ID: 969590761

View in Genome Browser
Species Human (GRCh38)
Location 4:8120636-8120658
Sequence CAGAGCACACAGATGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 390}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969590761_969590768 -9 Left 969590761 4:8120636-8120658 CCAGCCCCCATCTGTGTGCTCTG 0: 1
1: 0
2: 3
3: 45
4: 390
Right 969590768 4:8120650-8120672 TGTGCTCTGTCGTGGGAGCATGG No data
969590761_969590770 3 Left 969590761 4:8120636-8120658 CCAGCCCCCATCTGTGTGCTCTG 0: 1
1: 0
2: 3
3: 45
4: 390
Right 969590770 4:8120662-8120684 TGGGAGCATGGGAAACCAGCAGG 0: 1
1: 0
2: 4
3: 15
4: 223
969590761_969590769 -8 Left 969590761 4:8120636-8120658 CCAGCCCCCATCTGTGTGCTCTG 0: 1
1: 0
2: 3
3: 45
4: 390
Right 969590769 4:8120651-8120673 GTGCTCTGTCGTGGGAGCATGGG 0: 1
1: 0
2: 0
3: 9
4: 85
969590761_969590772 28 Left 969590761 4:8120636-8120658 CCAGCCCCCATCTGTGTGCTCTG 0: 1
1: 0
2: 3
3: 45
4: 390
Right 969590772 4:8120687-8120709 CACTTCTCAGCTTACAGTGCAGG 0: 1
1: 0
2: 1
3: 22
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969590761 Original CRISPR CAGAGCACACAGATGGGGGC TGG (reversed) Intronic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
900540817 1:3201819-3201841 CAGTGGACACAGAAGTGGGCGGG - Intronic
900618260 1:3575219-3575241 CAGCGCACACAGGTGGGACCCGG + Intronic
900911391 1:5599297-5599319 CAGAGGAGACTGATGGGGGATGG - Intergenic
902078652 1:13806235-13806257 CAGAGCCCAGGGATGGAGGCGGG - Intronic
902078664 1:13806268-13806290 CAGAGCCCAGGGATGGAGGCGGG - Intronic
903194113 1:21672245-21672267 GGGAGCACAGAGATGGTGGCTGG - Intergenic
903654686 1:24942105-24942127 CTGAGGACACGGATGGGGGCAGG - Intronic
905110389 1:35590420-35590442 CTGAGCTCAGAGATGGGAGCTGG - Intronic
907242122 1:53086606-53086628 CAGGGCACACAGAAGGGCCCTGG - Intergenic
911972399 1:104454455-104454477 CAGAGCTCCCAGAGAGGGGCAGG - Intergenic
912736244 1:112151899-112151921 CAGCCCAGACAGATGGGGTCTGG + Intergenic
912959378 1:114181546-114181568 CTGAGCCTACAGATGGGGGAGGG + Intergenic
915580040 1:156808139-156808161 CAGACCCCAATGATGGGGGCTGG + Intronic
915594527 1:156888532-156888554 CAGAACACACAGACAGGGGGAGG - Intergenic
916046251 1:161001968-161001990 AAGATCACACAGCTGGGGCCAGG + Intronic
917114745 1:171591644-171591666 CAGAGCAAACAGATAGGAGGAGG + Exonic
918780148 1:188689746-188689768 CAGACCTCACAGATGGCAGCTGG + Intergenic
919464309 1:197911941-197911963 CAGAGGGCACAGACGCGGGCCGG - Intronic
920007924 1:202846883-202846905 CAGAGCAGTGAGATGGGGGAGGG - Intergenic
920306253 1:205020062-205020084 CAGAGCACAAAGGAGGGTGCTGG - Exonic
920568051 1:206992009-206992031 GAGATCACACAGATAGGTGCTGG - Intergenic
920691933 1:208153840-208153862 CAGAACAGACAGCTGGGGGAGGG + Intronic
920709265 1:208279515-208279537 CAGAGGAAACACATGGGGTCAGG - Intergenic
922472206 1:225883295-225883317 CAGAGCTCAGAGAGGGGTGCTGG - Intergenic
922556295 1:226534977-226534999 GAGAGCTGAGAGATGGGGGCGGG + Intergenic
924246322 1:242088626-242088648 CAGAGCCCACAGCAGGTGGCCGG - Exonic
924595913 1:245444379-245444401 AGGAGCACACAGAAGGGGTCTGG + Intronic
1063334681 10:5200019-5200041 GGGAGCATACAGATGGGGGCAGG - Intronic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1063975020 10:11408160-11408182 CTGTGCACACAGAGTGGGGCAGG + Intergenic
1065149391 10:22806616-22806638 CAGAGAACAGAGATTGGAGCTGG - Intergenic
1066707990 10:38202119-38202141 CATTGCACACAGATTGGAGCAGG + Intergenic
1066981704 10:42422628-42422650 CATTGCACACAGATTGGAGCAGG - Intergenic
1069906369 10:71734842-71734864 CAGAGGACAGAGTTGGAGGCAGG - Intronic
1069937081 10:71925068-71925090 CAGAGGACAGAGATGTGGGCAGG + Intergenic
1070796743 10:79221375-79221397 CAGAACAAAGAGCTGGGGGCTGG - Intronic
1071291257 10:84190855-84190877 CAGAGCTCACTGAGTGGGGCGGG + Intergenic
1072694192 10:97590851-97590873 AAGAGAAGACAGATGGGAGCAGG + Exonic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1074689349 10:115990448-115990470 CAGATCCCACAGGTAGGGGCAGG + Intergenic
1075218840 10:120566468-120566490 CATAGCACAAAGATGGAGACAGG + Intronic
1075248249 10:120844088-120844110 AGTAGCTCACAGATGGGGGCAGG - Intergenic
1075444684 10:122505219-122505241 AAGAGCACACACCTGGGGCCAGG - Intronic
1075840647 10:125499525-125499547 CAGAGCACAGAGCTGCAGGCAGG + Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076365298 10:129917947-129917969 CAGAGGACCCAGAATGGGGCAGG + Intronic
1076491951 10:130867701-130867723 GAGAGGACACTGATGGGGTCAGG + Intergenic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076644492 10:131943281-131943303 CTCAACACAGAGATGGGGGCGGG + Intronic
1077488952 11:2851653-2851675 CTGAGCACCCAGCTGGGGCCAGG - Intergenic
1077563515 11:3281281-3281303 CAGAGCCCATTGATGGGGCCGGG + Intergenic
1077745656 11:4901453-4901475 AAGAGCACAAAGAGGGGGCCGGG - Intronic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1081538311 11:44011728-44011750 CAGAGCTCACATATGGGTGGTGG + Intergenic
1083594868 11:63914406-63914428 CAAAGAAGACAGGTGGGGGCAGG - Exonic
1083632287 11:64101986-64102008 CCCAGCACCCAGATGGGGGGTGG - Intronic
1083672434 11:64306757-64306779 CAGAATACCCAGATGAGGGCAGG + Intronic
1083775100 11:64890729-64890751 CTGAGCTCACAGATGGGGAGAGG + Intergenic
1083852228 11:65375086-65375108 CAGAGCAGGAAAATGGGGGCTGG + Intergenic
1084122397 11:67077381-67077403 CAGAGTCCACAGTTGGGGCCTGG + Intergenic
1084161730 11:67353773-67353795 CACAGCAGACCAATGGGGGCCGG - Intronic
1084163241 11:67362530-67362552 CAGAGCACACAGCTTCGGGAGGG - Intronic
1084219883 11:67671333-67671355 ATGAGGAAACAGATGGGGGCTGG + Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084548439 11:69826105-69826127 CAGAGCTCACAGCCGAGGGCTGG - Intergenic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1086498961 11:87432789-87432811 CATAGCACTCAGATGGGCCCAGG - Intergenic
1088166537 11:106944733-106944755 CAGAGTACTCACATGGGGGTTGG - Intronic
1088735186 11:112722987-112723009 CAGAGAACAGAGACGGGAGCAGG + Intergenic
1089631647 11:119788069-119788091 CACAGCAAATAGGTGGGGGCTGG + Intergenic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1091644728 12:2264884-2264906 CAGAGCAAACAGCTCTGGGCTGG - Intronic
1091804521 12:3346467-3346489 CAGAGACCCCAGTTGGGGGCTGG + Intergenic
1092199177 12:6569375-6569397 CTCAGCACAAAGGTGGGGGCAGG - Intergenic
1093193181 12:16098802-16098824 CAGGGAACACAGATGAGGTCTGG + Intergenic
1094320706 12:29179729-29179751 TAGAGGAGACAGATGGGGCCAGG - Intronic
1094487250 12:30934937-30934959 AATGGCACACAGATGGGGGTGGG - Intronic
1096464307 12:51839794-51839816 CAGGGCTCACAGACAGGGGCTGG - Intergenic
1096521576 12:52187488-52187510 CAGAGCAGAGAGAGAGGGGCTGG - Intronic
1097159044 12:57032970-57032992 CAGAGCACACAGATAGTGCAAGG - Intronic
1098387689 12:69935991-69936013 CAGGCCACACAGATGGGAGCAGG - Intronic
1100797577 12:98198485-98198507 CAGAACAAACAGGTGGGGGTAGG - Intergenic
1102164351 12:110794812-110794834 CAGAGAACACATAGGTGGGCTGG + Intergenic
1102225827 12:111227673-111227695 CAGGGCAGCCAGCTGGGGGCAGG + Intronic
1102246495 12:111359762-111359784 CACAGCTGACAGATGGAGGCTGG - Intergenic
1102950542 12:117028000-117028022 AAGAGCACAAAGATGGTGACAGG - Intronic
1103597101 12:122030589-122030611 CAGATCACACAGATGAGGGTTGG - Intronic
1104030589 12:125063318-125063340 CAGAGCACCCTGAGGGGTGCTGG + Intergenic
1104214561 12:126723422-126723444 CAGGGAACTCACATGGGGGCTGG + Intergenic
1104503020 12:129303950-129303972 CAGAACACAAAGGTGGAGGCAGG - Intronic
1104677063 12:130718379-130718401 CAGGCCACACAGATGGAGTCAGG - Intergenic
1104787181 12:131457236-131457258 CTGAGAAGTCAGATGGGGGCTGG - Intergenic
1104815119 12:131641157-131641179 CAGACCACACAGACTGGAGCAGG + Intergenic
1105258087 13:18758170-18758192 CAGAGCACAAAACTGGAGGCTGG - Intergenic
1105260744 13:18777476-18777498 CAGAGCACAGAACTGGAGGCTGG - Intergenic
1106749959 13:32752591-32752613 AAGAGCACAGAGGTGGGTGCTGG + Intronic
1108432763 13:50371031-50371053 CAGAGCACACAGAGGGGAGGAGG + Intronic
1112182962 13:97103458-97103480 CAGAGCACCCAGACAGGGCCAGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1115584636 14:34798245-34798267 TAGACCACACCGCTGGGGGCAGG + Intronic
1117267116 14:54100849-54100871 CAGAGCACCCAGAGAGGGGATGG - Intergenic
1117805972 14:59491096-59491118 CAGTCCAGATAGATGGGGGCTGG + Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1121010366 14:90516835-90516857 CCCAGCACACACATGGGGACTGG - Intergenic
1121239264 14:92416308-92416330 TAGAGCACACAGAGCGTGGCAGG - Intronic
1121322324 14:92999276-92999298 CACAGCACAGAGAGGGTGGCAGG + Intronic
1121725222 14:96142669-96142691 CCAAGGACTCAGATGGGGGCTGG - Intergenic
1122051696 14:99065353-99065375 CAGAACAACCAGGTGGGGGCGGG - Intergenic
1122266920 14:100550919-100550941 CACAGGACACAGGTGGGGTCTGG + Intronic
1122293875 14:100694201-100694223 CAGGGCACACAGAGCGGGGGCGG + Intergenic
1122812112 14:104294196-104294218 CAGAGCCCTCAGCTGGGAGCTGG - Intergenic
1123107964 14:105851834-105851856 GAGAGCACACAACTGGAGGCCGG + Intergenic
1123142376 14:106093960-106093982 CTGAGCACACAGAGGGCAGCAGG + Intergenic
1123149697 14:106169163-106169185 CTGAGCACACAGAGGGCAGCAGG + Intergenic
1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG + Intergenic
1123875644 15:24621524-24621546 CAGAGAACAAAGCTGGAGGCTGG - Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1126201534 15:45992200-45992222 CATAGCACAGAGCTGAGGGCAGG + Intergenic
1127555363 15:60082209-60082231 CAGGCCACAGAGTTGGGGGCAGG + Intergenic
1127688155 15:61368663-61368685 CAGTTCACACAGATGTGGGGAGG - Intergenic
1128723894 15:69973775-69973797 CTGATTTCACAGATGGGGGCAGG - Intergenic
1129185689 15:73904854-73904876 CAAAACACACAGATGGAGGGAGG + Intergenic
1129385555 15:75194251-75194273 CAGAGCAGAGAGATGTGGCCAGG + Intergenic
1129790426 15:78337460-78337482 CAGAGCAGACAGGAGGGGCCAGG - Intergenic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1130936308 15:88473757-88473779 GAGAGCTCACAGAAGGAGGCAGG - Intronic
1130962791 15:88674681-88674703 CAGAGCCTGCAGAGGGGGGCTGG - Intergenic
1131065796 15:89434252-89434274 CAGACCACACAGATGGGAAACGG - Intergenic
1131455698 15:92580813-92580835 CAGAGCACACAGACCTGGGAGGG + Intergenic
1131569683 15:93522121-93522143 CAGAGTAGACAGAAAGGGGCTGG - Intergenic
1132267883 15:100492973-100492995 AAGAGCACAAAGAAGGGGACGGG - Intronic
1132519077 16:379131-379153 CAGTGGACACAGCAGGGGGCGGG + Intronic
1132771633 16:1566886-1566908 CTGAGAACCCAGATGGGGCCTGG - Intronic
1133248447 16:4464570-4464592 CAGAGCGCACAGACCGGAGCAGG + Intronic
1133295959 16:4752431-4752453 CAGCGGACCCACATGGGGGCAGG - Exonic
1134492887 16:14709070-14709092 GAGTGCAGACAGATGGGGCCTGG + Intronic
1134498268 16:14748192-14748214 GAGTGCAGACAGATGGGGCCTGG + Intronic
1134582306 16:15380899-15380921 GAGTGCAGACAGATGGGGCCTGG - Intronic
1134849386 16:17468611-17468633 CCGAGCACACAGAGAGGGGCTGG + Intronic
1135313627 16:21424950-21424972 GAGTGCAGACAGATGGGGCCTGG - Intronic
1135322898 16:21508680-21508702 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1135366551 16:21857230-21857252 GAGTGCAGACAGATGGGGCCTGG - Intronic
1135445264 16:22513928-22513950 GAGTGCAGACAGATGGGGCCTGG + Intronic
1136114706 16:28087383-28087405 CAGAGCACACAGGCAGGGGGTGG + Intergenic
1136152769 16:28362674-28362696 GAGTGCAGACAGATGGGGCCTGG - Intronic
1136210314 16:28752599-28752621 GAGTGCAGACAGATGGGGCCTGG + Intronic
1136310289 16:29403654-29403676 GAGTGCAGACAGATGGGGCCTGG - Intronic
1136323738 16:29505444-29505466 GAGTGCAGACAGATGGGGCCTGG - Intronic
1136334382 16:29601865-29601887 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1136438423 16:30245425-30245447 GAGTGCAGACAGATGGGGCCTGG - Intronic
1136473096 16:30494839-30494861 CAGAGAAGACAGGTGGGGCCAGG + Exonic
1137747928 16:50836831-50836853 GAGAGCACAGACATGTGGGCAGG - Intergenic
1138142312 16:54579381-54579403 AACAACACAAAGATGGGGGCAGG - Intergenic
1138196168 16:55053870-55053892 CAGAACTCCCAGCTGGGGGCTGG + Intergenic
1138522205 16:57577572-57577594 CACATCACCCAGATGGTGGCAGG - Intronic
1138652626 16:58469898-58469920 AAGAGCACACAGATGGTGAGTGG + Intronic
1139335553 16:66228455-66228477 CAGAGACCAGAGCTGGGGGCAGG - Intergenic
1139386186 16:66572954-66572976 CAGAGCCCACAGATCTGAGCAGG - Intronic
1139857971 16:69996040-69996062 GAGTGCAGACAGATGGGGCCTGG - Intergenic
1139915369 16:70424989-70425011 CAGGGCACAGAGATGGCAGCTGG + Intronic
1141690645 16:85594351-85594373 CAGGGCTCACAGATGGGGCCTGG - Intergenic
1141798953 16:86294400-86294422 AGGAGCACACAGAGGGAGGCTGG + Intergenic
1142035092 16:87857700-87857722 CTGAGCAGACAGGTGGGGCCAGG - Intronic
1142600670 17:1052176-1052198 CAGAACACACAGAACGGGGCTGG + Intronic
1142740734 17:1930546-1930568 GAGAGGAGAGAGATGGGGGCGGG + Intergenic
1143374377 17:6458635-6458657 GAGAGCAGCCAGGTGGGGGCTGG - Intronic
1143444543 17:6999672-6999694 CCCAGCACACAGAGAGGGGCTGG + Intronic
1143450949 17:7036396-7036418 CAGAGCCCCCCGACGGGGGCTGG + Exonic
1144137693 17:12314319-12314341 CAGAGAACAAAGCTGGGGGCCGG - Intergenic
1144970798 17:19108289-19108311 TGGAGCAGACTGATGGGGGCCGG - Intergenic
1144991100 17:19234451-19234473 TGGAGCAGACTGATGGGGGCCGG - Intronic
1145238186 17:21223696-21223718 CAGAGCACACAGATACGAGCTGG + Intergenic
1145896477 17:28461068-28461090 CAGGGCACCCTGATTGGGGCTGG + Intronic
1145962527 17:28895923-28895945 CAAGGCAGACAGGTGGGGGCAGG + Intronic
1146630334 17:34464959-34464981 GGGAGCACACATATGGGGGATGG - Intergenic
1147214949 17:38893622-38893644 CAGACCACACAGCTGGTGGGCGG - Intronic
1147555615 17:41477075-41477097 CAGGGCACACAAATGGGGCGGGG + Exonic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147668446 17:42163388-42163410 CAGAGCAGACAGAGGGGGACTGG + Intronic
1148018827 17:44540281-44540303 AAGAGCACAAAGAAGGGGGCTGG + Intergenic
1148687338 17:49508239-49508261 CAGACCAGCCAGCTGGGGGCGGG + Intronic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1148845061 17:50525043-50525065 CAGGGCACACATGAGGGGGCAGG - Intronic
1149015222 17:51901337-51901359 CAGAGAACAAAGCTGGGGGCTGG - Intronic
1149572709 17:57684997-57685019 CAGAGGACCCAGATGGTGGAAGG + Intergenic
1150002747 17:61451922-61451944 CAGCGCGCACAGCTGGGAGCAGG + Intergenic
1150310224 17:64122225-64122247 CAGAGCAGACAGATGGGAAAAGG - Intronic
1151496063 17:74458842-74458864 CACAGCAGAAAGATGGAGGCTGG - Intergenic
1151685129 17:75641824-75641846 GACAGCACACAAATGGGGGAGGG - Intronic
1152563734 17:81091065-81091087 CGGGGCACACAAGTGGGGGCGGG - Intronic
1152626272 17:81389224-81389246 CAGATCAGACAGATGGGGGTTGG - Intergenic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1153016084 18:583861-583883 CAGATCACCCAGGTGGGGGAGGG + Intergenic
1154119421 18:11639317-11639339 GAGTGCAGACAGATGGGGCCTGG - Intergenic
1154425270 18:14267315-14267337 CAGAGCACAAAACTGGAGGCTGG + Intergenic
1154428003 18:14286902-14286924 CAGAGCACAAAACTGGAGGCTGG + Intergenic
1154432966 18:14322554-14322576 CAGAGCACAAAACTGGAGGCTGG + Intergenic
1155249329 18:23940154-23940176 AAGGGGACAGAGATGGGGGCAGG + Intronic
1155630412 18:27886494-27886516 CAGATCCCAGAGATGGAGGCAGG + Intergenic
1156571687 18:38262732-38262754 CAAATCACACAGAAGGTGGCAGG - Intergenic
1157564885 18:48673100-48673122 CATGCCACAGAGATGGGGGCAGG - Intronic
1157636987 18:49168511-49168533 TAGGGTACACAGATGGTGGCAGG + Intronic
1159477993 18:68949039-68949061 CAGGGGACAAAGATGTGGGCTGG + Intronic
1160232906 18:77061977-77061999 CAGTGAACACAGACGCGGGCTGG + Intronic
1160522013 18:79513247-79513269 CAGACCCTACAGGTGGGGGCCGG - Intronic
1160630496 18:80243917-80243939 CTGAGCACACTGCTGGGAGCGGG + Intronic
1160871670 19:1280609-1280631 CAGATCACAGGGTTGGGGGCCGG - Intergenic
1160976178 19:1793680-1793702 TGGAGCACAAAGCTGGGGGCAGG - Intronic
1161237235 19:3204181-3204203 CGGAGCACACACATCGGGGCCGG + Intronic
1161332837 19:3696573-3696595 CAAAGGACACAGATGGGAGGAGG + Intronic
1161950221 19:7463678-7463700 CACGGCACACAGAAGGGGGCAGG + Intronic
1161979662 19:7623973-7623995 CAGAGCACTTGGCTGGGGGCTGG - Intronic
1163815226 19:19460938-19460960 CAGAGCACACAGAGGGACGGGGG - Intronic
1163926760 19:20353257-20353279 AAGAGCACACAGAGGGGGGAGGG - Intergenic
1165144097 19:33720656-33720678 CAGAGCACACTGCTGAGAGCTGG + Intronic
1165992722 19:39825656-39825678 CAGGGCCCCCAGATGGGGGAGGG + Exonic
1166361612 19:42254967-42254989 CGGCGGACACAGGTGGGGGCGGG - Exonic
1166663500 19:44662754-44662776 CAGACCACACAGAAGGGTGTGGG + Exonic
1166705089 19:44904033-44904055 CTGAGTGCAGAGATGGGGGCAGG + Intergenic
1166891813 19:45998692-45998714 CAGATCACACAGATGGTAACAGG + Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167374167 19:49102340-49102362 GAGAGCATACGGATCGGGGCAGG - Intronic
1167571344 19:50290822-50290844 CCTAGCACACAGAGGGAGGCTGG + Intronic
1167792287 19:51689810-51689832 GGGAGGACAGAGATGGGGGCTGG + Intergenic
1168127437 19:54293712-54293734 CAGAGCACACAGATGTGCAGAGG + Intergenic
1168170841 19:54587644-54587666 CAGAGCACACAGGTGTGTGGAGG - Intronic
1168172919 19:54601136-54601158 CAGAGCACACAGATGTGCAGAGG - Intronic
1168459927 19:56545900-56545922 TAGAACACACAAATGGGGACTGG + Intronic
1168687774 19:58358706-58358728 CGGAGCACACAGGTGTGGACTGG + Intronic
925935124 2:8750216-8750238 AAGAGCACACGGATGGGGGCTGG + Exonic
926772167 2:16388026-16388048 CAGAGCACACAAATGTGTACTGG - Intergenic
928260794 2:29764537-29764559 TAGAGCACACACTTGGGGCCAGG + Intronic
928331335 2:30360156-30360178 CAGAGCACACGCTTGGAGGCAGG + Intergenic
929449756 2:42028805-42028827 AACAGGACCCAGATGGGGGCTGG - Intergenic
929581718 2:43085618-43085640 CAGTGGACAGAGATGGGAGCAGG - Intergenic
929950925 2:46408979-46409001 CAGAGCACACACAGGCGGCCTGG + Intergenic
931460587 2:62447171-62447193 CAGAGAACTCAGATGGGGAAGGG + Intergenic
932591117 2:73068346-73068368 CAGGACACAGAGATGTGGGCTGG + Intronic
933874498 2:86605147-86605169 CAGAGAAGAAAGCTGGGGGCTGG + Exonic
934059721 2:88282998-88283020 CAGAGCACACAGAATGAGGTGGG - Intergenic
934182520 2:89639176-89639198 CACAACACATAGATGGGGTCAGG + Intergenic
934875905 2:97919962-97919984 CAGAGTACATAGGTGGAGGCTGG - Intronic
935521042 2:104105453-104105475 CAAAGTAAATAGATGGGGGCAGG + Intergenic
936723174 2:115278636-115278658 GAGAGGAAACACATGGGGGCAGG + Intronic
937061072 2:118980861-118980883 CAGAGGACTCAGAAGGGGACAGG + Intronic
937105840 2:119311954-119311976 GAGAACACACAGCTGGGTGCTGG - Intronic
937183279 2:120014767-120014789 CAGAGCAAACAGAGGGGAGTAGG + Intronic
937236073 2:120432589-120432611 CAGAGCACACATTTGGGTGTGGG - Intergenic
937921964 2:127137289-127137311 CCGAGCCCACAGAGGGGTGCTGG + Intergenic
938219674 2:129554604-129554626 CAGAGCACACAGCTGGAGAGAGG - Intergenic
938248665 2:129797470-129797492 CAGAGCACACCCTTGGGGGCAGG + Intergenic
938384522 2:130854763-130854785 CAGAACACAGAGCTGGGGGTGGG - Intronic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
940240190 2:151554111-151554133 CACAGCGAACAGTTGGGGGCAGG + Intronic
940898917 2:159108486-159108508 CAGAGAAAATAGATGAGGGCAGG + Intronic
940901603 2:159131128-159131150 CAGATCTCATAGCTGGGGGCTGG + Intronic
943234515 2:185300570-185300592 CAGAGGACAAAGACGTGGGCTGG - Intergenic
944194065 2:197033615-197033637 AACAGCACAGGGATGGGGGCAGG + Intronic
944499153 2:200340528-200340550 CAGAGAACAAAGATGGCAGCTGG - Intronic
945866519 2:215182378-215182400 CTGAGCACTCTGACGGGGGCAGG - Intergenic
946707795 2:222475831-222475853 AAGGGCACACAGATGGGGCCTGG - Intronic
946912056 2:224473364-224473386 CAGAGCACAAAGTTGGCAGCTGG - Exonic
947411679 2:229847973-229847995 AAGAGGCCACAGATGGAGGCAGG - Intronic
947444167 2:230150673-230150695 TAGAGCACCTGGATGGGGGCTGG + Intergenic
947734293 2:232446734-232446756 CAGGGGACACAGAAGAGGGCAGG - Intergenic
947858118 2:233338258-233338280 CAGAGCTCAGAGAAGGGGCCTGG + Intronic
947951342 2:234150193-234150215 CAGAGCACGCAGCCTGGGGCTGG + Intergenic
948234609 2:236379084-236379106 CAGAGCACCCAGAGGGGCACTGG - Intronic
949003290 2:241630125-241630147 CAGTGCACACAGATTGGGCGAGG - Intronic
949052481 2:241904538-241904560 AGGAGCCCTCAGATGGGGGCGGG + Intergenic
1170394438 20:15910918-15910940 CAGAGCACAGAGATGGGTAGAGG - Intronic
1171345293 20:24461440-24461462 CAGCCCACAGAGAGGGGGGCAGG + Intergenic
1171792036 20:29536190-29536212 TAGAAGACACAGCTGGGGGCCGG + Intergenic
1171971745 20:31569248-31569270 CAGACCAGACAGATGGGGGCTGG + Exonic
1172489717 20:35326065-35326087 CAGATCACAAAGTTGGGGGAAGG + Intronic
1172523446 20:35583675-35583697 CAGACCACACGGGTGAGGGCTGG - Intergenic
1172664697 20:36591072-36591094 GAGAGCACATTGGTGGGGGCTGG - Exonic
1172804079 20:37598577-37598599 AAGAGCCCACGGGTGGGGGCGGG + Intergenic
1172839644 20:37894610-37894632 CAGAGCCCTCAGGTGGAGGCAGG - Intergenic
1173288986 20:41697851-41697873 CAAAGCACACAGAGGGGGCCCGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174338827 20:49883400-49883422 CACAACACACAGATGAGGGATGG - Intronic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1175862882 20:62159562-62159584 CAGAGGATAGAGATGGGGGGAGG - Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1176844083 21:13863202-13863224 CAGAGCACAAAACTGGAGGCTGG - Intergenic
1178106095 21:29320912-29320934 CTGAGCAAACAGATGGGAGCAGG - Intronic
1178385179 21:32143288-32143310 CAAAGCAGACAGATTGGGGCAGG - Intergenic
1178417903 21:32418684-32418706 CAGAGTACAGGGATGGGGCCAGG + Intronic
1179000998 21:37458037-37458059 CAGAACACACAGAGGCGGCCAGG - Intronic
1179568933 21:42266620-42266642 CAGAGGACAGAGATGGGAGGAGG - Intronic
1179593460 21:42426992-42427014 CAGAGCAGACAGACCAGGGCAGG - Intronic
1179601998 21:42485477-42485499 CAGAGCACAGAATTGGGGGAAGG - Intronic
1180045614 21:45303792-45303814 CAGAGCGCACAGAGGGGCCCTGG + Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181507946 22:23374337-23374359 CACAGCACACAGCTGAGGCCTGG - Intergenic
1181685310 22:24523875-24523897 CAGAGCCCTCAGGTGGGAGCTGG - Intronic
1181814700 22:25429480-25429502 CAGAGCCCTGAGAAGGGGGCAGG - Intergenic
1182468377 22:30532108-30532130 CATGGCACAGAGATGGGGGAGGG + Intronic
1183477314 22:38042736-38042758 CTGACCACACAGAAGAGGGCTGG + Intergenic
1184191816 22:42900027-42900049 CAGAGAGCTGAGATGGGGGCAGG - Intronic
1184738802 22:46415083-46415105 CAGAGCAGACAGATGTTGCCAGG + Intronic
949562464 3:5215056-5215078 AAAAGCACAGAGATGTGGGCTGG + Intronic
950108713 3:10404900-10404922 CAGAGCACATAGCAAGGGGCAGG - Intronic
950473318 3:13199722-13199744 CGGAGGACTCAGATGGGGGCAGG - Intergenic
950669873 3:14519601-14519623 CAGAGGGCACAGTTGGGGCCAGG - Intronic
952341454 3:32451043-32451065 CAGTGCAGACAGTTGGGGACCGG + Intronic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
953885558 3:46712727-46712749 GGGAGGAAACAGATGGGGGCTGG - Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954107300 3:48416199-48416221 CAGACCAGACACATGGAGGCAGG + Intronic
954415100 3:50389510-50389532 GAAAGGACACAGGTGGGGGCTGG + Intronic
954841504 3:53515657-53515679 CAAGGCTCACAGATGGGAGCTGG + Intronic
957157550 3:76564695-76564717 CAGTACACACAGGTGGGGACAGG + Intronic
957184616 3:76925661-76925683 AAGGGAACACAGATGGGGTCAGG + Intronic
957789367 3:84919213-84919235 GAGAGCACAGGGTTGGGGGCAGG - Intergenic
959585315 3:108020246-108020268 CTGAACAAACACATGGGGGCAGG + Intergenic
960115974 3:113892856-113892878 TATAGAACACGGATGGGGGCTGG - Intronic
960294942 3:115931372-115931394 CAGGTCACTCAGCTGGGGGCAGG - Intronic
961349114 3:126287748-126287770 CAGAGCTCACAGGAGGGGGCTGG - Intergenic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961466296 3:127083978-127084000 CAGTGCCCACACATGGGTGCTGG - Intergenic
961478143 3:127161375-127161397 GAGAGCAGACAGAAGGGGCCAGG - Intergenic
961506163 3:127371887-127371909 CAGAGGAGACAGATGGGGCTGGG + Intergenic
961555544 3:127694545-127694567 CAGGGCACACAGGTGCTGGCAGG - Intronic
963925267 3:150944471-150944493 CAGAGGGGAGAGATGGGGGCTGG + Intronic
964122172 3:153196329-153196351 CAGAGCACACAGAGGCTGGCAGG + Intergenic
964698173 3:159533627-159533649 CAGAGAACAGAGATGTGGGGGGG - Intronic
965040899 3:163505667-163505689 CACAGCACACAAATGTGGACTGG + Intergenic
966748701 3:183302118-183302140 CACAACCCACAGACGGGGGCAGG + Intronic
966816926 3:183896990-183897012 CAGACCAAGCAGATGGGAGCAGG + Intergenic
966926052 3:184645324-184645346 CAGAGCAGGCAGGTTGGGGCAGG - Intronic
967410813 3:189165017-189165039 AAATGCACAGAGATGGGGGCTGG - Intronic
968284654 3:197501350-197501372 CATCGCATACACATGGGGGCAGG - Intergenic
968609141 4:1549257-1549279 CAGAAGACCCAGATGGGTGCAGG + Intergenic
969284579 4:6194907-6194929 CAGACCACACAGAGGGGAACAGG + Intronic
969317813 4:6392653-6392675 CAGAGCTCAGAGAGGTGGGCTGG + Intronic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
969975597 4:11098121-11098143 CAAACCACACAGAGTGGGGCAGG - Intergenic
970005878 4:11410306-11410328 CAGAGGAAAGAGATGGGAGCTGG + Intronic
973729596 4:53810789-53810811 CTCAGCTCACAGATAGGGGCTGG - Intronic
974238818 4:59216431-59216453 CTGAGAACCCAGGTGGGGGCTGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
978562357 4:110046539-110046561 CAGAGCTCACAGATGGCAGGGGG - Exonic
982075483 4:151732415-151732437 CAGAGCACAGGGTTGGGGGCAGG - Intronic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983262254 4:165469996-165470018 CTGAGCCTACAGGTGGGGGCTGG + Intronic
985657890 5:1141490-1141512 GAGAGCACAGAGAGGGAGGCAGG - Intergenic
985890565 5:2712176-2712198 GGCATCACACAGATGGGGGCAGG - Intergenic
985986068 5:3517467-3517489 CAGAGCAGAAAGACGGGGGGAGG - Intergenic
987620726 5:20336286-20336308 GAGAGGACACAGTTAGGGGCTGG + Intronic
987871996 5:23631448-23631470 CAGATCACACATCTGGAGGCTGG + Intergenic
988472966 5:31557771-31557793 CAGAGCTCACACATGGGGAAGGG - Intergenic
990245633 5:53860524-53860546 CAGAGAACAAAGCTGGGGCCTGG - Intergenic
990291751 5:54359371-54359393 CAGGGCAGACAGATGGGTACAGG - Intergenic
991405081 5:66293672-66293694 GAGAGCACTCAGATGGTGGGGGG - Intergenic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
998096315 5:139397364-139397386 CAGAGGACCCACATGAGGGCAGG + Intronic
998923780 5:147100154-147100176 CAGATCACACAGCTAGTGGCTGG + Intergenic
999662335 5:153878495-153878517 AAGAGCACACAGATGATTGCGGG + Intergenic
1001936274 5:175708092-175708114 CAGAACACACAGCTGGGTGTGGG + Intergenic
1002195114 5:177497159-177497181 CTGTGGAGACAGATGGGGGCTGG + Intronic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1003541143 6:7019158-7019180 CAGAGCACCCACATGGGTGGAGG - Intergenic
1003544525 6:7048259-7048281 AAGTGCACAGAGCTGGGGGCGGG + Intergenic
1004224148 6:13770822-13770844 CAGAGCTCACAGATGGTGGCTGG - Intergenic
1006410913 6:33872744-33872766 CAAGGCCCACAGGTGGGGGCTGG + Intergenic
1009397453 6:63215834-63215856 CAGAGCAAAGTGCTGGGGGCTGG - Intergenic
1011861821 6:91767564-91767586 CTGAAAACACAGATTGGGGCAGG + Intergenic
1014183180 6:118407456-118407478 CAGAGAACACTGACGGGGGGAGG - Intergenic
1017541713 6:155409338-155409360 CAGAGGAAACCGATGGGGGTGGG + Intronic
1019442734 7:1055659-1055681 CAGAGCACACTGAGGGGTCCCGG + Intronic
1019560455 7:1653533-1653555 CAGGGCACACAGACAGGGGCAGG - Intergenic
1021536007 7:21705434-21705456 CAGAGCAAACAGCTGGTTGCTGG - Intronic
1023272265 7:38476901-38476923 CAGAGCTTCCAGATGGTGGCGGG + Exonic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1023892290 7:44401820-44401842 CAGAACACACAGGTGGAGACAGG + Intronic
1024059580 7:45687791-45687813 AAGATCACACAGATGGCAGCTGG - Intronic
1024088195 7:45914635-45914657 CAGAGCCCTCAGAAGGGTGCAGG - Intronic
1024177236 7:46852992-46853014 CCCACCACTCAGATGGGGGCAGG + Intergenic
1024418411 7:49134970-49134992 CATAGCACACTGATGAGAGCAGG + Intergenic
1026994155 7:74605099-74605121 CAGAGCAGACACAGGGTGGCTGG + Intergenic
1027232351 7:76280367-76280389 CACGGCACACAGATGGGGGAGGG - Intronic
1028150207 7:87363556-87363578 CAGAGTACACAGGAGGGAGCTGG + Intronic
1029241602 7:99167171-99167193 CAGGGCACAGAGGTGGGAGCTGG - Intergenic
1030212060 7:107006350-107006372 CAGAAATCACAGCTGGGGGCGGG - Intergenic
1034258745 7:149740644-149740666 CAGAGCTTACAGTTGGGGGCTGG - Intergenic
1034345825 7:150384584-150384606 CTGAGCACACAGGTAGAGGCGGG + Intronic
1035245362 7:157559414-157559436 CAGAACACACTGGCGGGGGCTGG + Intronic
1035330600 7:158094601-158094623 TAGAAAGCACAGATGGGGGCCGG - Intronic
1035936651 8:3848684-3848706 CAGATCACACAGATGGTGCAAGG - Intronic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1038213154 8:25538870-25538892 CAGATCACACTGATGGCGGGGGG + Intergenic
1038239415 8:25794849-25794871 TAGGGCACACTGGTGGGGGCGGG - Intergenic
1038423616 8:27450924-27450946 AAGAGGACACAGATGGGTGCAGG - Intronic
1039546143 8:38413006-38413028 CAGAGCCCCCAGTTTGGGGCTGG + Exonic
1040483587 8:47849727-47849749 CAGAGCACAGTGATGTGGACTGG - Intronic
1040989628 8:53335917-53335939 CAGAGTAGGCAGATGGGGGGTGG - Intergenic
1040994847 8:53391132-53391154 CAGCTCACATAGATGAGGGCAGG - Intergenic
1041168583 8:55116752-55116774 CCCAGCACATAGATGGGGGAGGG - Intronic
1043270331 8:78325205-78325227 CAGTTCACACAGCTGGGGGCTGG - Intergenic
1043875771 8:85484499-85484521 CAGCCCACACAGATGGTGTCTGG + Intergenic
1048971398 8:139646991-139647013 CAGTGCACACAAAGGTGGGCTGG + Intronic
1049092913 8:140530295-140530317 CTGAGCACAAAGGTGGGGGGGGG + Intergenic
1049260388 8:141635925-141635947 CTGAGCACCCAGCTGTGGGCAGG + Intergenic
1049271941 8:141700717-141700739 CAGAGGACCCAGTAGGGGGCTGG - Intergenic
1049422947 8:142524935-142524957 CAGAGTAGAGAGGTGGGGGCTGG - Intronic
1049580733 8:143409397-143409419 CAGAGTACACCGGTGGGGGCAGG + Intergenic
1049785734 8:144449826-144449848 GCGGGCACACAGATGGGGGCGGG + Exonic
1050280959 9:4049489-4049511 CACAGCCCACAGATGCCGGCAGG + Intronic
1050342436 9:4654366-4654388 AGGAGCAGACAGACGGGGGCAGG + Intronic
1052378673 9:27745721-27745743 CAAAGCACACTGCTGAGGGCTGG + Intergenic
1052834881 9:33242850-33242872 CAGAGCACTGGGATGGGGGCAGG - Intronic
1053313249 9:37032663-37032685 GAGGGCACAGAGATGGGGGAAGG + Intronic
1055054069 9:72007809-72007831 AAGAACACACAGGTGGGTGCGGG + Intergenic
1055734438 9:79312427-79312449 GAGAGCACACTGATAGGTGCTGG + Intergenic
1057129611 9:92644408-92644430 CAGAGGACGCAGATGAGGGCAGG + Intronic
1057577393 9:96254300-96254322 CAGAGCACAGACATGGGGAAGGG + Intronic
1058851387 9:109014410-109014432 CAGAGCCCCACGATGGGGGCGGG + Intergenic
1058857528 9:109078191-109078213 CATAGCACAAAGAAGAGGGCTGG - Intronic
1060110778 9:120904912-120904934 CAGGGCACAAAGATGGGTGAAGG - Exonic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1061026335 9:128052112-128052134 CACAGCACCCATATGGGGCCGGG + Intergenic
1061920510 9:133779955-133779977 CAGAACACAGAGATGAGGGAAGG + Intronic
1062268787 9:135699520-135699542 CAGAGCACACGTGAGGGGGCGGG - Exonic
1062337852 9:136080256-136080278 GAGAGCACAGAGATGGGTGCGGG - Intronic
1062523238 9:136968267-136968289 AAGAGGTCACAGATGGGGCCCGG - Intergenic
1187501245 X:19840869-19840891 CACAGCACACAGCTGGAGGGTGG - Intronic
1189256345 X:39642600-39642622 CAGAGGAGAAAGATGGGGGCAGG + Intergenic
1190330732 X:49233847-49233869 AAGAACACACAGGTGGGTGCGGG + Intergenic
1190916876 X:54817591-54817613 GAGATCACCCAGATGGTGGCAGG + Intergenic
1191227116 X:58055062-58055084 CAGACTTCTCAGATGGGGGCAGG - Intergenic
1195586216 X:106567610-106567632 CAGAGAACAAAGCTGGGGTCTGG + Intergenic
1197278004 X:124502380-124502402 GGGAGCACACAGCTGGGGGCTGG + Intronic