ID: 969593255

View in Genome Browser
Species Human (GRCh38)
Location 4:8133682-8133704
Sequence GCATGGACCCAGGTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969593255_969593265 5 Left 969593255 4:8133682-8133704 CCCAGCTCCACCTGGGTCCATGC 0: 1
1: 0
2: 2
3: 28
4: 256
Right 969593265 4:8133710-8133732 CCCTCCGACAGCATCTCTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969593255 Original CRISPR GCATGGACCCAGGTGGAGCT GGG (reversed) Intronic
900931568 1:5741299-5741321 ACCTGGCTCCAGGTGGAGCTGGG - Intergenic
901310174 1:8263360-8263382 GCATGAACCCAGGTGGGACTTGG - Intergenic
902677097 1:18016330-18016352 CCATGGACCTAGGAGGAGCTAGG - Intergenic
902795895 1:18800165-18800187 GCATGGGCCCAAGTGCAGCTTGG - Intergenic
902873602 1:19328347-19328369 GCTTGGAGACAGATGGAGCTTGG + Intronic
904392146 1:30193026-30193048 GCATTGCCTCAGGTGCAGCTGGG - Intergenic
905868880 1:41391712-41391734 CCATGGACCCAGGAGGAGGCAGG + Intergenic
909919839 1:81367514-81367536 GCAGGGACATAGATGGAGCTGGG - Intronic
911300213 1:96163568-96163590 GCAAGGACAGAGGTGTAGCTAGG + Intergenic
912382111 1:109253394-109253416 GGAAGGGCCCAGGTGGCGCTGGG + Intronic
912686817 1:111774482-111774504 GCTTGCACCCTGGTGGAGCTGGG - Intronic
912942940 1:114061106-114061128 CCATGGAGCCAGCAGGAGCTGGG + Intergenic
913216479 1:116624925-116624947 ACATGGTGGCAGGTGGAGCTGGG - Intronic
916722944 1:167498585-167498607 TAATGGGCCCAGATGGAGCTAGG - Intronic
916729562 1:167553780-167553802 GCAGGGACCCAGCCGGAGCTCGG + Intergenic
918983834 1:191596884-191596906 CCATGGATCCAGCTGGAGCCAGG - Intergenic
921080682 1:211736571-211736593 GCAGGCAGCCAGGTGGAGCCTGG + Intergenic
1063885410 10:10572651-10572673 GCAGGGACACAGTTGGAGCTGGG - Intergenic
1063926466 10:10982501-10982523 GCTGGGACCCAGGTGCTGCTTGG - Intergenic
1065407763 10:25388683-25388705 CCATGGAGCCAGTGGGAGCTGGG + Intronic
1065976423 10:30846560-30846582 TCATGGAGCCAGTGGGAGCTGGG + Intronic
1067834360 10:49628964-49628986 GCAAGGAGCCAGCTGGATCTGGG - Intronic
1069617453 10:69815216-69815238 GCAGAGGCCCAGGTTGAGCTAGG + Intronic
1070873793 10:79782266-79782288 GCATGAACCCAGGAGGAGGAAGG + Intergenic
1071045462 10:81369566-81369588 GCAGGGACACAGATGGAGTTTGG - Intergenic
1071572992 10:86708205-86708227 GCTGGGACCTGGGTGGAGCTTGG + Intronic
1071640726 10:87304415-87304437 GCATGAACCCAGGAGGAGGAAGG + Intergenic
1071654510 10:87433530-87433552 GCATGAACCCAGGAGGAGGAAGG - Intergenic
1075204153 10:120432232-120432254 CCATGGCTCCAGGTGGGGCTGGG + Intergenic
1075549016 10:123378569-123378591 GCATTGACCAAGGAGGAGTTAGG - Intergenic
1076019115 10:127055957-127055979 GTATGGACCCAGCAGGAGCCAGG + Intronic
1076474009 10:130739948-130739970 GCATGAACCGAGGTGGAGAACGG + Intergenic
1076705169 10:132297414-132297436 GCGTGGCCCCTGGTGGGGCTGGG - Intronic
1077014094 11:392388-392410 GCAGGGCCCCAGGTGGGCCTGGG + Intergenic
1077104180 11:834846-834868 GCGTGGAGGCAGGTGGAGCCTGG - Intronic
1077469043 11:2748289-2748311 GCGTGGACCCAGGGTGAGCTAGG - Intronic
1078648967 11:13169520-13169542 GCATGGACCCAGGTGGAATTTGG - Intergenic
1079113395 11:17621690-17621712 GCAGGAACCCAGGTAGAGCCTGG - Intronic
1079818514 11:25094393-25094415 GCAGGGGCCCAGCTGGGGCTGGG - Intergenic
1080721388 11:34852613-34852635 GCAGGGACATAGATGGAGCTGGG + Intergenic
1081846089 11:46241489-46241511 GAAAGGAGCCAGGTGGAGGTGGG - Intergenic
1083211996 11:61193945-61193967 GCCAGGACCCAGCTCGAGCTGGG - Intergenic
1083852116 11:65374306-65374328 CCATGTGCCCAGGTGGAGCAGGG + Intergenic
1083852123 11:65374332-65374354 CCATGTGCCCAGGTGGAGCAGGG + Intergenic
1085510367 11:77085058-77085080 GTCTGGTCCCAGCTGGAGCTGGG + Intronic
1086249175 11:84794395-84794417 CCATGGAGCCAGTGGGAGCTGGG + Intronic
1086515176 11:87603787-87603809 AGATGGACACAGGTGGAGCAGGG + Intergenic
1088517458 11:110653912-110653934 GCATGGACATGGATGGAGCTGGG + Intronic
1089459591 11:118644787-118644809 GCAGGGTCCCAGGCTGAGCTGGG + Intronic
1091125390 11:133091125-133091147 AAGTGGACCCAGGTGCAGCTTGG + Intronic
1091349821 11:134884164-134884186 GCAGGGACACAGATGGAGCCGGG - Intergenic
1091633416 12:2179251-2179273 GCATCCTGCCAGGTGGAGCTGGG + Intronic
1092171506 12:6376279-6376301 GGAGGGGCCCAGGTGAAGCTGGG + Intronic
1092298705 12:7224202-7224224 TCAGGGACCCAGGTTGACCTGGG + Intergenic
1092489299 12:8930655-8930677 CCATGGGTCCAGGTGGAGGTGGG + Exonic
1094468467 12:30779726-30779748 CCAGGGGCTCAGGTGGAGCTGGG + Intergenic
1096946494 12:55413882-55413904 CCATGGGTCCAGGTGGAGGTGGG - Intergenic
1098635831 12:72782122-72782144 ACATGGACACAGGTGGGGGTGGG + Intergenic
1101681097 12:106966283-106966305 GCAGCAACACAGGTGGAGCTGGG - Intronic
1102791529 12:115650339-115650361 ACATGCACCCAGGAGGAGGTGGG + Intergenic
1103561620 12:121795921-121795943 GCCTGGACCCAGGCCGGGCTGGG - Intronic
1104598261 12:130134473-130134495 GCCAGGACCCAGCTGCAGCTAGG - Intergenic
1104603075 12:130166477-130166499 GCATGGCCCCAGGGGCAGCTTGG - Intergenic
1110618624 13:77570132-77570154 GCATGGACCCAGGTACAGACAGG - Intronic
1112163730 13:96895696-96895718 ACATGGAGCCAGGTGGAGCCAGG + Intergenic
1112339055 13:98537581-98537603 GCATGCACCTGGGTGGAGCTGGG - Intronic
1113269270 13:108655296-108655318 CCATGGGCCCAGCTGGACCTTGG - Intronic
1113270471 13:108668305-108668327 GCTTGGACCCAAGCGGAGCTAGG + Intronic
1117930752 14:60838621-60838643 ACATGGAGCCAGTGGGAGCTGGG + Intronic
1118278933 14:64411182-64411204 GATAGGACCCAGGTGGAGGTTGG - Intronic
1118555580 14:67016188-67016210 CCATGGACCCATGTGGTACTTGG + Intronic
1120331776 14:83102541-83102563 TCAGGGACACAGATGGAGCTGGG + Intergenic
1121173453 14:91873086-91873108 GGGTGGACCCAGGTGGAGGCCGG - Intronic
1121316273 14:92962717-92962739 GCCTGCCCTCAGGTGGAGCTGGG + Intronic
1122442432 14:101741258-101741280 GAAGGGACCAAGGTGCAGCTCGG - Intergenic
1122881838 14:104693778-104693800 GCAAGGACCCAGGTACAGATGGG - Intronic
1122887459 14:104716570-104716592 GGAGGGAACCAGGTGGAGCGTGG - Intronic
1123467714 15:20528866-20528888 GGATGGACCCAGCTGTAGCCTGG + Intergenic
1123650399 15:22472176-22472198 GGATGGACCCAGCTGTAGCCTGG - Intergenic
1123728026 15:23124075-23124097 GGATGGACCCAGCTGTAGCCTGG + Intergenic
1123740807 15:23281018-23281040 GGATGGACCCAGCTGTAGCCTGG - Intergenic
1123746191 15:23321540-23321562 GGATGGACCCAGCTGTAGCCTGG + Intergenic
1124278458 15:28344857-28344879 GGATGGACCCAGCTGTAGCCTGG + Intergenic
1124304242 15:28566751-28566773 GGATGGACCCAGCTGTAGCCTGG - Intergenic
1124566680 15:30822094-30822116 GGAGGGAGCCAGGTGGAGCTGGG - Intergenic
1128847722 15:70916690-70916712 CCATGGAGCCAGGTGGACCTGGG + Intronic
1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG + Exonic
1129199556 15:73990818-73990840 GCATGGAGCCAGGAGCACCTGGG + Intronic
1129248252 15:74293066-74293088 GCATTGACCCATCTGGTGCTGGG + Intronic
1129660363 15:77549723-77549745 GCAAGGGGCCAGGAGGAGCTTGG + Intergenic
1131082754 15:89550647-89550669 GCAGGGACACAGATGGAGCTAGG + Intergenic
1131513732 15:93064068-93064090 ACATGGCCCCAGGAGGAACTGGG - Intronic
1132374146 15:101317581-101317603 GAATGGATCCAGGTGGGGATGGG - Intronic
1133304813 16:4802306-4802328 GCGCGGCCCCAGGTGGAGCCAGG + Intronic
1134290590 16:12901040-12901062 GCAAGGACCCAGGCGGAGCTGGG - Intergenic
1135461746 16:22649989-22650011 GCAGGCACACAGATGGAGCTGGG - Intergenic
1137036718 16:35574808-35574830 GCAAGGAGACAGGAGGAGCTGGG + Intergenic
1137064346 16:35824024-35824046 GCAGGGACACTGATGGAGCTGGG - Intergenic
1138008404 16:53357552-53357574 GGATGGACCCAGCTGTAGCCTGG + Intergenic
1138118926 16:54382523-54382545 GCCTGAACACAGGTGGAGTTTGG - Intergenic
1138477943 16:57283306-57283328 GCACTGACCCAGGTAGAGGTGGG + Intronic
1139596718 16:67962364-67962386 GCCTAGACCCCGGTGGGGCTGGG - Intronic
1140342170 16:74175037-74175059 GCAGGGAGGCAGGTGCAGCTGGG + Intergenic
1140505975 16:75473020-75473042 GCCTGGACCCTGGTGGAAATTGG + Exonic
1141251612 16:82363928-82363950 GAATGGACCAAGGTAGAGTTGGG + Intergenic
1141377706 16:83547242-83547264 GCCTGGACCCAGGGGGATGTGGG + Intronic
1142173031 16:88632669-88632691 GCATGGACGCAGGTCATGCTGGG - Intergenic
1142215694 16:88828782-88828804 GCATGGAGCCGGGCGGCGCTGGG + Intronic
1144061011 17:11583389-11583411 CCATGGAGCCAGCAGGAGCTGGG - Intergenic
1144352658 17:14412732-14412754 GCATGGACTCATGGGGAGCCTGG - Intergenic
1144994869 17:19260500-19260522 GGAAGGACACAGGTGGACCTGGG + Intronic
1145269261 17:21396039-21396061 GCAGGGACCCAGGTACAGCAGGG - Intronic
1148683339 17:49486969-49486991 GCAAGGACACAGGTGGAGGGTGG - Intergenic
1149256980 17:54837363-54837385 CCATGGAGCCAGTGGGAGCTGGG - Intergenic
1150624633 17:66833932-66833954 GAATGGGGCCAGGTGGAGTTGGG - Intergenic
1152224169 17:79085073-79085095 GCAAGGACTCCGGAGGAGCTCGG - Intronic
1152647063 17:81474180-81474202 GCAAGGAGACGGGTGGAGCTGGG + Intergenic
1154142642 18:11838384-11838406 GCATGGAGCCAGGTGGACTTGGG + Intronic
1155677797 18:28450645-28450667 GCAGGGACCGAGATGGAGTTTGG + Intergenic
1156617089 18:38799759-38799781 GCATGGACACAGGGTGAGGTTGG - Intergenic
1156750855 18:40453418-40453440 GCATGGAGCCAGGTATATCTAGG + Intergenic
1157242344 18:46022962-46022984 GCAGGGACATGGGTGGAGCTGGG + Intronic
1158762239 18:60403557-60403579 GTACCCACCCAGGTGGAGCTTGG - Intergenic
1160024197 18:75205102-75205124 GCAGGGATCCCGGTGGAGGTGGG - Intronic
1160125749 18:76169774-76169796 GCATGTGCCCAGGTGGAGGGAGG + Intergenic
1161572967 19:5040338-5040360 GCATGTACCCGTGTGGAGCCAGG - Intronic
1161716335 19:5877997-5878019 GCATGAACCCAGCTGGGCCTGGG - Intronic
1162329733 19:10020472-10020494 TCCTGGGACCAGGTGGAGCTGGG + Intronic
1162430617 19:10625954-10625976 CCACGGAACCAGGTGGAGATGGG - Intronic
1163104245 19:15114478-15114500 GCATGGACACAGGGGTAGCCTGG + Exonic
1164623807 19:29713856-29713878 GCATGCTGCCAGGAGGAGCTGGG - Intronic
1164671554 19:30074916-30074938 GCTTGGATCCAGGTGGAGTCGGG - Intergenic
1165098895 19:33426714-33426736 GGAGGGAACCAGGAGGAGCTGGG + Intronic
1165397211 19:35571020-35571042 GCATGAACCCTGGTGGAGGGAGG + Intergenic
1165903082 19:39177855-39177877 GCAGGGCTCCAGGTGGAGCATGG + Intronic
1166718752 19:44985645-44985667 GCTTGGAGCCAGGCTGAGCTTGG - Intronic
926541095 2:14182540-14182562 GCCAGGCCCAAGGTGGAGCTGGG + Intergenic
932408519 2:71530396-71530418 GCAGGGACCCAGGAGCAGCCCGG - Intronic
932770952 2:74500522-74500544 TCACGGACCCAGCTGGATCTTGG + Intronic
933652707 2:84862179-84862201 GCAAGGAGCCAGGTGGGACTGGG - Intronic
935518908 2:104079016-104079038 CCATGGAGCCAGCAGGAGCTGGG - Intergenic
937038353 2:118801352-118801374 GCATGAAGCAGGGTGGAGCTGGG - Intergenic
941916115 2:170815137-170815159 GCATACAACCAGGTGAAGCTCGG - Intronic
946381157 2:219350138-219350160 GCATGGGACCTGCTGGAGCTTGG + Intergenic
948070103 2:235114098-235114120 GCACGGACCCAGAAGGCGCTGGG - Intergenic
948685883 2:239669604-239669626 GAATGAACCCAGCTGGAGCATGG + Intergenic
948779004 2:240305480-240305502 GTATAGAGCCACGTGGAGCTAGG - Intergenic
1168964483 20:1891015-1891037 GGCTGGAACCAGGTGAAGCTGGG + Intergenic
1169005926 20:2207334-2207356 GCCTGGGCCCAGGTGGAGGAAGG + Intergenic
1169150039 20:3282398-3282420 GTTTGGACCCAGTGGGAGCTTGG - Intronic
1169632453 20:7648052-7648074 CCATGGAGCCAGCAGGAGCTGGG - Intergenic
1171029421 20:21663919-21663941 GCATGGAGACAGATGCAGCTGGG + Intergenic
1172811678 20:37652475-37652497 GCATGGTCTCTGGAGGAGCTTGG + Intergenic
1173024971 20:39299084-39299106 GGATGGAGACAGGAGGAGCTGGG + Intergenic
1173493809 20:43504627-43504649 CCATGGACCCAGGTGAAGACAGG + Intergenic
1173681470 20:44885507-44885529 GGAGGGACCCAGGAGGAGGTGGG - Intergenic
1173907056 20:46637132-46637154 AGCTGGACCCAGGTGGAGCTGGG - Intronic
1174081761 20:47974906-47974928 CCAGGGACCCAGGTGGCTCTTGG - Intergenic
1174134692 20:48371691-48371713 CCAGGGACCCAGGTGGCTCTTGG + Intergenic
1175785739 20:61710656-61710678 GCAAGGGCCCATGTGGAGCAGGG + Intronic
1175902803 20:62366712-62366734 GCATGGACCCGGGGGCGGCTGGG - Intronic
1176074077 20:63240587-63240609 GCCTGGAGCCAGCTGGACCTGGG - Intergenic
1176388000 21:6148842-6148864 ACATGAGCCCAGGTGTAGCTGGG + Intergenic
1177396201 21:20538553-20538575 CCATGGAGCCAGCAGGAGCTGGG - Intergenic
1177609809 21:23432029-23432051 ACGTGGGCCCAGGTGCAGCTTGG + Intergenic
1178336417 21:31747571-31747593 GCATGGATACAGGTGAAGGTGGG + Intergenic
1178474842 21:32928743-32928765 GCTTGCCCCCAGATGGAGCTTGG - Intergenic
1179547193 21:42120761-42120783 GGCTGGACCGAGGTGGATCTGGG + Intronic
1179735472 21:43389406-43389428 ACATGAGCCCAGGTGTAGCTGGG - Intergenic
1180046806 21:45310347-45310369 GCATGTCCACAGGTGGAGGTGGG + Intergenic
1180817829 22:18803298-18803320 ACATGGTGGCAGGTGGAGCTGGG - Intergenic
1181204044 22:21237751-21237773 ACATGGTGGCAGGTGGAGCTGGG - Intergenic
1181524362 22:23471254-23471276 GCATGGGCCCAGCTGATGCTAGG + Intergenic
1181557726 22:23681459-23681481 GCATGGACACAGGTTGTGGTTGG + Intergenic
1181625290 22:24118803-24118825 CCATGGCCCCTGGTGGAGCAAGG + Intronic
1182353860 22:29713421-29713443 GCAATGACCCAGCTGTAGCTCGG + Intergenic
1183167297 22:36157244-36157266 TCATGGACCCGGAGGGAGCTGGG - Intronic
1183345674 22:37306322-37306344 GCAAGGACCCAGGAGGTGCAGGG - Intronic
1184915071 22:47563591-47563613 CCATGGTCCCAGGGGGAGCCGGG + Intergenic
1184947237 22:47812196-47812218 ACCTGGAGCCAGGAGGAGCTGGG + Intergenic
1185157016 22:49199208-49199230 GCGTGGAGTCACGTGGAGCTTGG + Intergenic
1185213536 22:49585803-49585825 GCATGGACCCAGATGCGGGTGGG + Intronic
1203222877 22_KI270731v1_random:57664-57686 ACATGGTGGCAGGTGGAGCTGGG + Intergenic
1203267952 22_KI270734v1_random:29149-29171 ACATGGTGGCAGGTGGAGCTGGG - Intergenic
950155137 3:10716338-10716360 GGCTGGAGCCAGGTGAAGCTGGG - Intergenic
950253017 3:11482538-11482560 CCCTAGACCCAGGTGGAGCAGGG - Intronic
952654133 3:35763560-35763582 CCATGGAACCACATGGAGCTTGG + Intronic
952997050 3:38894675-38894697 TCAGAGACCCAGGAGGAGCTTGG - Exonic
953435152 3:42872016-42872038 GCAGGGCTCCAGCTGGAGCTGGG - Intronic
954434719 3:50489954-50489976 GCAGGGACCCAGTTGGCCCTTGG + Intronic
954439111 3:50511890-50511912 GCAAGGACCCAGGGGGACCTGGG - Intergenic
954615760 3:51967914-51967936 GCAGGGTCCCAGCCGGAGCTCGG - Intronic
958616553 3:96500296-96500318 TCTTGGTCCCAGGTGGAGCATGG - Intergenic
958636124 3:96749992-96750014 CCATGGAACCAGTGGGAGCTGGG + Intergenic
959256701 3:104024370-104024392 GCAGGGACACAGATGGAGCTGGG + Intergenic
959532776 3:107452321-107452343 GCATGTACCCAGGTGGAGGGAGG - Intergenic
960650640 3:119944612-119944634 GCGTGTAGCCATGTGGAGCTTGG - Intronic
961089153 3:124094579-124094601 GCCTGGACCCAAGGGGAGGTCGG - Intronic
961499585 3:127322780-127322802 ACATGGGCCCAGGTGCTGCTGGG - Intergenic
961724179 3:128915206-128915228 GGATCGAGACAGGTGGAGCTGGG - Exonic
963725187 3:148911924-148911946 GCATGGCCCCAGGTGGCTCATGG + Intergenic
963848496 3:150183502-150183524 AAATGGATCCAGATGGAGCTTGG + Intergenic
964556565 3:157946029-157946051 GCATGGAGCCATGTGAGGCTGGG + Intergenic
965367646 3:167820291-167820313 CCATGGAGCCAGCAGGAGCTGGG + Intronic
966321191 3:178702768-178702790 TCATGGAAGCAGGTGGAGTTAGG + Intronic
969106514 4:4810788-4810810 GCAAGGAACCTGGGGGAGCTGGG + Intergenic
969451482 4:7276385-7276407 GCCTGCCCCAAGGTGGAGCTGGG - Intronic
969593255 4:8133682-8133704 GCATGGACCCAGGTGGAGCTGGG - Intronic
971298809 4:25425023-25425045 GCCTAGACCCAGCTGGACCTGGG + Intergenic
971546269 4:27891049-27891071 GCATGGACCAAGCTGTACCTTGG - Intergenic
971831453 4:31701340-31701362 GCATGGACCTAGGTGAAGAAAGG + Intergenic
973768948 4:54189146-54189168 GCATGGGATCAGGTGGATCTGGG + Intronic
976921577 4:90449916-90449938 CCATGGAGCCAGCAGGAGCTAGG - Intronic
978301147 4:107270542-107270564 CCATGGAGCCAGTGGGAGCTGGG - Intronic
978880417 4:113695663-113695685 GCTTGGACCCAGGTGGTTGTAGG - Intronic
979867485 4:125775091-125775113 GTCTGGACCCAGTTGGAGCCCGG + Intergenic
980101985 4:128551060-128551082 GCGTGTACCAAGGTGGGGCTTGG - Intergenic
981723669 4:147826014-147826036 GCAAGGAGCCAGGTGGGGCGGGG + Intronic
984695011 4:182770464-182770486 GCAGGGGCCCGGGTGGGGCTGGG - Intronic
985516159 5:345784-345806 GCGGGGCCCCAGGAGGAGCTGGG + Intronic
985534246 5:454414-454436 ACATGGTCCCAGGCGGGGCTGGG + Intronic
985780966 5:1871609-1871631 GCATGGAGCCAGGTGCCTCTCGG - Intergenic
986223471 5:5791380-5791402 GCATAGATCCAAGTGGTGCTGGG - Intergenic
989339037 5:40354114-40354136 CCATGGAGCCAGTGGGAGCTAGG + Intergenic
992067480 5:73120805-73120827 GCAGGGACGCAGGTTGGGCTCGG - Intronic
992863659 5:80937117-80937139 GGCTGGACCCAGGCAGAGCTGGG - Intergenic
994891187 5:105639230-105639252 CCACGGAGCCAGCTGGAGCTGGG + Intergenic
998908814 5:146935845-146935867 GCTTGGACTCAGATAGAGCTGGG + Intronic
999719842 5:154391555-154391577 TCATGAACCTAGCTGGAGCTAGG - Intronic
1002678141 5:180935737-180935759 CCATGGAGCCAGGTGGGGCTGGG - Intronic
1003485104 6:6568850-6568872 GCATGGACAAAGGTGGAGGTGGG + Intergenic
1003794177 6:9581546-9581568 GCCAGGCACCAGGTGGAGCTGGG + Intergenic
1004516873 6:16328102-16328124 GCAGGGACCTCGGTGGAGCTTGG - Exonic
1004804419 6:19187294-19187316 GCAGGGAATCAGGTGGAGTTAGG + Intergenic
1005989870 6:30896156-30896178 GCTTGGCCCCAGGGGGAGCCAGG + Intronic
1007514494 6:42400549-42400571 GCATGGGCCCTGGTGGTGGTGGG - Intronic
1008843982 6:55939445-55939467 GCAGGGACATAGATGGAGCTGGG + Intergenic
1011732734 6:90282449-90282471 GCAGGGACATAGATGGAGCTGGG - Intronic
1012583183 6:100892919-100892941 GCATGGACCCAGCAGGAGTCTGG - Intergenic
1013052447 6:106549392-106549414 TCATGGCCACAGGTGGAGCCAGG + Intronic
1015206132 6:130641071-130641093 GAATGGACCCATGTGGATCATGG + Intergenic
1015206822 6:130649883-130649905 GAATGGACCCATGTGGATCATGG + Intergenic
1017003515 6:150013377-150013399 GCAGTGACCCTGGAGGAGCTGGG - Intergenic
1019448343 7:1082980-1083002 GCAGTGACCGAGGTGGGGCTGGG + Intronic
1019478880 7:1256982-1257004 GCAGGGTCCCAGGTGGGGCCTGG - Intergenic
1019896863 7:3989645-3989667 CCAGGGACCCACGGGGAGCTGGG - Intronic
1020091458 7:5344573-5344595 GCATGAAGCCAGGGGCAGCTGGG + Intronic
1023354451 7:39353094-39353116 GCAAGGAGGCAGGTGGACCTAGG + Intronic
1023909287 7:44542045-44542067 CCCTGGGCCCAGGTGGAGCAGGG - Intergenic
1024190470 7:47002095-47002117 GCATCATCCCAGGTGGAGCAGGG + Intergenic
1027353402 7:77334270-77334292 GCAGGGACACAGATGGAGCTGGG + Intronic
1028054678 7:86226679-86226701 CCTTGGAGCCAGTTGGAGCTGGG - Intergenic
1029022174 7:97376313-97376335 GCAGGGACACAGATGGAGCTGGG + Intergenic
1029899141 7:104021784-104021806 GCATGGAGCCAGCAGGAGCTGGG + Intergenic
1033101992 7:138481726-138481748 GCTTGGACCCAGGAGGACCCAGG + Intronic
1033256368 7:139805094-139805116 GCAGGGATCCTGGTGGTGCTGGG + Intronic
1033923618 7:146428036-146428058 GCAGGGACACGGATGGAGCTGGG - Intronic
1033956408 7:146854195-146854217 ACATGGACCCTGGTCCAGCTTGG - Intronic
1034430538 7:151039079-151039101 GCCTGTTCCCAGGTGGAGCCTGG - Intronic
1035607182 8:937676-937698 GCTGGGTGCCAGGTGGAGCTTGG + Intergenic
1035746692 8:1966248-1966270 CCACAGAGCCAGGTGGAGCTGGG + Intergenic
1037691334 8:21183719-21183741 CCATGAACCCAGGTGGAGCAGGG - Intergenic
1041205614 8:55495404-55495426 CCATGGAGCCAGCAGGAGCTGGG - Intronic
1041721966 8:60984068-60984090 GGAGGGACCCAGGAGGTGCTGGG - Intergenic
1041955932 8:63558406-63558428 CCATGGAGCCAGTGGGAGCTGGG + Intergenic
1045505061 8:102772362-102772384 GCAGGGACCCATATTGAGCTGGG - Intergenic
1045890167 8:107146705-107146727 GCATGGACACATGAGGAGCTTGG - Intergenic
1049334371 8:142075009-142075031 GCCTGAACCCACGTGCAGCTGGG + Intergenic
1050483837 9:6114047-6114069 CCATGGAGCCAGTGGGAGCTGGG + Intergenic
1051340242 9:16103823-16103845 GCATGGACTCCGGGGGGGCTGGG + Intergenic
1052708059 9:32016630-32016652 TCATGGAGCCAGCTGGAGCTGGG - Intergenic
1053294066 9:36900756-36900778 GCATGGACACAGGTGGTGGGAGG - Intronic
1054922385 9:70555194-70555216 GGATGCACCCAGGTGAAGCATGG - Intronic
1057260795 9:93582128-93582150 GCATGGACACAGAAGCAGCTAGG + Intronic
1057959737 9:99443139-99443161 GCTGGGACATAGGTGGAGCTGGG + Intergenic
1058270757 9:102968450-102968472 TCATGGAGCCAGCGGGAGCTGGG - Intergenic
1060564924 9:124582262-124582284 GCAAGGACACAGATGAAGCTGGG + Intronic
1062627053 9:137448104-137448126 GCCTGGACAGAGTTGGAGCTAGG - Exonic
1062627160 9:137448520-137448542 GCAGGGGCCCAGCTGGGGCTGGG - Exonic
1186223825 X:7376257-7376279 CCATGGAGCCAGTGGGAGCTGGG - Intergenic
1186343099 X:8663903-8663925 GCAGGGACGTGGGTGGAGCTGGG + Intronic
1190735053 X:53250589-53250611 GCAGGGGCCCTGGTGGGGCTGGG + Exonic
1190889818 X:54558311-54558333 GCCTGGAGCCATGTGGAACTAGG - Intronic
1192227955 X:69242289-69242311 GCAGGGACCCAGCTGGCTCTTGG - Intergenic
1198829074 X:140729713-140729735 GCATGGACCCAGTTGGTCATCGG - Intergenic
1201653225 Y:16314569-16314591 ACATGGGTCCAGGTGGAGCCAGG + Intergenic
1201935515 Y:19407136-19407158 CCATGGAGCCAGTGGGAGCTGGG - Intergenic