ID: 969600185

View in Genome Browser
Species Human (GRCh38)
Location 4:8171503-8171525
Sequence CTTGAGGCAGGGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969600177_969600185 6 Left 969600177 4:8171474-8171496 CCAGAGAGGGGTGTGGGTGGGGG No data
Right 969600185 4:8171503-8171525 CTTGAGGCAGGGAAGGAGCAGGG No data
969600169_969600185 19 Left 969600169 4:8171461-8171483 CCAGCTCTGCTTTCCAGAGAGGG No data
Right 969600185 4:8171503-8171525 CTTGAGGCAGGGAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969600185 Original CRISPR CTTGAGGCAGGGAAGGAGCA GGG Intergenic
No off target data available for this crispr