ID: 969598909

View in Genome Browser
Species Human (GRCh38)
Location 4:8164177-8164199
Sequence CTGTATTTAGAGATGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969598909_969598912 9 Left 969598909 4:8164177-8164199 CCTTTCTTCATCTCTAAATACAG No data
Right 969598912 4:8164209-8164231 TGATTGACTTCACAGCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969598909 Original CRISPR CTGTATTTAGAGATGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr