAGTGCCTGCCATATGGG - Intronic
1075822811 10:125329181-125329203 TTGCAAACTCACTGCCTTCGGGG + Intergenic
1079607320 11:22386139-22386161 ATGCATACTCACTGTCATCTGGG - Intergenic
1081449413 11:43157640-43157662 TTGTACACTCTCTGCCATATTGG + Intergenic
1081450835 11:43169535-43169557 TTGTACACTCTCTGCCATATTGG + Intergenic
1083453235 11:62760804-62760826 TAGCACAGTGTCTGGCATCTAGG + Intergenic
1084261663 11:67983065-67983087 ATGCACACCCACTGCTATCTTGG - Intergenic
1084307574 11:68297071-68297093 TTGCACACAATCTGCCAACTTGG + Intergenic
1084810981 11:71611046-71611068 ATGCACACCCACTGCTATCTTGG + Intergenic
1085630248 11:78109441-78109463 CTGCACACTGATTGCCATATTGG - Exonic
1088235520 11:107718945-107718967 TTGCACACTTAGTGTCATCTTGG - Intronic
1088522704 11:110716333-110716355 TTGCAAACTGATGGCCATCTGGG + Intergenic
1089110248 11:116050077-116050099 TTGCACACTGAATGTCACCAGGG - Intergenic
1091290783 11:134438598-134438620 TGGCACACTGACTGCAAGCCTGG + Intergenic
1091585935 12:1816677-1816699 GTGCACACAGACTGTCACCTCGG + Intronic
1092964016 12:13624528-13624550 TTGCATATTCAGTGCCATCTAGG + Intronic
1097595338 12:61621541-61621563 TGGCACACTGACTGCCAAGGAGG + Intergenic
1098483688 12:70996239-70996261 TTGCAAACTGTCTGGCAGCTTGG - Intergenic
1099264951 12:80434054-80434076 TTGCACAGTGACAGTGATCTTGG + Intronic
1099375823 12:81895312-81895334 TTTGACACTGACTTCCAGCTGGG + Intergenic
1102282656 12:111630561-111630583 TTGCACACAGTCTACCATCGTGG + Intergenic
1102692250 12:114770519-114770541 GTGCATACCCACTGCCATCTGGG + Intergenic
1102925661 12:116824129-116824151 TTGGCCAGTGACTGCCATGTTGG - Intronic
1103832731 12:123793205-123793227 ATGCACACTGACTCCCTTCCTGG + Intronic
1104960871 12:132488277-132488299 TTGCAGTCTGACTGACCTCTGGG + Intergenic
1111823797 13:93244084-93244106 TTTCCCACTGACTCCCATCAGGG - Intronic
1112681381 13:101769552-101769574 TTGCCTACTGAAGGCCATCTTGG - Intronic
1113067340 13:106385663-106385685 TTGCACAATAAGTTCCATCTGGG - Intergenic
1114332642 14:21652609-21652631 TTGCTCACTGACTGAGACCTGGG + Intergenic
1116244258 14:42388487-42388509 TTACACACAGACTACAATCTAGG - Intergenic
1116524716 14:45890550-45890572 TTGCAAACTGACTGAGACCTAGG - Intergenic
1116986798 14:51228565-51228587 CTGCATCCTGACTGACATCTTGG + Intergenic
1118720116 14:68587892-68587914 ATGCACCATGTCTGCCATCTGGG - Intronic
1119268636 14:73281122-73281144 TTGCACACTTAGTGCCTTGTAGG + Intronic
1124204814 15:27708004-27708026 CTGCACACTGAGTGCTGTCTTGG - Intergenic
1124585536 15:31002607-31002629 CTGCAAGGTGACTGCCATCTGGG + Exonic
1125368244 15:38942176-38942198 AGACACACTGACTGCCAGCTTGG + Intergenic
1127039145 15:54954105-54954127 TGCCACACTAACTGCCTTCTTGG + Intergenic
1127308398 15:57729918-57729940 TTGCACACTAATCTCCATCTCGG - Intronic
1128958336 15:71973186-71973208 TTCCACATTGACTACCTTCTTGG - Intronic
1131292070 15:91115031-91115053 TTCCTCACTACCTGCCATCTTGG - Intronic
1131962497 15:97804430-97804452 TTTCCCACTGGCTGCCAGCTGGG + Intergenic
1132179220 15:99739191-99739213 TTGGATACTGACGGCCATCTGGG - Intergenic
1133197296 16:4180272-4180294 TTGCCCTCTGACTGCCAGCTGGG + Intergenic
1135425144 16:22328790-22328812 TGGCTCACAGACTGGCATCTGGG - Intronic
1136179563 16:28541734-28541756 TTGCACACTGATTATCTTCTAGG - Intergenic
1137564502 16:49524775-49524797 ACGCACACCGGCTGCCATCTGGG + Intronic
1142441585 16:90101856-90101878 TTGCTCACAGACTGTCATGTGGG - Intergenic
1143292556 17:5842767-5842789 TTGCACACTCTCTGCGATATTGG + Intronic
1144957195 17:19024704-19024726 GTGCACAGTGACTGGCATATTGG + Intronic
1149802644 17:59584963-59584985 TTGCACACTTACAACTATCTCGG - Intronic
1149843847 17:59990529-59990551 TTGCACACTTACAACTATCTCGG + Intergenic
1150482847 17:65523936-65523958 TTTCACACAAACTGCCATCCTGG + Intergenic
1151661447 17:75521307-75521329 TGGCCCACTGACTGTCCTCTTGG + Intronic
1156283944 18:35672183-35672205 TTGCACACTTCCTGGAATCTAGG + Intronic
1163387578 19:17009205-17009227 TCGCTCACTGTCTGCCTTCTGGG - Intronic
1163549229 19:17956244-17956266 GTGAACACTGACTGACATCCAGG + Intronic
1164583651 19:29451287-29451309 TAGCACAGTGACTGGCATATAGG + Intergenic
1167684555 19:50948590-50948612 ATACACACTGAGTGCCAACTCGG - Intronic
1168309569 19:55453574-55453596 CTCCTCACTGCCTGCCATCTTGG + Intronic
1168496753 19:56858936-56858958 TAGCAAACTGACTGCCAAATGGG + Intergenic
924964086 2:59460-59482 TTGCAAACTCACTTCCACCTAGG + Intergenic
925115344 2:1373906-1373928 CTTCACAATGACTTCCATCTGGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925611906 2:5708424-5708446 TTGCACTCAGAGTGCCAGCTTGG + Intergenic
927071078 2:19529922-19529944 TTTGACTCTGTCTGCCATCTGGG - Intergenic
931075770 2:58709960-58709982 TTGGACACTGACTGTCTTCTTGG + Intergenic
931095128 2:58931065-58931087 TTGCACATTGAATCTCATCTTGG + Intergenic
933072922 2:77884309-77884331 TTACACACTGTCTGACATCTTGG + Intergenic
933457094 2:82530160-82530182 TTGTACACTGTCTGCGATTTGGG - Intergenic
933771221 2:85745540-85745562 TTGCTCACTGTCTGCCCTCCCGG + Intergenic
935430557 2:102971433-102971455 TTGCACTCTGCCTCCCTTCTAGG + Intergenic
938265596 2:129925912-129925934 TCGCACACTGACCCCCACCTGGG - Intergenic
938688339 2:133762796-133762818 TTCCACACTGATTGACATCTGGG - Intergenic
939006570 2:136795174-136795196 TAGCACACTGAGAGCCATTTTGG - Intronic
939244053 2:139599910-139599932 TTGCACACCTAATTCCATCTAGG + Intergenic
940988407 2:160072876-160072898 TTGCCCACTGAATTCCAGCTGGG - Intergenic
941995661 2:171599834-171599856 TTGCACATTTAATTCCATCTTGG + Intergenic
942752745 2:179306386-179306408 CTGCACCCAGACTGCAATCTAGG + Intergenic
944326841 2:198415779-198415801 ATTCACACTGATTGCCATTTTGG + Intronic
945561469 2:211345950-211345972 GTCCACACAGACTGCCATCATGG + Intergenic
945580990 2:211594069-211594091 TTGCACACTAAATTCCATCGAGG + Intronic
946276558 2:218636030-218636052 TTCCACACTGCCTCCCATGTGGG - Intronic
948277104 2:236717280-236717302 TTGCACAGTACCTGACATCTTGG - Intergenic
1170537514 20:17355998-17356020 TTGCACATTTAATCCCATCTTGG + Intronic
1173503043 20:43567214-43567236 TTCAAGACTGTCTGCCATCTGGG + Intronic
1173737211 20:45370716-45370738 CTGTGCACTGACTGCCTTCTGGG - Intronic
1174521522 20:51134543-51134565 CTGCACACTGAGTGCCTTCACGG - Intergenic
1180831349 22:18908113-18908135 ATGGACACTGCCTGCCTTCTGGG - Intronic
1181068509 22:20318253-20318275 ATGGACACTGCCTGCCTTCTGGG + Intronic
1181506354 22:23360843-23360865 TTGCACTCTGACTGTCCTATGGG - Intergenic
1182040120 22:27231698-27231720 TTGCAGACTGAGTCCCAGCTTGG - Intergenic
1184485864 22:44779067-44779089 TTGCACAGTGACTGACTTTTTGG + Intronic
1203281433 22_KI270734v1_random:133384-133406 ATGGACACTGCCTGCCTTCTGGG - Intergenic
949877650 3:8636776-8636798 TTGCACATCTAATGCCATCTTGG + Intronic
949882505 3:8672820-8672842 ATGCACACCCACTGCTATCTTGG + Intronic
950314238 3:11986483-11986505 TTGCACACTGAATTCTGTCTTGG + Intergenic
956753944 3:72367389-72367411 TGGAAGGCTGACTGCCATCTTGG + Intergenic
957076735 3:75608645-75608667 ATGCACACCCACTGCTATCTTGG - Intergenic
957582742 3:82095995-82096017 TTACACACTGACTGCAACCATGG - Intergenic
961686732 3:128638036-128638058 TTCCACAATGACTGAAATCTTGG + Exonic
962232835 3:133680960-133680982 TGGCACACTGCCTGACATATGGG + Intergenic
963039042 3:141055401-141055423 TTCCACACTGTCTGTCATCACGG - Intronic
968361844 3:198152836-198152858 TTGCTCACAGACTGTCATGTGGG - Intergenic
968833157 4:2943523-2943545 CTGCACACTGGCTGCCCTCCTGG - Intronic
969020188 4:4134940-4134962 ATGCACACCCACTGCTATCTTGG - Intergenic
969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG + Intronic
972661556 4:41121649-41121671 TTGCCCACTGGCTCCCATTTTGG + Intronic
975797341 4:78021683-78021705 TTGAACACTTACTGCAAGCTAGG - Intergenic
977184253 4:93916982-93917004 TATCCCACTGAATGCCATCTGGG - Intergenic
977254219 4:94722426-94722448 TTGCAAAAGGACTGCCAGCTGGG + Intergenic
978454529 4:108873444-108873466 TTGCACACTGACTTAGTTCTAGG - Intronic
981116586 4:140998040-140998062 TTGCACACTGACTTCAATTTAGG + Intronic
981279489 4:142940847-142940869 TTGCACACTGGCTGCTTTCCAGG + Intergenic
982349109 4:154395393-154395415 TGGCCCTCTGAATGCCATCTAGG + Intronic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
982541195 4:156673747-156673769 GTGTACACTGGCTGCCAGCTAGG - Intergenic
983987850 4:174081926-174081948 TTCCTCACTTTCTGCCATCTAGG + Intergenic
984312201 4:178076249-178076271 TTGAAGACTGTCTGGCATCTAGG - Intergenic
984675052 4:182537910-182537932 CTGCTCACTGACTGCTATTTTGG + Intronic
988082497 5:26431617-26431639 TTGCAGACATATTGCCATCTTGG - Intergenic
992116820 5:73546258-73546280 TTGCACACTCATTGCCTACTGGG - Intergenic
993967432 5:94374865-94374887 TTGCACCTTGAATTCCATCTTGG + Intronic
994724573 5:103419161-103419183 TGGCACAATGACTGGAATCTAGG - Intergenic
994781118 5:104091419-104091441 TTGCACAATTCCTGCCAACTAGG - Intergenic
996444744 5:123534092-123534114 TAGCACACTGCCTGACACCTAGG - Intronic
997001332 5:129765775-129765797 ATGCACACTGACTGCCACCAGGG - Exonic
998950180 5:147385840-147385862 TTGCCAGCTTACTGCCATCTTGG - Exonic
999550771 5:152684982-152685004 TTGCCCCTTGACTGCCACCTTGG + Intergenic
1000535069 5:162469574-162469596 GTGCATACTGATTGTCATCTGGG + Intergenic
1001532996 5:172477862-172477884 TTGCACATTGAATCCTATCTTGG + Intergenic
1002469335 5:179426119-179426141 TTGCCCTCTGACTTCCAGCTGGG + Intergenic
1005350655 6:24931721-24931743 TTGCACACTTACTGTGAACTTGG + Intronic
1010607365 6:77907718-77907740 TTCCACACTGACTGCCACAATGG + Intronic
1011717752 6:90124788-90124810 TTGCACACTGGTTGACTTCTAGG - Intronic
1013462379 6:110387471-110387493 TGGAGCTCTGACTGCCATCTTGG + Intergenic
1014097148 6:117472853-117472875 TCTCACATTGACTGCCTTCTTGG + Intronic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1016628559 6:146200668-146200690 TTGCATACTTAATCCCATCTTGG - Intronic
1017169613 6:151444239-151444261 TTTTACACTTAATGCCATCTCGG + Intronic
1019253839 7:35890-35912 TTGCTCACAGACTGTCATGTGGG + Intergenic
1020307601 7:6846969-6846991 ATGCACACCCACTGCTATCTTGG - Intergenic
1021786768 7:24159990-24160012 TTGGACACTTACTGTGATCTTGG + Intergenic
1022642218 7:32198578-32198600 TAGCACTCTAGCTGCCATCTTGG - Intronic
1022650116 7:32266843-32266865 TTGCACATTTAATCCCATCTTGG - Intronic
1029078719 7:97955913-97955935 ATGCACACCCACTGCTATCTTGG - Intergenic
1029129485 7:98319139-98319161 TCGCACACTCACTGCCACATGGG + Intronic
1029599648 7:101556169-101556191 GTGAACACTGACTGCCACTTCGG + Intronic
1030302926 7:107992385-107992407 TAGCACAGTGACTGCCCTCCAGG - Intronic
1031199366 7:118660239-118660261 TTGAATAGTCACTGCCATCTTGG - Intergenic
1031263194 7:119549033-119549055 TTCCTCACTGACTGACATCCTGG + Intergenic
1034406536 7:150907191-150907213 TTGTCCACTGACAGACATCTAGG - Intergenic
1034818820 7:154198072-154198094 TTGCACATCTACAGCCATCTGGG - Intronic
1035559081 8:591576-591598 TTCCTCACTGACTGTCACCTGGG - Intergenic
1035594939 8:849535-849557 TTCCAAACTGACTGCCCTTTTGG + Intergenic
1039232872 8:35468114-35468136 TTACATTCTGAATGCCATCTTGG - Intronic
1040813587 8:51482937-51482959 GTGCTCTCTGACTGACATCTGGG + Intronic
1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG + Intergenic
1043633650 8:82366204-82366226 TTGCACACTTGCTGCAATATTGG - Intergenic
1045258794 8:100553097-100553119 TTGAACACTGACTGAGAGCTTGG + Intronic
1045686153 8:104714278-104714300 GTGCACTCTGTCTTCCATCTGGG + Intronic
1045830685 8:106457098-106457120 TGGCACACTGACTGGCACATTGG - Intronic
1048179219 8:132180050-132180072 TGGCAGAATGACTGCCTTCTGGG + Intronic
1048555281 8:135469844-135469866 ATGCACAGAGACTGCCATCAAGG + Intronic
1048757176 8:137752743-137752765 TGACACACTGTCTGCAATCTAGG - Intergenic
1049402412 8:142434339-142434361 CTGCACACAGACTGACATTTGGG - Intergenic
1051768304 9:20548222-20548244 TTGCCTAGTGACTGCCATATTGG + Intronic
1052956888 9:34259562-34259584 TTACACACAACCTGCCATCTGGG + Intronic
1055890306 9:81116936-81116958 TTCAACACAGCCTGCCATCTGGG - Intergenic
1057107534 9:92434046-92434068 TTGTATACTGACTTCAATCTTGG - Intronic
1057776890 9:98018680-98018702 TTCCACACTCACTGCAATCTTGG - Intergenic
1059002861 9:110368031-110368053 TTGCACACTGCATGCCAGCCTGG + Intronic
1060996277 9:127876350-127876372 TTCCATCCTCACTGCCATCTTGG + Intronic
1062746559 9:138216653-138216675 TTGCTCACAGACTGTCATGTGGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186219326 X:7332724-7332746 ACGCACAATGACTGCCATTTCGG + Intronic
1186759803 X:12711367-12711389 TTCCACATTGGCAGCCATCTTGG + Intronic
1187831187 X:23382735-23382757 TTGCACACTGATTGTCAGCAGGG - Intronic
1198805897 X:140494039-140494061 TTGCACACTCTCTGACATATAGG + Intergenic
1198954890 X:142118129-142118151 TTGAATTCTGACTGCTATCTTGG + Intergenic
1202152122 Y:21853004-21853026 TTGCACACGTACTGTCATTTTGG - Intergenic