ID: 969603376

View in Genome Browser
Species Human (GRCh38)
Location 4:8189829-8189851
Sequence TAAGGGCCACACTCTGTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 92}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969603376_969603387 11 Left 969603376 4:8189829-8189851 CCCCGCACAGAGTGTGGCCCTTA 0: 1
1: 0
2: 1
3: 4
4: 92
Right 969603387 4:8189863-8189885 ACCTTTAGGGAGGAGGAGGCTGG 0: 1
1: 0
2: 3
3: 114
4: 2308
969603376_969603389 12 Left 969603376 4:8189829-8189851 CCCCGCACAGAGTGTGGCCCTTA 0: 1
1: 0
2: 1
3: 4
4: 92
Right 969603389 4:8189864-8189886 CCTTTAGGGAGGAGGAGGCTGGG 0: 1
1: 1
2: 4
3: 37
4: 461
969603376_969603384 1 Left 969603376 4:8189829-8189851 CCCCGCACAGAGTGTGGCCCTTA 0: 1
1: 0
2: 1
3: 4
4: 92
Right 969603384 4:8189853-8189875 AGAAGGCATGACCTTTAGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 197
969603376_969603385 4 Left 969603376 4:8189829-8189851 CCCCGCACAGAGTGTGGCCCTTA 0: 1
1: 0
2: 1
3: 4
4: 92
Right 969603385 4:8189856-8189878 AGGCATGACCTTTAGGGAGGAGG No data
969603376_969603392 22 Left 969603376 4:8189829-8189851 CCCCGCACAGAGTGTGGCCCTTA 0: 1
1: 0
2: 1
3: 4
4: 92
Right 969603392 4:8189874-8189896 GGAGGAGGCTGGGAAACGGGAGG 0: 1
1: 1
2: 3
3: 72
4: 771
969603376_969603383 -2 Left 969603376 4:8189829-8189851 CCCCGCACAGAGTGTGGCCCTTA 0: 1
1: 0
2: 1
3: 4
4: 92
Right 969603383 4:8189850-8189872 TAGAGAAGGCATGACCTTTAGGG No data
969603376_969603382 -3 Left 969603376 4:8189829-8189851 CCCCGCACAGAGTGTGGCCCTTA 0: 1
1: 0
2: 1
3: 4
4: 92
Right 969603382 4:8189849-8189871 TTAGAGAAGGCATGACCTTTAGG No data
969603376_969603390 18 Left 969603376 4:8189829-8189851 CCCCGCACAGAGTGTGGCCCTTA 0: 1
1: 0
2: 1
3: 4
4: 92
Right 969603390 4:8189870-8189892 GGGAGGAGGAGGCTGGGAAACGG 0: 1
1: 1
2: 26
3: 306
4: 4104
969603376_969603391 19 Left 969603376 4:8189829-8189851 CCCCGCACAGAGTGTGGCCCTTA 0: 1
1: 0
2: 1
3: 4
4: 92
Right 969603391 4:8189871-8189893 GGAGGAGGAGGCTGGGAAACGGG 0: 1
1: 1
2: 12
3: 151
4: 1391
969603376_969603386 7 Left 969603376 4:8189829-8189851 CCCCGCACAGAGTGTGGCCCTTA 0: 1
1: 0
2: 1
3: 4
4: 92
Right 969603386 4:8189859-8189881 CATGACCTTTAGGGAGGAGGAGG 0: 1
1: 0
2: 2
3: 22
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969603376 Original CRISPR TAAGGGCCACACTCTGTGCG GGG (reversed) Intronic
900384342 1:2402730-2402752 TGCGGGCCTCACTCTGTGCCCGG + Intronic
903211329 1:21820874-21820896 CAAGCACCACACTCTGTGCTGGG - Intronic
907325582 1:53636849-53636871 AAGGGGCCACACTCAGTGCAGGG + Intronic
907725387 1:57015531-57015553 TAAGTGCCAGACTGTGTGCCAGG + Intronic
908555122 1:65249802-65249824 TAAGGGCCTCACTCTGAACTGGG + Intronic
909387592 1:75077288-75077310 TAAGGGCCCTTCTCTGTGTGAGG - Intergenic
912926477 1:113917622-113917644 TAAGGGCCAGACACTATGCTTGG + Intergenic
920685184 1:208103900-208103922 CAAGGGCTACACTCTCTGGGGGG - Intronic
922950706 1:229556791-229556813 TAAAGGCCTCACTCTGTGCCTGG + Intronic
923183401 1:231546036-231546058 AAAGGGCCACAGTGTGTGCTGGG - Intronic
1068940046 10:62671605-62671627 GATGGGCCAGACTCTGTGCTAGG + Exonic
1069304387 10:66950791-66950813 TAAGGGCCACACTGTGTGAGGGG + Intronic
1070299973 10:75196383-75196405 TAAGGGCTTCACTCTGTCCCAGG - Intergenic
1075266458 10:121003149-121003171 TAAGTGCCAAGCTCTGTGCCAGG + Intergenic
1079343413 11:19631688-19631710 TAGGTGCCACACTCAGTGCCGGG - Intronic
1084303740 11:68267896-68267918 TAAGGGCCACAGACTGGGCCTGG + Intronic
1085172385 11:74460369-74460391 TATGGGCCACACCCTGTGATGGG + Intronic
1086111002 11:83198043-83198065 TAAGGGCCACACTCTTACCTAGG - Intronic
1098497694 12:71155550-71155572 TAAGGTCCACACTGTGTGGTTGG - Intronic
1103929822 12:124444216-124444238 TAAGGACCACAGTCTGTAGGAGG + Intronic
1106301111 13:28466631-28466653 TATGGGCCACATACTGTGCTAGG + Intronic
1106552496 13:30784365-30784387 TATGTGCCACACTCTGTTCCAGG + Intergenic
1109331282 13:60934112-60934134 TAAGTGCCAGACACTGTGCTAGG + Intergenic
1115755724 14:36524756-36524778 TAAGGGCCGGACTCTCTTCGCGG - Intergenic
1118742181 14:68747584-68747606 CAAGGCCCTCACTCTGTGCTGGG + Intergenic
1119108430 14:71946800-71946822 TAAGGACCTCACTCTGTATGGGG - Intronic
1119543889 14:75458014-75458036 TGAGTGCCACACTCTGTACCAGG + Intronic
1120634711 14:86937430-86937452 AAAGGGCCACACACTGTTTGGGG - Intergenic
1125919275 15:43515944-43515966 CAAGGGCCACACCCTGGGCATGG - Intronic
1129457672 15:75684245-75684267 TAAGGGCCCCACTCTGCAGGTGG - Intronic
1134335577 16:13296498-13296520 GAAGGGCCACATTCTGTCTGTGG + Intergenic
1134689906 16:16184412-16184434 TATGGGCCACGCTCTGTTCTAGG - Intronic
1137777817 16:51071186-51071208 GCAGGGCCACACTCCCTGCGGGG - Intergenic
1138581021 16:57940392-57940414 TGAGGGCCACGCTCTGTGCCAGG + Intronic
1139304734 16:65975404-65975426 TATTGGCCAGACTCTGTGCCTGG - Intergenic
1141063489 16:80896161-80896183 TAGCAGCCACACTCTGTGCCTGG - Intergenic
1142685058 17:1572772-1572794 TAAGTGCCACACCCTGAGGGTGG + Intronic
1142687851 17:1587998-1588020 TAAGTGCCACACCCTGAGGGTGG + Intronic
1143265389 17:5632995-5633017 TTAAGGCCAGGCTCTGTGCGAGG + Intergenic
1143587598 17:7858296-7858318 TAAGGGCCACACGTTGGGCCGGG + Intronic
1145901330 17:28492161-28492183 TAAGGGGCACACACTGAGCATGG + Intronic
1147879435 17:43644416-43644438 CAGGGGACACACTCTGTGCCAGG + Intronic
1149468780 17:56899741-56899763 TATGGGCCAGGCTCTGTGCTAGG + Intronic
1151264627 17:72945274-72945296 GAAAGGCCACACTCTGGGAGAGG - Intronic
1153469952 18:5432955-5432977 TAAGTGCCAGACACTGTGTGTGG - Intronic
1157898862 18:51494266-51494288 TATGGGCCACACACTGTGCTAGG - Intergenic
1161962830 19:7532159-7532181 TAAGGGCCAAGATCTGTGCTGGG + Intronic
1161979468 19:7623211-7623233 CAAGCCCCACACTCTGTGGGTGG - Exonic
1163211274 19:15842128-15842150 TAAGAGACACACTATGTGTGAGG + Intergenic
927226010 2:20767037-20767059 GCAGGGCCACAATCTGGGCGAGG + Intronic
928648346 2:33378861-33378883 TAAGGGGCACAATCTGTCTGCGG - Intronic
930641983 2:53862698-53862720 TATGGGCCACTCTCTGAGGGTGG - Intergenic
935422897 2:102888007-102888029 GATCTGCCACACTCTGTGCGTGG - Intergenic
942178295 2:173355422-173355444 CAAGGGCCACCCACTGAGCGCGG - Intronic
945723143 2:213444159-213444181 TAAGGGCTCAACTCTGTGGGAGG + Intronic
1172490553 20:35333300-35333322 TATGGGCCAAACTCTGTGCCAGG - Intronic
1175142724 20:56872854-56872876 TCAGTGCCACACACTGTGGGAGG - Intergenic
1177529787 21:22344223-22344245 TAAGGGCAGCACTCTCTGCCAGG - Intergenic
1182311679 22:29413005-29413027 TAAGGGCCAGTCACTGTGTGGGG - Intronic
954576663 3:51680123-51680145 TAAGGGCAGCCCTCTGTGCCTGG + Intronic
954996752 3:54888844-54888866 TATGTGCCAGACTCTGAGCGAGG + Intronic
956642975 3:71432072-71432094 TAAGGGCCAAACAATGTGCCAGG + Intronic
961822340 3:129581510-129581532 TGATGGCCACTCTCTGTGGGTGG - Intronic
967341061 3:188398495-188398517 TAAGTGCCCCACTCTCTGCATGG - Intronic
968750007 4:2383817-2383839 TAAGGGCCTTTCTCTGTGTGTGG + Intronic
969603376 4:8189829-8189851 TAAGGGCCACACTCTGTGCGGGG - Intronic
977586242 4:98778734-98778756 TAAGTGCCACACATTGTGCTAGG + Intergenic
983712899 4:170741877-170741899 TATGAGCCACACACTGTGCTAGG + Intergenic
989169794 5:38462799-38462821 TAAAGGACACACTATGTGCCAGG - Intronic
992020512 5:72619371-72619393 TAAGTGCCCCACTCTTTGCCAGG + Intergenic
993415755 5:87627959-87627981 TACAGGACACACTCTGTACGAGG - Intergenic
999131949 5:149290344-149290366 TATGTGCCAGACTCTGTTCGAGG + Intronic
1004632774 6:17437586-17437608 TAAGGGTCACAGGCTGGGCGTGG + Intronic
1006066698 6:31467323-31467345 TCAGGGCCACACCCTCTCCGTGG + Intergenic
1008578370 6:52882732-52882754 TAAGTGCCAGATTCTGTGTGAGG - Intronic
1009928729 6:70150707-70150729 TAAGGCCCAAACACTGTGGGAGG - Intronic
1011811691 6:91139609-91139631 TCAGGGCTACACTCTGGGCAAGG + Intergenic
1012408616 6:98929912-98929934 TTAGGCCCACACTCTATGCATGG - Intronic
1012478189 6:99637473-99637495 TAGTGGCCACTCTCTGTGGGGGG + Intergenic
1015453240 6:133395266-133395288 TATGTGCCACACACTGTGCTAGG - Intronic
1016884079 6:148942069-148942091 TAAGGGCAACAGTCTCTGTGGGG + Intronic
1017192591 6:151669713-151669735 TACGGGCCAGGCTCTGTGCTGGG - Intronic
1023319170 7:38975207-38975229 TCAAGGCCACACTCTCTGAGAGG + Intergenic
1026796002 7:73366517-73366539 TGAGGTCCACACTGTGTGTGTGG - Intergenic
1034460828 7:151197095-151197117 TTAGGGCCAGAGTCTGTGCTAGG - Intronic
1042727069 8:71889916-71889938 CAAGGGCCAGTCTCTGTGCATGG + Intronic
1058428862 9:104900339-104900361 CAAGGGCCAGGCTCTGTGCTGGG + Intronic
1060244259 9:121930831-121930853 TAAGTGCCAAACTCAGCGCGAGG - Intronic
1062008246 9:134252563-134252585 TCAGGGTCACACCCTCTGCGAGG - Intergenic
1191953422 X:66618639-66618661 TGAGGTACACACTCTGTGCCAGG - Intronic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1195520137 X:105821114-105821136 TAATGGCCACAGCCTGTGTGAGG - Intergenic
1196062472 X:111425819-111425841 TATGTGCCAGACTCTGTGCAAGG + Intergenic
1197830059 X:130632039-130632061 TAAGGTCCACACTCTGTTAATGG + Intronic
1200002191 X:153067753-153067775 TCTGGGCCACACTCTGTTCTAGG + Intergenic
1200005542 X:153082272-153082294 TCTGGGCCACACTCTGTTCTAGG - Intergenic
1200041030 X:153369471-153369493 CAAGGGACACACTCTGGGCTGGG - Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic