ID: 969597437

View in Genome Browser
Species Human (GRCh38)
Location 4:8157396-8157418
Sequence CCAACCTAGTTATCTGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969597437_969597442 3 Left 969597437 4:8157396-8157418 CCACTCCCAGATAACTAGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 82
Right 969597442 4:8157422-8157444 TTTCAGAAATCCTCTTCCAAAGG 0: 1
1: 0
2: 0
3: 28
4: 372
969597437_969597443 4 Left 969597437 4:8157396-8157418 CCACTCCCAGATAACTAGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 82
Right 969597443 4:8157423-8157445 TTCAGAAATCCTCTTCCAAAGGG 0: 1
1: 0
2: 3
3: 33
4: 681

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969597437 Original CRISPR CCAACCTAGTTATCTGGGAG TGG (reversed) Intronic
906878319 1:49562210-49562232 GCAACCTACTTATCTGACAGAGG - Intronic
906923187 1:50086764-50086786 CCAATCCAATTATCTGGGGGTGG - Intronic
907551395 1:55308218-55308240 ACAAACTGGATATCTGGGAGAGG + Intergenic
907661111 1:56393210-56393232 CCACCCTGGCTATGTGGGAGAGG - Intergenic
914224289 1:145707585-145707607 CCCTCCTTGTTCTCTGGGAGTGG - Intronic
917227079 1:172795693-172795715 CCAACCTAGATAACTAAGAGAGG + Intergenic
1065885602 10:30074381-30074403 CCAACCTGGCTATCTGGGCCTGG + Intronic
1066992289 10:42527114-42527136 GCAACCTAGTTATCTGACAAAGG - Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1070442022 10:76455802-76455824 CCTACTTAGTTATGTGGGAGAGG + Intronic
1073743655 10:106440861-106440883 TCAACCCAGGTATTTGGGAGTGG + Intergenic
1079894226 11:26098389-26098411 CCAAGCTAGGAATCTGGGAGTGG - Intergenic
1080035023 11:27700920-27700942 GCACCCAAGTTCTCTGGGAGAGG + Intronic
1080938771 11:36890540-36890562 CCAAACTAGCTATCTAGGGGAGG - Intergenic
1081784118 11:45734265-45734287 CCATCCTAACTATCTGGGAAGGG - Intergenic
1081948590 11:47021877-47021899 CTAACCTAATTCTCTGGCAGGGG - Intronic
1094569416 12:31628682-31628704 CCGACCTTGTGATCTGGGTGGGG - Intergenic
1099393458 12:82108497-82108519 CCTACCTAGTTATTTGGTAGAGG - Intergenic
1111920905 13:94410419-94410441 CCAAACTAGTTATCTGAGTTGGG - Intergenic
1115736522 14:36337331-36337353 CCTACCTAGTTTTCTAAGAGAGG + Intergenic
1119062207 14:71486391-71486413 CCAGCCTAGTTGTCTGCAAGAGG + Intronic
1121170027 14:91845906-91845928 CCTTCCCAGTTTTCTGGGAGAGG + Intronic
1123965460 15:25451447-25451469 ACAACCAAGTTAAGTGGGAGAGG - Intergenic
1124006304 15:25798060-25798082 CCGGCCTAGTTAACTGGAAGAGG + Intronic
1126195001 15:45921917-45921939 CCACCCTAGATATTTGGGAAGGG - Intergenic
1132642567 16:984459-984481 CCCACCTTGGTCTCTGGGAGGGG + Intronic
1137517186 16:49156638-49156660 CCATCCTGGTTGGCTGGGAGTGG + Intergenic
1145991662 17:29082684-29082706 CCAAGCCAGTTATCTGTGACAGG + Intronic
1150260355 17:63785073-63785095 CAAAACTACATATCTGGGAGAGG + Intronic
1157514555 18:48301576-48301598 CCAGCCGAGTTATGTGAGAGTGG + Intronic
1161906825 19:7163078-7163100 ACTACCTGGTTTTCTGGGAGAGG - Exonic
1162671547 19:12261755-12261777 CAAAACTGGTTATCTGGGGGTGG + Intronic
1162714720 19:12622920-12622942 AAAACCCATTTATCTGGGAGTGG + Intronic
1163511831 19:17739984-17740006 CCAACCTGGTTAGCGGGGCGTGG + Intergenic
1165641376 19:37390451-37390473 CCAACCTAGTGATAAGGGATTGG + Exonic
926044077 2:9696877-9696899 CTAACCTATTCATCAGGGAGAGG - Intergenic
930355603 2:50315039-50315061 CCGAACTGGTTATCTGTGAGTGG - Intronic
941008486 2:160270912-160270934 CCCCTCTAGTTATATGGGAGCGG + Intronic
944456666 2:199902026-199902048 CCAGCTTAGGTCTCTGGGAGTGG - Intergenic
946332808 2:219019707-219019729 CCAGCCTTGTTATCTGGGGAGGG + Exonic
947023583 2:225711636-225711658 CCACCCTAGTCAGCTTGGAGAGG - Intergenic
947510398 2:230747832-230747854 CCCACCTTGTTCTCTGAGAGAGG + Intronic
948356011 2:237377779-237377801 GCAACCCAGTTATCTTTGAGTGG - Intronic
1169865736 20:10197924-10197946 CCAATATAGATATTTGGGAGTGG - Intergenic
1174881202 20:54281150-54281172 CCAACTTAGGTGTCTGGGTGGGG + Intergenic
1180160558 21:45997144-45997166 CCACCAAAGTCATCTGGGAGAGG + Intronic
1183872544 22:40751125-40751147 AAAAGCTAGTTAACTGGGAGTGG + Intergenic
950473407 3:13200525-13200547 TCAACCTCGTTATCTGGAAAGGG - Intergenic
954615515 3:51967236-51967258 CCAACCGAGGGATCTGGGCGCGG + Intronic
959653574 3:108775509-108775531 CCAAAATAGTTTTCTGGAAGAGG - Intergenic
960470852 3:118063481-118063503 GCAACCTACTTATCTGAGAAAGG + Intergenic
962081347 3:132142299-132142321 CCAACCTACTCATCTGGCAAAGG + Intronic
963020814 3:140871519-140871541 CCTTCCTTGTTATCTGGAAGTGG - Intergenic
966222005 3:177560398-177560420 CCAAGCTAGGGATTTGGGAGTGG - Intergenic
968330627 3:197866621-197866643 CCAAAGAAGTTACCTGGGAGTGG + Intronic
969597437 4:8157396-8157418 CCAACCTAGTTATCTGGGAGTGG - Intronic
972503489 4:39698557-39698579 CCATCCTAGCGCTCTGGGAGGGG - Intronic
973635155 4:52855382-52855404 CCAACCAAGGTATGTGGGAGGGG + Intergenic
975405641 4:73985861-73985883 CCTACTTAGTTATCTGAAAGTGG + Intergenic
977124199 4:93143799-93143821 ACAACATAGATATCTGTGAGGGG + Intronic
977895486 4:102360410-102360432 CCACCCTAGTTACGTGGAAGTGG + Intronic
983666447 4:170189495-170189517 TCTTCCTAGTAATCTGGGAGGGG + Intergenic
983736011 4:171061570-171061592 AAAACCTAATTATCTGGGAAAGG - Intergenic
985132404 4:186751806-186751828 CCTACATAGAAATCTGGGAGTGG - Intergenic
986253350 5:6081396-6081418 TGAACCTAGGGATCTGGGAGAGG - Intergenic
991218250 5:64181472-64181494 CCTACCTGTTTTTCTGGGAGAGG - Intronic
996957041 5:129195770-129195792 CAAATCTTGTTCTCTGGGAGAGG - Intergenic
999219304 5:149961298-149961320 CGAACCTAGATATCTGGAATAGG + Intronic
1004407368 6:15346584-15346606 CTAACCCACTTCTCTGGGAGAGG + Intronic
1016370151 6:143365343-143365365 CCAACTTTGTTATCTGGGCTGGG + Intergenic
1019897398 7:3993207-3993229 GCAACCTTGATATTTGGGAGAGG + Intronic
1023247713 7:38223358-38223380 TCAACCCAGTCATCTGAGAGAGG - Intronic
1029913126 7:104176317-104176339 ATAAGCTAGTTATCTGGGAAAGG + Intronic
1032894109 7:136231811-136231833 CCAACCTAGTTCTCCGTAAGAGG - Intergenic
1033756027 7:144398905-144398927 TCACTCTAGTTATCTGGGTGGGG - Intronic
1037294147 8:17383114-17383136 CCAACCTTGGTATCTAAGAGCGG - Intronic
1037619562 8:20551488-20551510 CCATCCCAGTGGTCTGGGAGGGG - Intergenic
1038846111 8:31230956-31230978 CCAAACTAGTTATTTGGAAGAGG + Intergenic
1041029949 8:53726896-53726918 CCAAACTTGTGATTTGGGAGTGG - Intronic
1054443329 9:65285846-65285868 CCAACCAAATTAGCTGGGCGTGG - Intergenic
1054486950 9:65735654-65735676 CCAACCAAATTAGCTGGGCGTGG + Intergenic
1055622244 9:78138398-78138420 GCAACCTACTTATCTGGCAAAGG + Intergenic
1058154749 9:101502666-101502688 CCAAGCTAGTTATCTGGGGATGG - Intronic
1060428554 9:123527057-123527079 CCAACCCAGGTAACTGGGTGAGG - Intronic
1191117721 X:56868829-56868851 CCAAGCTAAAAATCTGGGAGTGG + Intergenic
1191766662 X:64705581-64705603 CCAACACAGTGATATGGGAGTGG - Intergenic
1191819620 X:65290071-65290093 CCAACCTATTTATCTGACAGGGG + Intergenic
1192753439 X:74019181-74019203 CCACACTAGCTTTCTGGGAGAGG + Intergenic
1196813057 X:119643814-119643836 CCACCCTAGGTGGCTGGGAGAGG - Intronic
1201425552 Y:13846828-13846850 ACAACCTAGTTATCTGACAAAGG - Intergenic