ID: 969601677

View in Genome Browser
Species Human (GRCh38)
Location 4:8180024-8180046
Sequence GCTGAAAGTGTCGCCCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969601676_969601677 -9 Left 969601676 4:8180010-8180032 CCTGCTGTGGGCAGGCTGAAAGT No data
Right 969601677 4:8180024-8180046 GCTGAAAGTGTCGCCCCATGTGG No data
969601671_969601677 15 Left 969601671 4:8179986-8180008 CCCATGAACAGCGGACTCTTAGC No data
Right 969601677 4:8180024-8180046 GCTGAAAGTGTCGCCCCATGTGG No data
969601670_969601677 16 Left 969601670 4:8179985-8180007 CCCCATGAACAGCGGACTCTTAG No data
Right 969601677 4:8180024-8180046 GCTGAAAGTGTCGCCCCATGTGG No data
969601672_969601677 14 Left 969601672 4:8179987-8180009 CCATGAACAGCGGACTCTTAGCG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 969601677 4:8180024-8180046 GCTGAAAGTGTCGCCCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969601677 Original CRISPR GCTGAAAGTGTCGCCCCATG TGG Intergenic
No off target data available for this crispr