ID: 969594685

View in Genome Browser
Species Human (GRCh38)
Location 4:8142360-8142382
Sequence CCTGGGCTGCACCTCGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969594685_969594695 21 Left 969594685 4:8142360-8142382 CCAGCACCGAGGTGCAGCCCAGG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 969594695 4:8142404-8142426 TACGATGACTCTCCACCTTCGGG 0: 1
1: 0
2: 0
3: 8
4: 40
969594685_969594697 30 Left 969594685 4:8142360-8142382 CCAGCACCGAGGTGCAGCCCAGG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 969594697 4:8142413-8142435 TCTCCACCTTCGGGCACAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 175
969594685_969594694 20 Left 969594685 4:8142360-8142382 CCAGCACCGAGGTGCAGCCCAGG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 969594694 4:8142403-8142425 TTACGATGACTCTCCACCTTCGG 0: 1
1: 0
2: 0
3: 4
4: 50
969594685_969594696 29 Left 969594685 4:8142360-8142382 CCAGCACCGAGGTGCAGCCCAGG 0: 1
1: 0
2: 1
3: 26
4: 242
Right 969594696 4:8142412-8142434 CTCTCCACCTTCGGGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969594685 Original CRISPR CCTGGGCTGCACCTCGGTGC TGG (reversed) Intronic
900120573 1:1047025-1047047 CCTGGGCAGCAGGTCAGTGCCGG + Intronic
900194915 1:1371270-1371292 CCTGGGCATCACCTGGGTGAGGG - Intergenic
900495954 1:2976319-2976341 CCTGGTGTCCACCTGGGTGCTGG + Intergenic
900694951 1:4004061-4004083 CCTGGGCTGAGCCTGGGTGTGGG + Intergenic
901190777 1:7408563-7408585 CCTGGGCAGCACCTCTGCCCTGG + Intronic
901234660 1:7661479-7661501 CCTGGGCTGCACCATAGTGAGGG + Intronic
901238443 1:7679812-7679834 CCTGGGGTCCACCTCGGCCCAGG + Intronic
902377379 1:16036224-16036246 CCTGGGCTGTACCTTGGAGCTGG + Intergenic
902382557 1:16059482-16059504 TCTGGGCTGTACCTTGGAGCTGG + Exonic
903884339 1:26532141-26532163 CCTGGGCTGCACCCTGGGCCAGG - Intronic
904178423 1:28648108-28648130 CCTGGGCTGCTCCAAGGTGGTGG + Intergenic
904199825 1:28812403-28812425 CGGGGGCTGCAGCTCGGCGCCGG - Exonic
904294681 1:29511689-29511711 CCTGGGCTGCAGACCGGTGTCGG - Intergenic
906152785 1:43597785-43597807 CATGGGCTCCACCACGGTCCGGG + Exonic
907045619 1:51298437-51298459 CCTGTGCTGCTCCTCGGCCCGGG + Intronic
910884290 1:91949554-91949576 CCAAGGCCGCACCTCGGGGCCGG - Exonic
911612231 1:99970003-99970025 CCTGGGCTGCACCGAGCTGGCGG + Intronic
912450193 1:109763698-109763720 CCTGGGCTGCAGCTGGGAACAGG + Intronic
913392867 1:118333830-118333852 CATGCGCAGCACCTCGGTGGTGG - Intergenic
913451942 1:118998600-118998622 CCTTGGCTGCACCTCTGTCTGGG + Intergenic
915682505 1:157595323-157595345 CCTGGGAAGCACCTGGATGCAGG + Intronic
918265206 1:182836076-182836098 CCTGGGCTGCAGACCGGTACAGG - Intergenic
922481406 1:225941951-225941973 CCTGGGCTCCAGCTGAGTGCTGG - Intergenic
922481660 1:225943533-225943555 CCTGGGCTCCAGCTGAGTGCTGG + Intergenic
922567589 1:226610993-226611015 CCTGGGAGGCACATCAGTGCAGG + Intergenic
922790098 1:228306529-228306551 TCAGGGCTGCACCGCGGAGCTGG + Exonic
922819038 1:228471308-228471330 CCTGGGCTGCCCCTTCGCGCAGG + Intergenic
922846545 1:228689557-228689579 CCTGGGCTGCAGACAGGTGCTGG + Intergenic
923036338 1:230287617-230287639 CCGGGGCTGCAGCTCTGGGCTGG - Intergenic
924415234 1:243850510-243850532 CCCGGGCTGCGCCTCGCTGAGGG + Intronic
924638342 1:245809742-245809764 CCTGGGAAGCTCCTCTGTGCTGG - Intronic
1063103547 10:2972983-2973005 CCAGGGCTGACTCTCGGTGCTGG - Intergenic
1066759768 10:38739941-38739963 CCTGGCCTGGACCCCGGTCCTGG + Intergenic
1067239364 10:44477165-44477187 CCAGGGCTGCAGCTGGGAGCTGG + Intergenic
1069156269 10:65034673-65034695 ACTGGGCAGCTCCTCTGTGCAGG - Intergenic
1073265728 10:102227299-102227321 CCTGGGCTGCTTCTAGGCGCGGG + Intronic
1074085033 10:110203532-110203554 CCTGGTCAGAGCCTCGGTGCCGG - Intergenic
1074399063 10:113126804-113126826 CCTGGGCAGCATCTGGGCGCAGG + Intronic
1074857561 10:117484554-117484576 CCAGGGCTGCCCCTAGCTGCAGG + Intergenic
1075917537 10:126182067-126182089 CCTGGGATGCACTGCGTTGCCGG - Intronic
1077014103 11:392405-392427 CCTGGGGTGGACCTGGGTGCAGG + Intergenic
1077145362 11:1042009-1042031 CCTGGTCTTCCCCTCGGGGCTGG - Intergenic
1078068672 11:8094369-8094391 CCTGGGCTGCCTCTGGGTGTGGG + Intronic
1079303013 11:19296205-19296227 CCTGGGCTCCATCTCTGTGAAGG + Intergenic
1080768488 11:35318571-35318593 ACTGGTCTGCAGCTCGGTGTTGG - Intronic
1083291622 11:61693735-61693757 TCTGGGCTGCCCCTGGCTGCAGG - Intronic
1083996748 11:66276708-66276730 CCTGGGCTGGACCTCAGGACAGG + Exonic
1084313888 11:68332542-68332564 CGTGGGCTTCACCTGGGTCCAGG + Intronic
1084441866 11:69179161-69179183 GATGGGCAGCACCTCGGGGCAGG + Intergenic
1089183018 11:116595921-116595943 GCTGGGCTGCCCCTGGGGGCAGG - Intergenic
1090967496 11:131611717-131611739 ACTGGGCTGCAATTCGGTGGTGG + Intronic
1093524805 12:20093605-20093627 CCAGGGCTGCACCTGCTTGCGGG - Intergenic
1095859497 12:46900844-46900866 CCTGGGCTGCACTTGTGTGCCGG - Intergenic
1102795259 12:115683718-115683740 CCTGGCCTGACCCTCAGTGCAGG - Intergenic
1103367594 12:120394540-120394562 CCTTGGCTGCAGCTGGGAGCAGG - Intergenic
1104660024 12:130605003-130605025 CCTGGGCTACACACCTGTGCAGG - Intronic
1108571981 13:51760912-51760934 CCTGGGCTGCAGATGGGTACTGG - Exonic
1112816384 13:103278591-103278613 CCTGGGCTAAACCTCAGTTCTGG + Intergenic
1113286841 13:108858921-108858943 TATGGGCAGCACTTCGGTGCAGG + Intronic
1113877698 13:113604895-113604917 CATGGGCTCCACCTCGCTCCTGG - Intronic
1113881935 13:113631897-113631919 CCTCGGCTGCACACCTGTGCAGG - Intronic
1118563102 14:67108258-67108280 CCTGGGCTGCAGTTTGGTGATGG - Intronic
1122778365 14:104133117-104133139 CCTAGGCTGTCCCTCTGTGCTGG + Intergenic
1123421878 15:20141995-20142017 CCTGGCCTGGACCCCGGTCCTGG - Intergenic
1123435284 15:20249722-20249744 CCTGGCCTGCACCCCTCTGCAGG + Intergenic
1123443204 15:20304640-20304662 CCTGGCCTGGACCTCGGTCCTGG + Intergenic
1123531106 15:21148535-21148557 CCTGGCCTGGACCCCGGTCCTGG - Intergenic
1123948886 15:25251980-25252002 CCTGGGCTGCACCCTACTGCAGG - Intergenic
1124678667 15:31710506-31710528 CCTGCTCTGCACCTCTATGCAGG - Intronic
1124848120 15:33311168-33311190 GCTGCGCTGCGCCGCGGTGCCGG + Intronic
1125519212 15:40338939-40338961 GCTGGGCAGGACCTGGGTGCTGG + Intronic
1125679722 15:41523151-41523173 CCTGGGATGGACCTGGGAGCTGG + Intronic
1125715911 15:41819809-41819831 GCTGGGCTGGTCCTGGGTGCGGG + Intronic
1127261052 15:57326487-57326509 CCTGGCCTCCACCTCGGTCCCGG + Intergenic
1130566860 15:85003538-85003560 CCTTGGCTGAACCCCAGTGCAGG - Intronic
1130650263 15:85758435-85758457 CCAGGGCTGCACCTCTGGGCAGG + Intergenic
1131515277 15:93072857-93072879 CCTGGGCCGCCCCTCAATGCTGG - Intronic
1132565773 16:621978-622000 CCTGGGCAGAGCCTGGGTGCAGG + Intronic
1132638458 16:965756-965778 GCTGGGCCGCACCTCGGGGCTGG + Intronic
1132878672 16:2151455-2151477 GCTGGGCTGGACCTGGGAGCTGG + Intronic
1133288300 16:4701577-4701599 CATGCGCAGCACCTCGGTGAGGG - Intronic
1133386128 16:5371757-5371779 CCTGGGCTGCACCTTGGCCCTGG + Intergenic
1133386134 16:5371775-5371797 CCTGGGTTGCACCTTGGCCCTGG + Intergenic
1133777175 16:8905927-8905949 CCTTGGCAGGAGCTCGGTGCTGG + Intronic
1136287287 16:29251995-29252017 TCTGGGCTGCACCTCAATCCAGG + Intergenic
1136773920 16:32861104-32861126 CCTGGCCTGGACCCCGGTCCTGG + Intergenic
1136841360 16:33545318-33545340 CCTGGCCTGGACCCCGGTACTGG - Intergenic
1136896689 16:34000415-34000437 CCTGGCCTGGACCCCGGTCCTGG - Intergenic
1137797886 16:51237553-51237575 CCTGGGAGGCACCTTGCTGCAGG - Intergenic
1138163352 16:54776907-54776929 CAAGGGCTGTACCTCGCTGCTGG - Intergenic
1140418664 16:74797568-74797590 CCTGGGCTGCAGACCGGTACTGG - Intergenic
1141886915 16:86898632-86898654 CCTGGGCCGAACCTCAGCGCAGG - Intergenic
1142092900 16:88224628-88224650 TCTGGGCTGCACCTCAATCCAGG + Intergenic
1203076340 16_KI270728v1_random:1123215-1123237 CCTGGCCTGGACCCCGGTCCTGG + Intergenic
1203124442 16_KI270728v1_random:1561836-1561858 CCTGGCCTGGACCCCGGTACTGG + Intergenic
1203151525 16_KI270728v1_random:1845615-1845637 CCTGGCCTGGACCCCGGTACTGG - Intergenic
1143140288 17:4738729-4738751 CCTGGGCGGCCCCTCCTTGCAGG - Intronic
1143822398 17:9575511-9575533 TCTGGGCTGCATCTCGTTGCGGG - Intronic
1146666991 17:34711835-34711857 GCTGGGCTGCAGCCCGGTGTTGG - Intergenic
1147998498 17:44374658-44374680 CCTGAGCTTCCCCTCGGGGCAGG + Exonic
1148178404 17:45586316-45586338 CGCGGGCTGCAGCGCGGTGCGGG - Intergenic
1150578589 17:66452317-66452339 CCTGTGCTGCACCTGGATTCTGG - Intronic
1150644987 17:66972297-66972319 CATCGGCTGCCCCTCGGAGCAGG + Intronic
1151746500 17:76014468-76014490 GCTGGGCCGCACCTGGCTGCGGG + Exonic
1152324557 17:79627970-79627992 CCTGGGCTGCCTCTCTCTGCTGG + Intergenic
1152596050 17:81238392-81238414 CCTGGGCTGGACCTCAGAGGGGG - Intronic
1153302455 18:3603136-3603158 AATGGGCTGAACCTCGGAGCAGG - Intronic
1157479257 18:48042650-48042672 CCTGGGCTGCCCCATGGTGGAGG - Intronic
1157870138 18:51222581-51222603 CCTGGGCTGTAGATGGGTGCAGG + Intergenic
1158254061 18:55525792-55525814 CCTCGGCGGAACCTAGGTGCTGG + Intronic
1159903714 18:74071868-74071890 CCTGGCATGCTCCTAGGTGCTGG + Intergenic
1160869405 19:1270185-1270207 CCTGGGGGGCACCTCAGGGCAGG - Intronic
1161170454 19:2810115-2810137 CCTGGGCTGCTGCTGGCTGCCGG - Intronic
1161879390 19:6937279-6937301 CCTGGGCTGCTCCTGGGTGCTGG + Exonic
1161973288 19:7595810-7595832 CCTGGGCTCCTCCCCGGGGCGGG + Intergenic
1162531717 19:11239883-11239905 CCTGGGCTGCATCCCGGCCCCGG - Exonic
1162838364 19:13336875-13336897 CATGGGCTTAACCTCTGTGCTGG + Intronic
1164181056 19:22819175-22819197 ACTGGGCATCACCTTGGTGCTGG - Intergenic
1165429762 19:35765985-35766007 CCTTGGCTGCACCTCTCTCCCGG - Intronic
1165433141 19:35783722-35783744 CCCTGGCTGCACCTCGCTCCAGG - Intronic
1166966441 19:46531967-46531989 CCTGGGCTGCACCCCGTGTCTGG - Intronic
1168219469 19:54950169-54950191 CCTGGGGTGCACCACAGTCCTGG - Intronic
1168636682 19:58002475-58002497 CCTGGGCCGGACCTCGGCGCGGG - Exonic
925009205 2:469125-469147 CCAGGGCTGCACCTCGCAGGCGG - Intergenic
926670455 2:15572739-15572761 CCTGGGCTCCACCTCGGACAGGG + Intergenic
926710463 2:15875489-15875511 CCTGGGATGCAACTGGGGGCTGG - Intergenic
927943668 2:27121800-27121822 CCTGGGCTGCAAATTGGTACTGG - Intergenic
927945762 2:27134327-27134349 ACTGGGCTGCTCATCGCTGCGGG - Exonic
927964957 2:27262779-27262801 CCTGGGCTGGCCCTCGGCCCGGG - Intronic
929563464 2:42969964-42969986 CCTCGGCTGCAGCTGGGTGCGGG + Intergenic
932423037 2:71612630-71612652 CCTGGGCAGCATCTGGGTGGAGG - Exonic
933741471 2:85538000-85538022 CTGGGGCTGGGCCTCGGTGCAGG - Intergenic
934323088 2:91984286-91984308 CCTGGCCTGGACCCCGGTCCTGG + Intergenic
934756621 2:96828708-96828730 CCTGGGCTGCTTGTGGGTGCTGG + Intronic
934844871 2:97656301-97656323 CCTGGGCTGCACCCCCTTGCTGG + Exonic
938570044 2:132554557-132554579 CCAGGGCTGCACATCAGTGATGG - Intronic
939280502 2:140058172-140058194 CCTGGGCTCCACATCTGGGCAGG + Intergenic
940048192 2:149432587-149432609 CATGGGCTACACCAAGGTGCAGG + Intronic
941917804 2:170823574-170823596 CCAGGGCTGCATCCCTGTGCTGG + Intronic
948484980 2:238274766-238274788 CCTGGGCTACTCGTCGGTGCTGG - Intronic
948771374 2:240252855-240252877 CCTGCGCTGCAGGTGGGTGCTGG + Intergenic
1169211137 20:3766973-3766995 CTTGGGCTGCACCTCCCTCCCGG - Intronic
1170347706 20:15405430-15405452 GCTGGGCCACACCACGGTGCTGG - Intronic
1170933738 20:20792248-20792270 CCTGGGCAGCACCTCCCTGAAGG - Intergenic
1172273407 20:33667128-33667150 CCTGGGCCGCATCGCGGTGGTGG + Exonic
1176386174 21:6139508-6139530 CAGGCGGTGCACCTCGGTGCCGG - Intergenic
1179737299 21:43398744-43398766 CAGGCGGTGCACCTCGGTGCCGG + Intergenic
1179803976 21:43825821-43825843 CCTTGGCTGCCCCTCGGGCCTGG + Intergenic
1179876930 21:44273322-44273344 CCTGAGCTCAACCTCGGTCCTGG + Intergenic
1180193598 21:46181054-46181076 CCTGGGCCGGACCTCAGGGCTGG - Intronic
1180783455 22:18534492-18534514 CCTGGGCGCCACCTGGGGGCAGG + Intergenic
1181354842 22:22291679-22291701 CCTGGCCTGGACCCCGGTCCTGG - Intergenic
1181387506 22:22557081-22557103 CCTGGGCTGAACCAGGGGGCAGG + Exonic
1182429543 22:30291725-30291747 CCAGGGCTGGAGCTCAGTGCTGG - Intronic
1183352591 22:37342498-37342520 ACCGGGCTGCACCTCGGGGGAGG - Intergenic
1183858466 22:40652456-40652478 CCTGGGGCGCTCCCCGGTGCTGG - Intergenic
1184666648 22:45992781-45992803 CCAGGGCTGGAGCTCAGTGCAGG - Intergenic
1184895563 22:47404539-47404561 CTCGGGCTGCTCCTCTGTGCCGG - Intergenic
1185231317 22:49685848-49685870 CCTGGGCTTCAGCACCGTGCTGG - Intergenic
950500742 3:13361996-13362018 CCTGGGCTGCAGGTTGGGGCTGG - Intronic
950624963 3:14238573-14238595 CCTGGGCTGCGGATCGGTACTGG - Intergenic
950716673 3:14852785-14852807 CCTTGGCTGACCCTGGGTGCAGG + Intronic
951650828 3:24949707-24949729 CCTGGGATTCCCCTCTGTGCCGG + Intergenic
953787432 3:45921631-45921653 CCTGGGCTGCCCCTCAGAGGCGG - Exonic
954646270 3:52133544-52133566 CCTGGGCTGGACCTGTGTGCTGG - Intronic
954852829 3:53617936-53617958 CCTGGGCTTGGCCTGGGTGCTGG - Intronic
955687795 3:61562969-61562991 CGCGGGCAGCACTTCGGTGCCGG + Intronic
957665463 3:83219062-83219084 TCTCTGCGGCACCTCGGTGCCGG - Intergenic
964273959 3:154988175-154988197 CATGGGCTGCTCCTCGGGCCTGG - Intergenic
966235864 3:177700923-177700945 CCTGGACTGCATCCCGGTGGGGG - Intergenic
967739832 3:192992840-192992862 CCTGGGCTGAACCCCAGTTCTGG + Intergenic
968623372 4:1614665-1614687 CCTGGGCTGCCCCCAGGAGCAGG - Intergenic
968652089 4:1764162-1764184 CCAGGGCTGCACCTGAGGGCTGG - Intergenic
968817279 4:2828635-2828657 ACTGGGCTGCAGCTCAGGGCTGG - Intronic
968928406 4:3562401-3562423 CCTGGGCTGCACCTTTGGGCAGG - Intergenic
969178659 4:5420588-5420610 GCTGTGCTGCATCTCAGTGCTGG - Intronic
969594685 4:8142360-8142382 CCTGGGCTGCACCTCGGTGCTGG - Intronic
969601748 4:8180446-8180468 CCTGAGCTGGTCCTCGGGGCTGG - Intergenic
975682051 4:76886770-76886792 CCTGGTCTGTAGCTGGGTGCTGG + Intergenic
976921902 4:90452569-90452591 GCTGGGCTGGACCTCGGGCCTGG + Intronic
981080643 4:140636053-140636075 CCTGGCCTGAACATGGGTGCAGG + Intronic
988027325 5:25713367-25713389 CCTGGGCTGCAGACCCGTGCTGG + Intergenic
990989752 5:61673484-61673506 CCTGGGCTGGATCTTGGAGCAGG - Intronic
991639607 5:68739440-68739462 CATGGGCTGCACCTGGCTGCAGG - Intergenic
995099242 5:108278581-108278603 CCTGGCCTGCAACTCAGTCCTGG - Intronic
998307810 5:141096508-141096530 CCGGGGCACCAGCTCGGTGCAGG - Exonic
998308448 5:141102361-141102383 CCGGGGCACCAGCTCGGTGCAGG - Exonic
998310356 5:141123707-141123729 CCGGGGCACCAGCTCGGTGCAGG - Exonic
998312797 5:141151963-141151985 CCGGGGCACCAGCTCGGTGCAGG - Exonic
998313486 5:141157712-141157734 CCGGGGCACCAGCTCGGTGCAGG - Intergenic
998315557 5:141179749-141179771 CCGGGGCACCAGCTCGGTGCAGG - Exonic
998316654 5:141189030-141189052 CCGGGGCACCAGCTCGGTGCAGG - Exonic
998317288 5:141194264-141194286 CCGGGGCACCAGCTCGGTGCAGG - Exonic
998317960 5:141201486-141201508 CCGGGGCACCAGCTCGGTGCAGG - Exonic
998318920 5:141210619-141210641 CCAGGGCACCAGCTCGGTGCAGG - Exonic
998319487 5:141215835-141215857 CCGGGGCACCAGCTCGGTGCAGG - Exonic
998320461 5:141225217-141225239 CCGGGGCACCAGCTCGGTGCAGG - Exonic
998322039 5:141241628-141241650 CCGGGGCATCAGCTCGGTGCAGG - Intergenic
998322701 5:141247290-141247312 CCGGGGCACCAGCTCGGTGCAGG - Exonic
999119928 5:149201361-149201383 CCTGTGCTGCATCACTGTGCGGG + Intronic
999326620 5:150648191-150648213 CCTGAGTTCCACCTCGCTGCCGG + Exonic
1000660545 5:163933248-163933270 CCTGGGCAGGACATCTGTGCAGG + Intergenic
1002377220 5:178797176-178797198 CCTGTGCTGCACCTCAGTGAGGG - Intergenic
1002505804 5:179678433-179678455 CGGGGACTGCCCCTCGGTGCTGG - Intergenic
1002571164 5:180140088-180140110 CCTGGCCTGGACCCAGGTGCTGG + Intronic
1003198900 6:3940850-3940872 CCTGGGCTGCCTGTCTGTGCAGG - Intergenic
1003351880 6:5325442-5325464 CCTGGGCTGCCTGTCTGTGCAGG + Intronic
1003880299 6:10474530-10474552 CTTGGGCTGCATCTGGGTCCTGG + Intergenic
1006388086 6:33743133-33743155 CCTGGGCCCCAGCTCAGTGCAGG + Intronic
1006456733 6:34136276-34136298 CCCTGGCTGCTCCTCTGTGCTGG + Intronic
1007125049 6:39418944-39418966 CCTGTGCCTCACCTCTGTGCTGG - Intronic
1007312550 6:40958116-40958138 TCTGGGCTGAAGCTCTGTGCTGG - Intergenic
1007781620 6:44257659-44257681 CCTGGGCTGCCCCTGGGCGCGGG + Intronic
1013441972 6:110179856-110179878 CCTCGGCTGCACCTGGGCACTGG - Exonic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1018126808 6:160690504-160690526 CCTGGGCTGAACCTGGGTGTGGG - Intergenic
1018149745 6:160926588-160926610 CCTGGGCTGAATCTGGGTGCGGG + Intergenic
1019192010 6:170256974-170256996 CCTCGGCGCCACCTGGGTGCTGG - Intergenic
1019338443 7:496032-496054 CCTGGGCTGCACCTGGATCTGGG - Intergenic
1020130227 7:5555357-5555379 GCTGGGCTGCACCCCCGGGCCGG - Intronic
1022247034 7:28570550-28570572 CCTTGGCTGCCCCTGGGTCCTGG + Intronic
1024231496 7:47367201-47367223 CCTGGCGTGCACCTCTGTGCAGG + Intronic
1024505407 7:50158178-50158200 CCTGGGCCTCACCTAGGGGCTGG - Intronic
1028984449 7:96998629-96998651 CCTGGGCTGGACTTAGGTGGTGG - Intergenic
1029609298 7:101618216-101618238 CCTGGGCTGAGCCTCTCTGCTGG - Intronic
1029927205 7:104329651-104329673 CCTGCCCTGCCCCTCGCTGCTGG + Intronic
1030382250 7:108825454-108825476 CCTGGGCAGCAGCTGGGTGTGGG + Intergenic
1034438797 7:151076368-151076390 CCTCGGCTGTCCCTCGGTGGCGG - Exonic
1035091879 7:156319589-156319611 CCACGGCTGCTCCTCTGTGCAGG - Intergenic
1035311946 7:157975072-157975094 CCTGGGCTGCACCCTGCTGATGG - Intronic
1037921501 8:22809459-22809481 CCTGGGCTGGGCCTAGGTGGTGG + Intronic
1038702199 8:29859272-29859294 CCTGGCCTGAACTTCTGTGCTGG + Intergenic
1039752023 8:40487342-40487364 CCAGGGCTGCACCTTGCTTCTGG - Intergenic
1042695156 8:71547628-71547650 CCTGGGCCCCACCCCGGGGCAGG - Exonic
1048275444 8:133062461-133062483 CCTGGGCATCTCCCCGGTGCCGG + Intronic
1049289917 8:141796370-141796392 CCTGGGCTGCGACTCCGTGCAGG + Intergenic
1049645461 8:143733852-143733874 CCCGGGCAGCACCTGGGGGCGGG + Intergenic
1049647260 8:143741036-143741058 CCCGGGCAGAGCCTCGGTGCTGG - Intergenic
1049690659 8:143957551-143957573 CCTGGGCTCAACCTTGGTTCTGG - Intronic
1049813380 8:144586392-144586414 TCTGGGCTACACCTTGGTGACGG + Intronic
1053312084 9:37026617-37026639 CCTGGGCAGCCCCTTGGCGCCGG - Intronic
1053351773 9:37418012-37418034 CCAGGCCTGCCCCTCGGTTCCGG + Intergenic
1053691875 9:40590709-40590731 CCTGGCCTGGACCCCGGTCCTGG + Intergenic
1053803290 9:41777543-41777565 CCTGGGCTGCGCCTTTGGGCAGG - Intergenic
1054191584 9:61988853-61988875 CCTGGGCTGCGCCTTTGGGCAGG - Intergenic
1054272928 9:63046782-63046804 CCTGGCCTGGACCCCGGTCCTGG - Intergenic
1054303132 9:63391675-63391697 CCTGGCCTGGACCCCGGTCCTGG + Intergenic
1054401911 9:64718185-64718207 CCTGGCCTGGACCCCGGTCCTGG + Intergenic
1054435517 9:65202500-65202522 CCTGGCCTGGACCCCGGTCCTGG + Intergenic
1054461732 9:65468759-65468781 CCTGGGCTGCGCCTTTGGGCAGG + Intergenic
1054494876 9:65819187-65819209 CCTGGCCTGGACCCCGGTCCTGG - Intergenic
1054646787 9:67598859-67598881 CCTGGGCTGCGCCTTTGGGCAGG + Intergenic
1056800380 9:89686806-89686828 CCTGGACTGCACCCCAGTGCTGG - Intergenic
1057205516 9:93169840-93169862 GCTGGCCTGCAGCTCTGTGCAGG + Intergenic
1057209602 9:93192611-93192633 CCTGGGCAGCCCCTCTGGGCAGG - Intronic
1057322912 9:94030844-94030866 CCTGGGCTGCTCCCCGTGGCGGG - Intronic
1057700503 9:97360423-97360445 CCAGGGCTGCCCCTGGGTGCAGG - Intronic
1060260746 9:122071608-122071630 CCCGTGCTGCACCTAGGGGCTGG - Intronic
1061081897 9:128375940-128375962 CCTGGGCTTCACATCGGGGCCGG + Intronic
1062424734 9:136500883-136500905 CCTGGGCTGCAGCTGGGGACCGG - Intronic
1185785087 X:2884069-2884091 CCTGGGCTGCAGACCAGTGCTGG - Intergenic
1187361118 X:18628551-18628573 GCTGGCCTGCCCTTCGGTGCGGG - Exonic
1187388998 X:18873591-18873613 CCTGGGCTTCCCCTCCGTGCAGG + Intergenic
1190276927 X:48904870-48904892 CTTTGGCTGCACCTCGGGGAAGG + Exonic
1192556302 X:72092315-72092337 CCTGGGCTTCTCCTGGGTTCTGG + Intergenic
1195238622 X:102927928-102927950 CCAGGGCTGCAGCTGTGTGCAGG + Intergenic
1197729192 X:129795551-129795573 CCTGGACAGCTCCTCAGTGCAGG - Intergenic
1199264695 X:145817485-145817507 CCTGGGCTGCAGCTCGGGCTCGG - Intergenic
1200208247 X:154333024-154333046 CCTGGGCTGCACCTGGTATCAGG + Intergenic
1202583082 Y:26402606-26402628 CCTGGCCTGGACCCCGGTCCTGG - Intergenic