ID: 969595589

View in Genome Browser
Species Human (GRCh38)
Location 4:8147809-8147831
Sequence GGTCACCAGTGACCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969595589_969595592 2 Left 969595589 4:8147809-8147831 CCAGCTTGTGGTCACTGGTGACC 0: 1
1: 0
2: 0
3: 12
4: 151
Right 969595592 4:8147834-8147856 AGCCCCTAGACACTCACAGGTGG No data
969595589_969595591 -1 Left 969595589 4:8147809-8147831 CCAGCTTGTGGTCACTGGTGACC 0: 1
1: 0
2: 0
3: 12
4: 151
Right 969595591 4:8147831-8147853 CGCAGCCCCTAGACACTCACAGG 0: 1
1: 0
2: 1
3: 8
4: 105
969595589_969595596 21 Left 969595589 4:8147809-8147831 CCAGCTTGTGGTCACTGGTGACC 0: 1
1: 0
2: 0
3: 12
4: 151
Right 969595596 4:8147853-8147875 GTGGCCTTTGCCCAGCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969595589 Original CRISPR GGTCACCAGTGACCACAAGC TGG (reversed) Intronic
900114667 1:1023401-1023423 GGGGACCACTGACCACAGGCTGG - Intronic
901296954 1:8168174-8168196 GGTGACCAGTCACCACAGGAAGG - Intergenic
903853186 1:26320531-26320553 GATGTCCAGTAACCACAAGCAGG - Intergenic
906078535 1:43068986-43069008 GGTAATCACTGACAACAAGCCGG + Intergenic
907735063 1:57104283-57104305 GGTCACAAGTGGCCCAAAGCAGG + Intronic
908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG + Intronic
909284798 1:73802196-73802218 AGTCTTCAGTCACCACAAGCAGG + Intergenic
909877416 1:80825594-80825616 GGTCAACAGTCTCCACAAGTGGG + Intergenic
911116969 1:94256153-94256175 GGTCACCTGTCTCCTCAAGCAGG + Intronic
912509981 1:110182778-110182800 GGTCACTAGTGACCTCAACAAGG + Intronic
1063453699 10:6168553-6168575 GGTTTCCAGTGGCCACCAGCAGG - Intronic
1067878882 10:50026722-50026744 GGTCACCAGTGACAGCAGGAAGG + Intergenic
1067892860 10:50151220-50151242 GGTCACCAGTGACAGCAGGAAGG - Intergenic
1069609950 10:69766323-69766345 GACCACCAGTGGCCACAACCAGG - Intergenic
1076046656 10:127299674-127299696 CATGACAAGTGACCACAAGCTGG - Intronic
1076114640 10:127886794-127886816 AGTCACCATTGAGCACAAGTAGG - Intronic
1077049144 11:558940-558962 GGTCACCTGGGACCTCCAGCAGG - Exonic
1083372343 11:62192374-62192396 GGTCACCTGGGACCACAGGGTGG + Intronic
1083793860 11:65003269-65003291 GGTCACCAGTGACCTCAGAAAGG + Intergenic
1084459883 11:69290847-69290869 GCTGACCAGTGCCCACATGCTGG + Intergenic
1084916040 11:72429769-72429791 AGTCTCCAGTGACCACTGGCAGG - Intronic
1085345933 11:75768344-75768366 TGATACCAGTGACCAAAAGCGGG + Intronic
1086741896 11:90379412-90379434 GCTCTCCAATGCCCACAAGCTGG + Intergenic
1088020476 11:105112186-105112208 GGTCACCAGACACCTCATGCAGG + Intergenic
1088914402 11:114216504-114216526 GGTTACCAGTGTCCAAAGGCTGG - Intronic
1090140839 11:124258721-124258743 GGTCAGCATTTGCCACAAGCTGG - Intergenic
1091449914 12:565944-565966 CCTCACCAATGACCACGAGCAGG + Exonic
1092272107 12:7031399-7031421 GGGCACCAGTGAGCACAGGAGGG - Intronic
1092282003 12:7104679-7104701 GGCCACCCGTGACCCCAAACTGG + Intronic
1092477057 12:8828451-8828473 AGGCACCATTCACCACAAGCTGG - Intronic
1097492030 12:60282647-60282669 GGGCACCAATGAGCACAAGAGGG - Intergenic
1100567857 12:95815400-95815422 TCTCTCCACTGACCACAAGCCGG + Intronic
1103420062 12:120773511-120773533 GCTCACCAGTAACCAAAAGCGGG + Intronic
1103829530 12:123767859-123767881 TGTCACAAGTGACCACAGACTGG + Intronic
1108282466 13:48873726-48873748 GGTCACCTGAGACCACCAACAGG + Intergenic
1113360166 13:109623198-109623220 TGTCACAAATGACCACAAACTGG - Intergenic
1114337180 14:21702362-21702384 GGTCACCAGTGACCTCATAATGG + Intergenic
1115307713 14:31949672-31949694 GGTCAGCAGTGACTAAAAGCTGG - Intronic
1118770389 14:68938990-68939012 GGTCACCAGGGCCAAGAAGCAGG + Intronic
1120152179 14:81048579-81048601 GGCCACCAGTGACCCTGAGCTGG + Intronic
1120686389 14:87542826-87542848 GGTCATCTGTGCCCACAGGCTGG - Intergenic
1121124808 14:91399240-91399262 CGACACCAGTGACACCAAGCTGG + Intronic
1124553819 15:30707794-30707816 GGTGACCAGTGTCTTCAAGCTGG + Intronic
1124677430 15:31697878-31697900 GGTGACCAGTGTCTTCAAGCTGG - Intronic
1125524870 15:40368446-40368468 GGTCGCCAGTGTCCACAGGCAGG - Exonic
1127328347 15:57916509-57916531 GGGCACCGGTGACCCCAGGCAGG + Intergenic
1130792300 15:87168407-87168429 GAGCACCAGTGTCCCCAAGCTGG + Intergenic
1131575668 15:93588192-93588214 GTTCTCCAGTGACATCAAGCAGG + Intergenic
1133741920 16:8658357-8658379 GGTAACAAATGACCACAAACTGG - Intergenic
1135404033 16:22185340-22185362 GTTCACCAGGGAACACATGCAGG + Intronic
1136296781 16:29308505-29308527 GGTCTCCAGCGACACCAAGCTGG - Intergenic
1138306538 16:55981672-55981694 TGTCATCAGTGACCACAAAAAGG - Intergenic
1140647578 16:77049816-77049838 TGTCACAAGTAACCAAAAGCAGG + Intergenic
1141579011 16:84984575-84984597 GGTCATAAGTGACCAAAAACTGG - Intronic
1141740271 16:85887066-85887088 CGTCCCCAGAGACCACAAGTTGG - Intergenic
1142160110 16:88552962-88552984 CGTCACACGTGACCACCAGCCGG - Intergenic
1145944314 17:28761488-28761510 GGCCACCTGAGGCCACAAGCTGG - Intronic
1147468430 17:40632397-40632419 GGTCACCAGTAACCATAAAAAGG + Intronic
1149815492 17:59719251-59719273 GGTCACAGGTCACCACAGGCTGG - Intronic
1151945423 17:77317153-77317175 TGTAACGAGTGGCCACAAGCTGG + Intronic
1152202060 17:78952885-78952907 GCTCACCACTGACCACATGATGG - Intergenic
1152991669 18:368955-368977 GGTCACCAGTCAGTATAAGCTGG - Intronic
1155260954 18:24041928-24041950 GGCCACCAGTGTCATCAAGCTGG + Intronic
1156378322 18:36534042-36534064 GGTCAGAAGTGTCCACAAACAGG - Intronic
1157351774 18:46894341-46894363 GGTCACCAGAGCCCACATGGGGG + Intronic
1157488861 18:48108347-48108369 GATCAGCAGCGACCACAGGCAGG + Intronic
1157937731 18:51891913-51891935 TGTAACAAGTGACCACAACCAGG + Intergenic
1160568020 18:79798748-79798770 CGTCCCCAGTGACCACAGTCCGG - Intergenic
1161293757 19:3509058-3509080 GGTCACTGGTGACCACAGGGAGG - Intronic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1166267012 19:41690656-41690678 GGTCTCCAGAGACCACAGCCAGG + Intronic
1167498959 19:49835120-49835142 GGTCATCACCAACCACAAGCAGG + Exonic
1168467932 19:56618991-56619013 GGTCCCCACTGACAAAAAGCCGG - Intronic
925457283 2:4026995-4027017 GGTCACCAGTGTCAGCAGGCTGG - Intergenic
926243795 2:11107249-11107271 GGTCCTCAGTGACCACGTGCTGG - Intergenic
927352781 2:22137385-22137407 GGTCACCAATGACCTCCACCTGG - Intergenic
928663767 2:33530058-33530080 GGGCTCTAGTGACCACAAGATGG - Intronic
932630902 2:73342500-73342522 GGTCACCAGTGACCTCCATGTGG - Intergenic
933119050 2:78513208-78513230 TGTCATCATTGACCAAAAGCAGG - Intergenic
937679389 2:124627297-124627319 GGTCACCAGAAACCACAGACAGG + Intronic
938147477 2:128848821-128848843 GGTCTTCAGTGGACACAAGCTGG - Intergenic
945461659 2:210116420-210116442 GGCCAGCAGTGACCACTACCTGG - Intronic
947073952 2:226320746-226320768 GGTCACCAGTCGCCGCTAGCTGG + Intergenic
947759411 2:232592872-232592894 GGTCATCAGTCCCCACCAGCAGG - Intergenic
947760299 2:232599219-232599241 GCTCACCAGTGACCCAGAGCTGG - Intergenic
1170155128 20:13262245-13262267 GGCCACCAGTGGCCACCAGGGGG - Intronic
1175734894 20:61378340-61378362 GGTCACCAATTAGCACAAGGTGG + Intronic
1181119086 22:20653486-20653508 GGTCACCAGTGACAACAGAAAGG - Intergenic
951190508 3:19764418-19764440 GGCCACCTGTGACCCCGAGCTGG - Intergenic
952845186 3:37682300-37682322 GGTCACCAGTGACCTCCAGAAGG + Intronic
955046641 3:55367239-55367261 TGCCACCAGTGAACACAGGCAGG + Intergenic
955207336 3:56908189-56908211 AGACACCAGTGACCCCGAGCGGG + Intronic
956821970 3:72962088-72962110 GGGCTCCAGTGACCCCAGGCAGG - Intronic
963905387 3:150769640-150769662 GCTGACCAGTGGCCACAACCTGG - Intergenic
968503042 4:960054-960076 AGTCACCAGTCACCACCACCCGG + Exonic
968711990 4:2126074-2126096 GGACTCCAGTGCCCAAAAGCTGG + Intronic
968919408 4:3514978-3515000 GTTCACCCGGGACCACAAGATGG - Intronic
969087811 4:4669517-4669539 GGTCACCGTTGCCCATAAGCTGG - Intergenic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
973238269 4:47929632-47929654 GGTCACCAGTGACCCCTATATGG - Intronic
975285334 4:72611129-72611151 GCTCTCCAGTGGCCACAACCAGG - Intergenic
981012825 4:139943347-139943369 GGTCACAAGTGGCCAGAGGCTGG + Intronic
981210679 4:142100412-142100434 TGTCACCAGAGGCCAAAAGCTGG - Intronic
984478730 4:180270918-180270940 CCTAACCAATGACCACAAGCTGG - Intergenic
984589483 4:181601143-181601165 TGTAACCAATGACCACAAACTGG + Intergenic
986495017 5:8332857-8332879 GGTCAGCGGTGAACACAAGGTGG + Intergenic
986646484 5:9921294-9921316 GGACACCAGTGAGCACTTGCTGG - Intergenic
988600072 5:32631576-32631598 AGTCAGCAGTGACCACTTGCAGG + Intergenic
988609637 5:32712382-32712404 GGTCTACAGCGACGACAAGCTGG + Exonic
991341510 5:65615915-65615937 GTTCCCCACTGACCACAAACAGG + Intronic
994816394 5:104592678-104592700 GGTCCCCAAAGACCACAAGTTGG - Intergenic
996032665 5:118723198-118723220 TGTCATAAATGACCACAAGCTGG + Intergenic
997523018 5:134535330-134535352 GGTCAGCAGTGTACAGAAGCGGG - Intronic
1002109304 5:176897528-176897550 GGTCACCAGTGACCACGTGGAGG - Intronic
1003162016 6:3644160-3644182 GGTCACCAGTCCCCACAGGCGGG - Intergenic
1005290553 6:24374918-24374940 GGACACTGGTCACCACAAGCTGG - Intergenic
1007163399 6:39810948-39810970 GCCCACCAGTGGCCACAAACTGG - Intronic
1007731467 6:43950176-43950198 GCTCAGCAGTGAGCACAAGGAGG - Intergenic
1012201460 6:96411428-96411450 GGTCACCAGTGAGGAGGAGCAGG + Intergenic
1013300867 6:108803854-108803876 GGTCACCAGGGACCTCCATCTGG - Intergenic
1015219261 6:130785362-130785384 GGCCAGCAGCCACCACAAGCTGG + Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1027428075 7:78082072-78082094 GGACACAAGTAACCACAAGGCGG - Intronic
1027801281 7:82753288-82753310 GAGCATCAGTGGCCACAAGCGGG + Intergenic
1028848855 7:95513761-95513783 TGTCACAAGTTACCACAAACTGG - Intronic
1030058201 7:105601640-105601662 GGACAGCAGTCACCAGAAGCCGG + Intergenic
1033822172 7:145147945-145147967 GGGCACCATGGACCACATGCTGG + Intergenic
1034576163 7:152000365-152000387 GGTCAGCAGTTCCCACAAACTGG - Intronic
1035036983 7:155901930-155901952 TGTCGTCAGTGACCACAAGGAGG + Intergenic
1035037000 7:155902007-155902029 TGTCGTCAGTGACCACAAGGAGG + Intergenic
1035037017 7:155902084-155902106 TGTCGTCAGTGACCACAAGGAGG + Intergenic
1036166979 8:6444652-6444674 AGTCACCCCTGACCAAAAGCAGG + Exonic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1037348539 8:17924135-17924157 GGTAACCAGAGAACACCAGCAGG - Intronic
1039299240 8:36191571-36191593 GTTCTCCAGTGAACACCAGCTGG - Intergenic
1039678323 8:39698470-39698492 GGTCTCCAGTGGACACTAGCTGG - Intronic
1041201134 8:55452641-55452663 GGTCACCAGTGACCACCTCAAGG - Intronic
1041261329 8:56022788-56022810 GGTCATCAGTGAATATAAGCTGG - Intergenic
1042856565 8:73273482-73273504 GCTCATCAGTGACCACAGTCTGG - Intergenic
1045002939 8:97893892-97893914 CACCACCAGAGACCACAAGCTGG - Intronic
1047572177 8:126110913-126110935 GTTCACCAGAGGACACAAGCTGG - Intergenic
1048058293 8:130890711-130890733 GAGCACCAGAGACCACAGGCTGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG + Exonic
1051755250 9:20392663-20392685 GTTCACCAGTAACCCAAAGCTGG - Intronic
1051797964 9:20896464-20896486 GTTCACCAGTGAACACATGTGGG + Intronic
1055441002 9:76336171-76336193 AGTCTCAAGTTACCACAAGCTGG + Intronic
1055574349 9:77647316-77647338 GGTCACCACAGACCCCAAGCTGG + Intronic
1056442823 9:86637627-86637649 GGACATCAGGGACCACAAGGTGG + Intergenic
1056766042 9:89445355-89445377 TCTCACCAGTGACCACAAACTGG + Intronic
1057266183 9:93619588-93619610 GGCCACCAGGAACCACCAGCAGG - Intronic
1062036789 9:134386041-134386063 AGACACCTGTGACCACAAGGCGG - Intronic
1062234534 9:135501500-135501522 GGCCACCTGAGACCACAAGGCGG + Intronic
1062479055 9:136743084-136743106 GGCCAGCAGTGACCACCAGGTGG - Intronic
1186195642 X:7108379-7108401 GGTCTCCAGTGTCCACAGGGTGG - Intronic
1186635959 X:11405232-11405254 GGTCACCTGGGACCTCAAGGTGG - Intronic
1187611822 X:20951638-20951660 GGCCCCCAGTGAGCTCAAGCTGG - Intergenic
1189405090 X:40714656-40714678 GATCAGCAGTGTCCACAAACAGG + Exonic
1190151495 X:47953890-47953912 GGTCACCTGTGGCCAGAAGTAGG + Intronic
1191667741 X:63720730-63720752 GGTGACCAATGGCAACAAGCTGG + Intronic
1192901540 X:75503746-75503768 GGTAATAAATGACCACAAGCTGG + Intronic
1194890784 X:99375953-99375975 AGCCACCCATGACCACAAGCTGG + Intergenic
1195941888 X:110173995-110174017 GGACACCAGTGACCAGAATCTGG - Exonic
1197730587 X:129806031-129806053 TGAGACCAGTGACCCCAAGCAGG + Exonic