ID: 969595968

View in Genome Browser
Species Human (GRCh38)
Location 4:8149474-8149496
Sequence CTGTGGACACAGACCAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 221}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969595968_969595979 16 Left 969595968 4:8149474-8149496 CCCAGCTTGGTCTGTGTCCACAG 0: 1
1: 0
2: 1
3: 15
4: 221
Right 969595979 4:8149513-8149535 GAAGCAGAGGGCCTAGAGATGGG 0: 1
1: 1
2: 5
3: 23
4: 244
969595968_969595972 -10 Left 969595968 4:8149474-8149496 CCCAGCTTGGTCTGTGTCCACAG 0: 1
1: 0
2: 1
3: 15
4: 221
Right 969595972 4:8149487-8149509 GTGTCCACAGGTTCAGAGGAAGG 0: 1
1: 0
2: 3
3: 10
4: 193
969595968_969595977 4 Left 969595968 4:8149474-8149496 CCCAGCTTGGTCTGTGTCCACAG 0: 1
1: 0
2: 1
3: 15
4: 221
Right 969595977 4:8149501-8149523 AGAGGAAGGAGGGAAGCAGAGGG No data
969595968_969595976 3 Left 969595968 4:8149474-8149496 CCCAGCTTGGTCTGTGTCCACAG 0: 1
1: 0
2: 1
3: 15
4: 221
Right 969595976 4:8149500-8149522 CAGAGGAAGGAGGGAAGCAGAGG No data
969595968_969595978 15 Left 969595968 4:8149474-8149496 CCCAGCTTGGTCTGTGTCCACAG 0: 1
1: 0
2: 1
3: 15
4: 221
Right 969595978 4:8149512-8149534 GGAAGCAGAGGGCCTAGAGATGG 0: 1
1: 0
2: 3
3: 52
4: 471
969595968_969595973 -7 Left 969595968 4:8149474-8149496 CCCAGCTTGGTCTGTGTCCACAG 0: 1
1: 0
2: 1
3: 15
4: 221
Right 969595973 4:8149490-8149512 TCCACAGGTTCAGAGGAAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 310
969595968_969595975 -6 Left 969595968 4:8149474-8149496 CCCAGCTTGGTCTGTGTCCACAG 0: 1
1: 0
2: 1
3: 15
4: 221
Right 969595975 4:8149491-8149513 CCACAGGTTCAGAGGAAGGAGGG 0: 1
1: 1
2: 4
3: 63
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969595968 Original CRISPR CTGTGGACACAGACCAAGCT GGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900790011 1:4673654-4673676 CTGTGGACACAGACGCGGCCAGG + Intronic
901447621 1:9317969-9317991 CTGTGGAACCAGAGGAAGCTGGG + Intronic
901549418 1:9984399-9984421 CTTTGTACAGAGAACAAGCTTGG + Exonic
902124158 1:14194518-14194540 CTGGGGACACAGACAACGATGGG - Intergenic
903008874 1:20316593-20316615 CTGTGGAGACAGAACAGGATGGG + Intronic
903303264 1:22393872-22393894 CTGTGGATACAGGCCAGGCATGG + Intergenic
904463334 1:30693303-30693325 CTGTGGACCTAGCCCAGGCTTGG + Intergenic
906515163 1:46434664-46434686 CTGGGGACATAGACCACTCTTGG + Intergenic
906702326 1:47868854-47868876 CTGTGGACACTTGCCCAGCTGGG - Intronic
907571318 1:55486620-55486642 CTGTGTTCACAGCCCAGGCTGGG + Intergenic
908645755 1:66275945-66275967 CTGTGTCCACAGAGTAAGCTGGG + Intronic
912473664 1:109922853-109922875 CACTGGCCACAGGCCAAGCTAGG - Intronic
913098888 1:115545225-115545247 GTGAGGACACAGACCAACCCTGG + Intergenic
914333851 1:146697681-146697703 CTGTGGTCACAGCCCTACCTGGG + Intergenic
914919295 1:151836986-151837008 CTCTGGACTCAGGCCAGGCTTGG - Intergenic
918230978 1:182531529-182531551 CTCTGGAGTCAGATCAAGCTGGG - Intronic
918703216 1:187631390-187631412 CTCTGTGCACAGACCAAGGTAGG + Intergenic
922151414 1:223008130-223008152 CCGTGGAGACAGAGCAGGCTCGG - Intergenic
923660003 1:235949775-235949797 CTGTGGACTCCCACCCAGCTGGG + Intergenic
1062968795 10:1630198-1630220 CTGTGGCCAGAGACCATTCTGGG + Intronic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1068883879 10:62078616-62078638 CAGTGAACACAGACCATGCATGG - Intronic
1069796585 10:71056730-71056752 CTCTGGACCCAGACAAACCTTGG - Intergenic
1070518462 10:77229630-77229652 CTTTGGACTCAGACCGAGGTGGG - Intronic
1072034955 10:91554984-91555006 CTGGGAACACGGACCAAGCTCGG + Intergenic
1072662252 10:97370275-97370297 CTGGGGACAGAGACCAACGTGGG + Intronic
1074533136 10:114310609-114310631 ATGTGGCCTCAGACCCAGCTGGG + Intronic
1077617214 11:3685381-3685403 CAGTGGACACAGAAAAAGCAGGG + Intronic
1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG + Intergenic
1078358387 11:10649546-10649568 CTGTGCAGTCATACCAAGCTGGG - Intronic
1079245722 11:18750867-18750889 CTGTGGAGACCCACCAACCTGGG - Intronic
1080409679 11:32011850-32011872 CTGTGGAGCCAGACAGAGCTGGG - Intronic
1080893092 11:36426583-36426605 CTTTGGATTCAGACCAACCTTGG + Intronic
1083591473 11:63897833-63897855 CCCTTTACACAGACCAAGCTGGG + Intronic
1083866457 11:65456402-65456424 CTTTTGACACAGACAAAGTTTGG - Intergenic
1085319200 11:75563861-75563883 CTGTGGGCACAGCCCTGGCTAGG + Intronic
1085356561 11:75843511-75843533 CTGCTGACACAGTCCAAGCCTGG - Intronic
1085510798 11:77087112-77087134 ATGGGGACTCAGACCAGGCTGGG + Intronic
1085515829 11:77111354-77111376 CTTTGGAGGCAGACCAACCTTGG - Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1091799809 12:3317694-3317716 CTGAGGCCCCAGAGCAAGCTGGG + Intergenic
1092965374 12:13636311-13636333 GGGAGGACACAGACCATGCTGGG + Intronic
1094483072 12:30900387-30900409 CTGGGGACACAGAAAAAGCAAGG - Intergenic
1094495316 12:30985641-30985663 GTATGGACACAGACCAGGCCTGG + Intronic
1096228979 12:49887127-49887149 CTGTAGACAGAGGCAAAGCTGGG - Intronic
1096559920 12:52428800-52428822 CTGTGCACACAGACCCACCCTGG + Intronic
1098196179 12:68004423-68004445 CTGGGGAGAGAGAGCAAGCTGGG - Intergenic
1100472632 12:94907215-94907237 CTGAGCACACAAAGCAAGCTGGG - Intronic
1101098936 12:101372282-101372304 CTTTGGACACAGACTAGGCATGG + Intronic
1101569027 12:105936198-105936220 CTGTGGTCTCACACCAACCTAGG + Intergenic
1103001862 12:117390879-117390901 CTATGAAAACAGACCAAGGTTGG - Intronic
1103040356 12:117690116-117690138 CTGTGGCCATGGACCAAACTTGG - Intronic
1103987698 12:124778587-124778609 CTGTGGAGAAAGGCAAAGCTGGG + Intronic
1105847191 13:24303321-24303343 GTGTGGACACAGACGATGCCAGG - Exonic
1112763707 13:102718610-102718632 CTGTGGAAACAGAGCCAGGTTGG + Intergenic
1113778348 13:112961653-112961675 CTGTGGCCACACACACAGCTGGG + Intronic
1115992393 14:39163535-39163557 CTGTGGAGACAGATTAAGCAAGG - Intronic
1116797614 14:49408770-49408792 CTGTGGACATAGAACATTCTTGG + Intergenic
1117508868 14:56428783-56428805 CTTTGGAGTCAGACAAAGCTAGG + Intergenic
1118787893 14:69061461-69061483 CTGTGGACACAGGCCAGGCTAGG + Intronic
1122564425 14:102642149-102642171 CAATGGACACAGACGCAGCTGGG - Intronic
1124094825 15:26639305-26639327 CTGTGGAGTCAAACCAAGCTCGG + Intronic
1125600869 15:40915280-40915302 CAGTGGAGACGGCCCAAGCTGGG + Intergenic
1126326089 15:47479148-47479170 CTGTTGACCAAGACCAAGCAAGG - Intronic
1130936611 15:88476279-88476301 CTTTGGTCCCAGACCAATCTGGG - Intronic
1131177955 15:90221551-90221573 CCCTGGAGACAGGCCAAGCTGGG - Intronic
1132895826 16:2228953-2228975 CTGTGTATCCAGCCCAAGCTGGG - Intronic
1132925127 16:2425310-2425332 CTGGGGACACACAGCAAGCCAGG + Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134062073 16:11205348-11205370 CTGTGGACACAGCCTGACCTGGG - Intergenic
1136451663 16:30357299-30357321 CTGAGAACACAGAGCAAGGTGGG + Exonic
1138136775 16:54530230-54530252 GTGGAGTCACAGACCAAGCTTGG - Intergenic
1138543271 16:57701360-57701382 CTGAGGACACACAGCAAGCCTGG + Intronic
1139126881 16:64088910-64088932 CTCTGGAATCAGACCAAACTAGG + Intergenic
1139132719 16:64165580-64165602 GTTTGGACGCAGAACAAGCTAGG + Intergenic
1139364459 16:66425449-66425471 CCGTGGGCACAGCCCTAGCTTGG + Intergenic
1139999766 16:71013568-71013590 CTGTGGTCACAGCCCTACCTGGG - Intronic
1141154766 16:81589643-81589665 CTATGGACACAGACCATGGCAGG - Intronic
1141553339 16:84820707-84820729 CTCTGGAGACAGACAGAGCTGGG - Intronic
1143089693 17:4442172-4442194 CTGTGGACAGACAACAGGCTGGG - Intronic
1143182085 17:4989586-4989608 AGGAGGATACAGACCAAGCTGGG + Exonic
1144370367 17:14584594-14584616 CTGAGCAGACAGACCATGCTGGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147599327 17:41736023-41736045 CTGAGGACAGAGACTCAGCTTGG + Intergenic
1147643249 17:42017843-42017865 CTGTGGACACACTCCAAGGTCGG - Intronic
1149333309 17:55608652-55608674 ATGTGGAGACAGATAAAGCTTGG - Intergenic
1150648210 17:66993001-66993023 CTGTAGACACAGCGCACGCTAGG - Intronic
1151332052 17:73415777-73415799 CTGTGGTCTCAGACCAGGCGCGG - Intronic
1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG + Intronic
1154501791 18:15001069-15001091 CTGTGGTCCCAGAGCCAGCTGGG + Intergenic
1157101598 18:44735227-44735249 TTGAGGATACAGACCCAGCTTGG + Intronic
1159285210 18:66340161-66340183 CTGTGGACATAGAGCAATCAGGG + Intergenic
1159941421 18:74411850-74411872 CTGTGGACACAGACCTCGGGTGG - Intergenic
1160511150 18:79454249-79454271 CTCTGGACACAGGCCAGGGTCGG + Intronic
1160553687 18:79712577-79712599 CTCTGTAAACAGACCAGGCTAGG - Intronic
1162625443 19:11881087-11881109 CTCTGTGCACAGACCAAGGTGGG + Intronic
1164678161 19:30117041-30117063 CTGTGGCCACAGCCCTTGCTGGG + Intergenic
1165005059 19:32797966-32797988 CTGTGGACCCAGGCCCAGCCAGG - Intronic
1165464268 19:35963366-35963388 CTGTGGACACAGACAGACCTGGG - Intergenic
1166140332 19:40802000-40802022 CTGTGGCCCCAGACCAAGCACGG + Intronic
1167534338 19:50040060-50040082 CTGGGGACACTGACACAGCTGGG - Intronic
1167560720 19:50225502-50225524 CTGGAGACACAGCCCGAGCTGGG + Intronic
1168418039 19:56181922-56181944 ATGTGGACCCAGACCTAGGTGGG + Intronic
926685072 2:15691900-15691922 CTGTGGACACTGCTCAGGCTGGG - Intronic
926700998 2:15803441-15803463 CTTTGGAATCAGTCCAAGCTGGG + Intergenic
929401980 2:41594332-41594354 ATATGGACAGAGACCAGGCTGGG - Intergenic
930731196 2:54729624-54729646 CTTTGGAATCAGACCAATCTGGG - Intronic
931111233 2:59113741-59113763 CTGTGGACACCAATCATGCTAGG - Intergenic
931536925 2:63287843-63287865 CTGTTGACTCAAACCTAGCTTGG - Intronic
932430359 2:71670477-71670499 CTATGGTCACCGTCCAAGCTAGG + Intronic
938310403 2:130285445-130285467 CTGGAGCCACAGGCCAAGCTGGG + Intergenic
938500971 2:131831236-131831258 CTGTGGTCCCAGAGCCAGCTGGG + Intergenic
940988852 2:160077395-160077417 CTGTGCACAGAGCCCATGCTGGG + Intergenic
944313275 2:198258894-198258916 GTGTGGACACAAACCTACCTGGG - Intronic
946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG + Intronic
947454555 2:230241943-230241965 CTGTGGTCACAGTCCAAGAGGGG + Intronic
948768270 2:240234272-240234294 CTGTGGACACAGTCACCGCTGGG - Intergenic
1170353814 20:15470598-15470620 TTGTGGACACAAGCCAAGATGGG - Intronic
1171289535 20:23974064-23974086 CTGAGGTCACTGTCCAAGCTGGG + Intergenic
1172447272 20:34999768-34999790 CTGTGGATACAGAGCAGGCAGGG - Intronic
1173163477 20:40669878-40669900 CTGTGGACACAGGCCCAGGAGGG + Intergenic
1173791034 20:45827822-45827844 CTGTGTACCCAGCACAAGCTAGG - Intronic
1174480802 20:50830076-50830098 CTGTGGACCCAGACCTACCCAGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175404269 20:58716673-58716695 CTGTGTACACAGCCCCGGCTGGG + Intronic
1175474418 20:59260783-59260805 CTGTGGCCACAGACAGAACTGGG - Intergenic
1177777657 21:25586830-25586852 AAGAGGACTCAGACCAAGCTGGG - Intronic
1178366548 21:31993194-31993216 CTGTGCAAAGAGACCAAGGTTGG - Intronic
1179897870 21:44372826-44372848 CCGTGGACACAGAGCAGGGTAGG - Intronic
1184091382 22:42294772-42294794 CTGTGGTCACACACCACGCCTGG + Intronic
1184288043 22:43483085-43483107 CTGTGGGAACTGAACAAGCTGGG + Intronic
1184734692 22:46391224-46391246 TGGTGGCCACAGACCAAGTTCGG - Exonic
949474639 3:4431731-4431753 CTGAAGTCACAGACCAAGGTGGG + Intronic
950472326 3:13193894-13193916 CTTCGGCCACAGACCAAGCTTGG + Intergenic
951169696 3:19526591-19526613 CTGTGGACACTGACAACGCATGG + Intronic
953342034 3:42142508-42142530 CTGTGGGCACAGACTATACTCGG - Intronic
953559877 3:43979217-43979239 CTGTGGACAGAGACCGATCTTGG + Intergenic
954149887 3:48652049-48652071 CTGTGGACACACAGCCAGCAAGG + Intronic
954187513 3:48929550-48929572 CTTTGGACACAGACCAAAGAAGG - Intronic
955384331 3:58467096-58467118 CTTGGGACAGAGAACAAGCTAGG - Intergenic
956386870 3:68728840-68728862 ATGTTGAGACAGACCAAGCATGG - Intergenic
956731928 3:72204190-72204212 CTGTGGAAACAGCCTGAGCTGGG - Intergenic
956963783 3:74434566-74434588 CTGTGGAGTCAGACAAACCTAGG + Intronic
958762908 3:98329429-98329451 CTGTGGAGCCAGACACAGCTAGG - Intergenic
960581027 3:119279147-119279169 CTGTGGACTCAGGCCAACCTGGG - Intergenic
960718041 3:120596717-120596739 CTCTGGACTCAGACCTGGCTGGG + Intronic
965863049 3:173170208-173170230 CTGTGGTCCCAGACAAAGGTGGG + Intergenic
966672809 3:182547479-182547501 CTGTGGGCACAGAACAAGCATGG + Intergenic
967149804 3:186638209-186638231 CTGTGGAGATAGATCAATCTAGG - Intronic
968899132 4:3422631-3422653 CTGAGGACTCTGACAAAGCTGGG - Intronic
968955049 4:3714114-3714136 CCATGGACACAGACCCTGCTTGG + Intergenic
969370592 4:6728761-6728783 CTGAGGACACAGGGCAAGCAGGG - Intergenic
969511606 4:7621038-7621060 CTGTGGTCTCAGAGCCAGCTGGG - Intronic
969595968 4:8149474-8149496 CTGTGGACACAGACCAAGCTGGG - Intronic
970867278 4:20773477-20773499 CTGTTGACTCTGAGCAAGCTGGG + Intronic
971394913 4:26218695-26218717 CTGTGTGCAGAGACCAGGCTGGG - Intronic
972618715 4:40725104-40725126 CTGTAGTCAGAGACCAACCTAGG - Intergenic
973220963 4:47726193-47726215 CTGTTGACAGATACCAATCTAGG + Intronic
974477489 4:62402569-62402591 CTGTGCACACAGGCAAAGGTGGG - Intergenic
979769196 4:124501632-124501654 CTGTGGCCACAGACCTAGGTAGG - Intergenic
985699164 5:1360299-1360321 CTGTGGAAAAAGAAAAAGCTAGG + Intergenic
986366986 5:7042358-7042380 TTTTGGAGTCAGACCAAGCTTGG + Intergenic
986547384 5:8913495-8913517 ATGTGGGCTCAGACCAACCTTGG + Intergenic
987241443 5:16004180-16004202 CTTAGTACACAGACCAACCTTGG + Intergenic
987458915 5:18182794-18182816 CTGAAGACAGAGACAAAGCTTGG - Intergenic
988878756 5:35476761-35476783 CTTTGCAAACAGCCCAAGCTAGG - Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
992617833 5:78562293-78562315 CTGTGGACACAGACCTGGATTGG - Intronic
993301037 5:86210493-86210515 ATGTGGTCTCAGACAAAGCTTGG + Intergenic
995286146 5:110390398-110390420 CTCTGGAGATAGACCAACCTTGG + Intronic
998214604 5:140227666-140227688 CAGTGGGCACTGACCAATCTGGG - Intronic
1001924637 5:175627290-175627312 CTGTGGGCACAGAGCAAGTCGGG - Intergenic
1002064678 5:176646178-176646200 CTGTGGCCCCAGGACAAGCTAGG - Exonic
1002262148 5:178000897-178000919 CTGTGGTCACACAGCAAGCAAGG - Intergenic
1003240372 6:4340347-4340369 CTGGGGACACAGAATAAACTGGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005298883 6:24451830-24451852 CTGGGGACACAAAACACGCTAGG + Intronic
1007811023 6:44485739-44485761 CTCTTGACAGAGACCCAGCTGGG - Intergenic
1008836614 6:55839603-55839625 CTTTGTTCACAGACCAAGCATGG - Intronic
1011960108 6:93078158-93078180 CTTTGGACTCAGACCAACCTTGG + Intergenic
1012931090 6:105317640-105317662 ATGTGGACACAGTCCATCCTTGG - Intronic
1013173189 6:107655807-107655829 CTTTGGACAAAGACCAAACACGG - Intronic
1013648115 6:112165362-112165384 CTTTGGACTCAGACAAATCTGGG + Intronic
1014396951 6:120935602-120935624 CTGTGGAGACAGAACAATCTCGG + Intergenic
1014413455 6:121154065-121154087 ATTTGGACAGACACCAAGCTAGG - Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017036122 6:150268916-150268938 CTTTGCAGACAGACCAACCTCGG - Intergenic
1017425413 6:154315639-154315661 CTGTGGATCTATACCAAGCTTGG + Intronic
1018086602 6:160306506-160306528 GTGTGGGCACAGACCCAGCCTGG - Intergenic
1018294203 6:162328412-162328434 CTGTGTTCACAGAACAAGCAGGG - Intronic
1019264867 7:109310-109332 CTGTTCACACAGACCAGGATAGG - Intergenic
1022405589 7:30086989-30087011 CTGAGGACACAGATCACGTTTGG + Intronic
1023274558 7:38503825-38503847 ATGTGGACACAGACTAAACAAGG + Intronic
1023851600 7:44153242-44153264 CTGTGGGCTCAGCCCTAGCTGGG - Intronic
1024042436 7:45565681-45565703 CTGTGGACACAGCCCAATGGAGG - Intergenic
1024991255 7:55235869-55235891 GAGTGGAAACAGAGCAAGCTGGG - Intronic
1026023127 7:66726149-66726171 CTGTGGGCAAAGCCCAGGCTGGG - Intronic
1026342445 7:69446036-69446058 CTGTGGGAACAGACACAGCTGGG + Intergenic
1029617669 7:101669550-101669572 CTTTGGACTCAGACCCACCTAGG + Intergenic
1030461307 7:109839748-109839770 CTTTGGACACAGAACCAGTTTGG + Intergenic
1031678984 7:124647198-124647220 CTGTGGAGTCAGGCCAACCTAGG + Intergenic
1032784414 7:135188916-135188938 CTGGGGACAGAGCCCAACCTGGG + Intronic
1032887310 7:136154621-136154643 CTGAGGACAAAGGCCAAGGTGGG + Intergenic
1034206641 7:149321849-149321871 CAGTGGTAACAGATCAAGCTTGG + Intergenic
1034253585 7:149712797-149712819 CTCTGGACACAGACAAAGGCAGG - Intergenic
1038422167 8:27440336-27440358 CGGTGGACAGAGATCAGGCTTGG - Exonic
1039823222 8:41152145-41152167 ACGTGGACAGAGAGCAAGCTTGG + Intergenic
1040731970 8:50458211-50458233 CTGAGGAAACAGACAAAGCAAGG + Intronic
1041273661 8:56134933-56134955 CTGTAGACAAAGACAAAGCAAGG - Intergenic
1042082266 8:65067978-65068000 CTGTGGTCAGAGAAGAAGCTTGG + Intergenic
1048027816 8:130602730-130602752 CTGTTGACACTGACCGTGCTGGG - Intergenic
1048369329 8:133763963-133763985 CCGTGGACACGGACCCTGCTTGG - Intergenic
1049618876 8:143588943-143588965 CTGTGCCCACAGCCCAGGCTGGG + Intronic
1049685056 8:143936056-143936078 CTGTGGGCACAGAGCAGGCCTGG - Intronic
1049783637 8:144440248-144440270 CTGTGGACGCAGAGAAAGATGGG + Intronic
1053612944 9:39733611-39733633 TTTTGTACTCAGACCAAGCTGGG + Intergenic
1054554706 9:66643313-66643335 TTTTGTACTCAGACCAAGCTGGG - Intergenic
1054971952 9:71098390-71098412 GTGTGGAAACAGAGCAAGCCAGG + Intronic
1057147837 9:92770415-92770437 CAGCGGATACAGACCAGGCTGGG + Intergenic
1057772535 9:97981692-97981714 CTGTGGAGTCAGACCTATCTGGG + Intergenic
1059808185 9:117827360-117827382 CAGTGGTCATGGACCAAGCTGGG + Intergenic
1061396445 9:130346399-130346421 CTGTGTGCACAGACCAACATGGG + Intronic
1061622978 9:131823783-131823805 CAGACGACACAGACGAAGCTGGG - Intergenic
1062547838 9:137071547-137071569 CTGAGGACAGAGACCCAGGTAGG - Intergenic
1188091631 X:25971482-25971504 CTGTGATCACAGACGATGCTTGG - Intergenic
1188623464 X:32255171-32255193 CTGTGTACACTGACCAAGAATGG - Intronic
1190702687 X:53000081-53000103 CTGTCCTCACAGACCCAGCTGGG - Intergenic
1190879297 X:54481572-54481594 CTCTGGACACAGACACACCTGGG - Intronic
1192138717 X:68630266-68630288 CTGAGGACTGAGACTAAGCTGGG - Intergenic
1192147066 X:68689027-68689049 CTGAGGACTGAGACTAAGCTGGG + Intronic
1199220884 X:145314534-145314556 CAGTGGACACAATCCAATCTAGG + Intergenic
1199308954 X:146300114-146300136 CTTTGGATAAAGACCAAGCCTGG - Intergenic
1199818503 X:151421683-151421705 CTGTGGACACAGAAAATGTTGGG - Intergenic
1199997342 X:153033729-153033751 CTGTGGACATAGACCAGACTGGG - Intergenic
1200894099 Y:8356198-8356220 CTGTTGACACAACCCAACCTGGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic