ID: 969602158

View in Genome Browser
Species Human (GRCh38)
Location 4:8182883-8182905
Sequence TGGGAACCCTGGCCCCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 202}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969602158_969602176 29 Left 969602158 4:8182883-8182905 CCCTCATGGGGCCAGGGTTCCCA 0: 1
1: 1
2: 1
3: 16
4: 202
Right 969602176 4:8182935-8182957 TCAGGGCTGGACTTGGGAGTGGG 0: 1
1: 0
2: 3
3: 51
4: 347
969602158_969602169 12 Left 969602158 4:8182883-8182905 CCCTCATGGGGCCAGGGTTCCCA 0: 1
1: 1
2: 1
3: 16
4: 202
Right 969602169 4:8182918-8182940 GATGAGACCGCCTTCTCTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 74
969602158_969602168 11 Left 969602158 4:8182883-8182905 CCCTCATGGGGCCAGGGTTCCCA 0: 1
1: 1
2: 1
3: 16
4: 202
Right 969602168 4:8182917-8182939 GGATGAGACCGCCTTCTCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 78
969602158_969602173 22 Left 969602158 4:8182883-8182905 CCCTCATGGGGCCAGGGTTCCCA 0: 1
1: 1
2: 1
3: 16
4: 202
Right 969602173 4:8182928-8182950 CCTTCTCTCAGGGCTGGACTTGG 0: 1
1: 0
2: 6
3: 27
4: 348
969602158_969602174 23 Left 969602158 4:8182883-8182905 CCCTCATGGGGCCAGGGTTCCCA 0: 1
1: 1
2: 1
3: 16
4: 202
Right 969602174 4:8182929-8182951 CTTCTCTCAGGGCTGGACTTGGG No data
969602158_969602170 16 Left 969602158 4:8182883-8182905 CCCTCATGGGGCCAGGGTTCCCA 0: 1
1: 1
2: 1
3: 16
4: 202
Right 969602170 4:8182922-8182944 AGACCGCCTTCTCTCAGGGCTGG No data
969602158_969602175 28 Left 969602158 4:8182883-8182905 CCCTCATGGGGCCAGGGTTCCCA 0: 1
1: 1
2: 1
3: 16
4: 202
Right 969602175 4:8182934-8182956 CTCAGGGCTGGACTTGGGAGTGG No data
969602158_969602163 -10 Left 969602158 4:8182883-8182905 CCCTCATGGGGCCAGGGTTCCCA 0: 1
1: 1
2: 1
3: 16
4: 202
Right 969602163 4:8182896-8182918 AGGGTTCCCACCTGCCACTGGGG 0: 1
1: 0
2: 1
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969602158 Original CRISPR TGGGAACCCTGGCCCCATGA GGG (reversed) Intronic