ID: 969601613

View in Genome Browser
Species Human (GRCh38)
Location 4:8179735-8179757
Sequence CCTGACCTGCAGAGGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969601605_969601613 -5 Left 969601605 4:8179717-8179739 CCTGGTCCCCGCCAGGCTCCTGA No data
Right 969601613 4:8179735-8179757 CCTGACCTGCAGAGGGTCCATGG No data
969601603_969601613 -3 Left 969601603 4:8179715-8179737 CCCCTGGTCCCCGCCAGGCTCCT No data
Right 969601613 4:8179735-8179757 CCTGACCTGCAGAGGGTCCATGG No data
969601604_969601613 -4 Left 969601604 4:8179716-8179738 CCCTGGTCCCCGCCAGGCTCCTG No data
Right 969601613 4:8179735-8179757 CCTGACCTGCAGAGGGTCCATGG No data
969601601_969601613 6 Left 969601601 4:8179706-8179728 CCAGAGAAGCCCCTGGTCCCCGC No data
Right 969601613 4:8179735-8179757 CCTGACCTGCAGAGGGTCCATGG No data
969601600_969601613 7 Left 969601600 4:8179705-8179727 CCCAGAGAAGCCCCTGGTCCCCG No data
Right 969601613 4:8179735-8179757 CCTGACCTGCAGAGGGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969601613 Original CRISPR CCTGACCTGCAGAGGGTCCA TGG Intergenic
No off target data available for this crispr