ID: 969600146

View in Genome Browser
Species Human (GRCh38)
Location 4:8171379-8171401
Sequence CTGGGGAGAGGGAGCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969600146_969600154 -3 Left 969600146 4:8171379-8171401 CCCTCCTGGCTCCCTCTCCCCAG No data
Right 969600154 4:8171399-8171421 CAGCCCCACTCCTGTTGCCCTGG No data
969600146_969600164 26 Left 969600146 4:8171379-8171401 CCCTCCTGGCTCCCTCTCCCCAG No data
Right 969600164 4:8171428-8171450 TAGAAATTAACTTCCTCTTCTGG No data
969600146_969600155 -2 Left 969600146 4:8171379-8171401 CCCTCCTGGCTCCCTCTCCCCAG No data
Right 969600155 4:8171400-8171422 AGCCCCACTCCTGTTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969600146 Original CRISPR CTGGGGAGAGGGAGCCAGGA GGG (reversed) Intergenic
No off target data available for this crispr