ID: 969603988

View in Genome Browser
Species Human (GRCh38)
Location 4:8193141-8193163
Sequence CGTGCTCTGGGTAGGGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969603988_969603998 7 Left 969603988 4:8193141-8193163 CCCCCGGCCCTACCCAGAGCACG 0: 1
1: 0
2: 0
3: 12
4: 178
Right 969603998 4:8193171-8193193 CCCCTCTTCTAGAACGACCTTGG 0: 1
1: 0
2: 0
3: 2
4: 49
969603988_969604001 10 Left 969603988 4:8193141-8193163 CCCCCGGCCCTACCCAGAGCACG 0: 1
1: 0
2: 0
3: 12
4: 178
Right 969604001 4:8193174-8193196 CTCTTCTAGAACGACCTTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969603988 Original CRISPR CGTGCTCTGGGTAGGGCCGG GGG (reversed) Intronic
900124743 1:1064426-1064448 CGGCCTCTGGGAAGGGCGGGCGG + Intergenic
900125302 1:1066520-1066542 CGGGCTCTGGGAAGGGGCCGGGG + Intergenic
900304910 1:2000972-2000994 GGTTCCCTGGGTAGGGCAGGTGG + Intronic
900360772 1:2287868-2287890 AGGGCTCGGGGTGGGGCCGGAGG - Intronic
900972892 1:6001230-6001252 AGGGCTCAGGGTAGGGCCTGGGG - Intronic
902217669 1:14944868-14944890 CCTGTTCTGGGCAGGGCAGGAGG + Intronic
904453863 1:30635213-30635235 GGTGGTCTGGGTGGGGGCGGAGG - Intergenic
904562969 1:31411102-31411124 TGTGCTCTGGGTAGGAGAGGGGG + Intronic
905389962 1:37630009-37630031 AGTCTTCTGGGTAGGGCAGGAGG - Intronic
908920583 1:69186553-69186575 CGTGCTCTTGCTGGGGCTGGTGG - Intergenic
909829808 1:80173681-80173703 CATGCTCTGGGTAAGACTGGAGG - Intergenic
911527453 1:99004422-99004444 CGTGCTCGTGGTAAGCCCGGGGG - Exonic
913332493 1:117678935-117678957 GGTGCTCTGGTTAGGGACGTGGG - Intergenic
917194312 1:172449772-172449794 CGTGCACTGGGTAGAGGTGGGGG + Intronic
917960040 1:180134930-180134952 CGTGCTCTGGGAAGTGTAGGTGG + Intergenic
919639133 1:200032242-200032264 TGTGCTCTGGGGAGGCCCTGGGG + Intronic
919686297 1:200486737-200486759 TGGGCTGTGGGGAGGGCCGGTGG - Intergenic
922718252 1:227887770-227887792 CGAGCCCTGGGCAGGGGCGGCGG + Intergenic
923036424 1:230287979-230288001 TGTGCTCTGGCTCGGGCCGTGGG - Intergenic
923656398 1:235920850-235920872 TTTGGTCTGGGTAGGGCCCGAGG - Intergenic
924064252 1:240207579-240207601 CCTGCTCCGGGTAGAGGCGGCGG - Exonic
1065979229 10:30875133-30875155 TGAGCTCTGGGTAGGGCCAAGGG + Intronic
1067476792 10:46572733-46572755 TGCCCTCTGGGTAGGGCCTGTGG + Intergenic
1067617946 10:47769047-47769069 TGCCCTCTGGGTAGGGCCTGTGG - Intergenic
1069642698 10:69966077-69966099 CATGCCCTGGGAAGGGCAGGAGG - Intergenic
1070457567 10:76632538-76632560 TGTGGTCTGGGTAGGGGTGGGGG - Intergenic
1070889388 10:79930746-79930768 GGAGCTCTGGGCAGGGCTGGAGG - Intergenic
1072610976 10:97017583-97017605 GCTGCTCAGGGCAGGGCCGGAGG + Intronic
1072867471 10:99079302-99079324 CTTGCTCTGTGTAGAGCCAGGGG + Intronic
1073209055 10:101783511-101783533 CGGGCTCCGGGTAGGGCTGCGGG - Intergenic
1074456638 10:113601256-113601278 AAAGCTCTGGGTAGGGCCAGAGG - Intronic
1075724700 10:124605302-124605324 CCTGCTCTGGGTCAGGCCTGTGG + Intronic
1076199523 10:128547168-128547190 GGTGCTCTGGGCAGAGCCGGGGG - Intergenic
1077034359 11:487671-487693 CGTCCTCAGGGTCGGGGCGGTGG + Intronic
1077174952 11:1184855-1184877 GGTGCTCTGAGTTGGGCTGGTGG - Intronic
1077175519 11:1188173-1188195 AGTGCTCTGAGTTGGGCTGGTGG - Intronic
1077175677 11:1189067-1189089 GGTGCTCTGAGTTGGGCTGGTGG - Intronic
1077175910 11:1190366-1190388 AGTGCTCTGAGTTGGGCTGGTGG - Intronic
1077222119 11:1422358-1422380 GGTGCTCTGGGGAGGGGTGGGGG + Intronic
1077464181 11:2725782-2725804 TGTGCTTTGGGTGGGGGCGGGGG - Intronic
1078438742 11:11346762-11346784 GGTTTTCTGGGAAGGGCCGGTGG - Intronic
1083200582 11:61118860-61118882 GGTGGTGTGGGGAGGGCCGGGGG - Intronic
1083342374 11:61967237-61967259 CGCGCGCTGGGGCGGGCCGGGGG - Intronic
1083886271 11:65574787-65574809 AGTGCTGTGGGGAGAGCCGGCGG - Intergenic
1084367608 11:68712876-68712898 GGTGCTCTAGGTGGGGCCGTGGG - Intronic
1092215430 12:6678562-6678584 TGTACTCTGGGTTGGGTCGGCGG - Intronic
1096196358 12:49651347-49651369 AGGGCTCTGGGCAGGGCTGGTGG - Intronic
1097185884 12:57196070-57196092 TGTGCTCTGCGGAGGGGCGGAGG - Exonic
1097285017 12:57870404-57870426 CTTGCTCTGGGCAGTGCAGGTGG - Intergenic
1107885611 13:44872209-44872231 CCCACTCTGGGTAGGGCAGGAGG + Intergenic
1112207449 13:97338630-97338652 CGCGCTCTGGGAAGGGAAGGAGG - Intronic
1122378909 14:101287577-101287599 CTTGCTCAGGGCAGGGCTGGTGG + Intergenic
1124962456 15:34409089-34409111 CGTCCTCTGGGGAGGGGAGGGGG - Intronic
1128243132 15:66115133-66115155 TGTGCCCTGGGCAGGGCGGGAGG - Intronic
1128545120 15:68561403-68561425 CTTGCTCTGAGTGGGGCTGGGGG - Intergenic
1129848536 15:78779077-78779099 GCAGCTCTGGGCAGGGCCGGGGG - Intronic
1132403226 15:101526621-101526643 CGGGCTCTGCCTAGGGTCGGGGG - Intergenic
1132748096 16:1445298-1445320 CGTGGTCTGGGTGGGGTGGGAGG + Exonic
1132939250 16:2498832-2498854 GGAGCTCTGGGTTGGGCCTGGGG + Intronic
1132939837 16:2501190-2501212 CCAGCTCTGGGTGGGGCTGGGGG - Exonic
1133130552 16:3673879-3673901 GGCGCTCTGGGAAGGGCCTGTGG - Intronic
1135113376 16:19707720-19707742 AGTGCTCTGTGTAGGGTCGTGGG - Intronic
1136374727 16:29858811-29858833 CTTGCTCTGGCTGGGGGCGGAGG + Exonic
1137625803 16:49907716-49907738 TGGGCTCAGGGTAGGGCCTGAGG - Intergenic
1138556494 16:57773966-57773988 CCTGCTCTTGGTGGGGCAGGGGG + Intronic
1140046408 16:71442738-71442760 CCTGCTCTGGCTAGGTCAGGAGG - Intergenic
1141032570 16:80602548-80602570 GGTGCACTGGGCAGGGCAGGTGG - Exonic
1141672930 16:85502306-85502328 TGTGCTGTGGGTAGCGCCGTGGG + Intergenic
1142028549 16:87827172-87827194 CGTGCTCTGGGGGGGGACAGGGG + Intergenic
1142132554 16:88437580-88437602 CGTGCTCGGGGTAGACCCGGGGG - Exonic
1144658228 17:17051670-17051692 AGAGCTCTGGGTAGGGCATGGGG - Intronic
1144991723 17:19237894-19237916 CGTGCTCTGGGGAGGGGGCGGGG - Intronic
1146000336 17:29126849-29126871 TGTTCTCTGGGTGGGGCAGGAGG - Intronic
1148031832 17:44627415-44627437 CGTGTCCTGGGCAGGGCAGGTGG - Intergenic
1148352288 17:46949813-46949835 TGTGCTCTGGGAAGGGCAGGAGG + Intronic
1148442599 17:47719503-47719525 AGTGCTCTGGGCAGGGGCTGGGG + Intergenic
1149252325 17:54784477-54784499 CGTGGTCTGGGTTGGGCTCGGGG - Intergenic
1149746859 17:59107004-59107026 CCTGCGCAGGCTAGGGCCGGAGG - Intergenic
1151298565 17:73204363-73204385 TGTGCTGTGGCTGGGGCCGGGGG - Intronic
1151321349 17:73354472-73354494 CATGCTCTGGGTGGGGCTGATGG + Intronic
1151815457 17:76469452-76469474 CTTGCTCTGGGAGGGGCCTGTGG - Intronic
1152258676 17:79254924-79254946 CTTGCTCTAGGTAGGGCCTGGGG + Intronic
1152348595 17:79770125-79770147 CGTGGTCTAGGTTGGGCTGGGGG + Intergenic
1152376616 17:79921924-79921946 GGTGCTGCGGGGAGGGCCGGCGG - Intergenic
1155493404 18:26421176-26421198 CTTGCTGTGGATAGAGCCGGAGG - Intergenic
1160034165 18:75285907-75285929 CGTGCTCGTGGTGGGGCCAGTGG - Exonic
1160631014 18:80246710-80246732 CGTGCTCTGGGTCTGCGCGGGGG + Intronic
1161905073 19:7150446-7150468 CCTGCTCCGCGCAGGGCCGGCGG - Intronic
1162419003 19:10555210-10555232 GGTGCTCTGGGAAGTGCCCGAGG + Intronic
1166080996 19:40444115-40444137 CGGGGTCTGGGTGGGACCGGGGG - Intronic
1166111820 19:40627303-40627325 CGGGCTCTGGGAAGGAGCGGCGG - Exonic
1166218868 19:41353059-41353081 CGCGCTCTCGGCAGTGCCGGGGG - Exonic
1167661729 19:50799420-50799442 CTGGCTCTGGGGAGGGCTGGTGG - Intronic
1168320773 19:55508261-55508283 CGTGCTTGGGGTATCGCCGGAGG + Intronic
925079997 2:1056286-1056308 CGTGCTGTGGGGAGGGAGGGAGG + Intronic
925389240 2:3484269-3484291 CGTGTTCTGTGAAGGGCCAGAGG + Intronic
925778239 2:7355937-7355959 CGGGCTCTGTGTGGGGCAGGTGG + Intergenic
927287202 2:21369338-21369360 CTTTCTCTGGGTAGGGTCAGAGG + Intergenic
931263262 2:60638458-60638480 CGTGCTCTGGGTTGGCCAAGAGG - Intergenic
932188493 2:69718631-69718653 TGTGCTGTGGATAGGGCTGGTGG - Intronic
937905409 2:127050563-127050585 CGTGCTCTGTGCAGGGCTGGAGG - Intronic
938052732 2:128190167-128190189 CCTGCCCTGGGTCTGGCCGGCGG + Exonic
938078957 2:128359106-128359128 CGTGCTCTGGTTGGTGGCGGTGG - Intergenic
943401411 2:187415857-187415879 CGTGCTCTTGCTGGGGCTGGTGG - Intronic
948717091 2:239872000-239872022 CAGGCTCTGAGTAGGGCTGGGGG - Intergenic
948768075 2:240233583-240233605 GGTGCTGTGGGTGGGGCTGGAGG - Intergenic
948818870 2:240528347-240528369 GGAGCTCTGGGTAGGGTAGGAGG + Intronic
1169914994 20:10674796-10674818 CAGGCTTTGGGAAGGGCCGGCGG + Intergenic
1173548106 20:43914697-43914719 CGGGCGCTGCCTAGGGCCGGGGG - Intergenic
1175902161 20:62364242-62364264 CCTGCTCAGGGTGGGGCCAGGGG + Intronic
1175937940 20:62523532-62523554 AGGGCTCTGGGGAGGGCCGGGGG - Intergenic
1177967295 21:27744178-27744200 CATGCTCTGTGCAGGGCCCGTGG + Intergenic
1179785586 21:43728069-43728091 TGTGCTCTGAGCAGGGCTGGGGG + Intronic
1180059460 21:45377132-45377154 CGGGGTCTGGGTAGGGCCCCTGG - Intergenic
1181313941 22:21960138-21960160 CCTGCTCTGGGCAGGTCCTGGGG + Intronic
1181887016 22:26029607-26029629 CTTGCTCAGGGTAGGGAAGGAGG - Intronic
1184688452 22:46106791-46106813 CGTGCAGTGTGCAGGGCCGGGGG + Intronic
1184731485 22:46373405-46373427 AGTGCTCTGGGCGGGGCGGGGGG + Intronic
1184819078 22:46895164-46895186 GGTGCTCTGGGTCAGGCCTGAGG - Intronic
1185193179 22:49451742-49451764 CGTGTTTTGGGCAGGGCTGGAGG - Intronic
1185193193 22:49451792-49451814 CGTGCTTTGGGCAGGGCTGAAGG - Intronic
1185193201 22:49451827-49451849 CGTGCTTTGGGTAGGGCTGAAGG - Intronic
1185193216 22:49451897-49451919 CGTGCTTTGGGTAGGGCTGAAGG - Intronic
950304582 3:11908140-11908162 GGTGCTCTGGGTGGAGCGGGAGG - Intergenic
950509867 3:13419788-13419810 CGTGTTCTGGGTTGTGCGGGAGG - Intronic
955733131 3:62008676-62008698 CGTGGACTGGGTGGGGTCGGGGG + Intronic
958064663 3:88528343-88528365 CTTACTCTGGGTAGGGGAGGAGG + Intergenic
961553596 3:127682591-127682613 GGTGTCCTGGGTAGGGCCTGTGG + Intergenic
963046823 3:141108698-141108720 AGGGCTCTGGGTAGTGCAGGAGG + Intronic
966735041 3:183181269-183181291 TCTGCTCTGGGGAGGGCCTGGGG - Intronic
968699448 4:2047688-2047710 CTTGCTCTGGGTGGGGGCTGGGG - Intergenic
968830502 4:2931081-2931103 GGTGCTCTGGCCAGGGCCGCGGG - Exonic
969603988 4:8193141-8193163 CGTGCTCTGGGTAGGGCCGGGGG - Intronic
975164164 4:71158762-71158784 CGTGTTCTGGGTGAGGGCGGAGG + Intergenic
978499544 4:109394171-109394193 CGTTCTCTGGCTAGGGGCTGGGG - Intergenic
979950565 4:126887746-126887768 AGTGCTCTGGGGAGGGAAGGAGG + Intergenic
981928375 4:150164284-150164306 AGTGGTCTGGGTTGGGCCTGTGG + Intronic
986212781 5:5689911-5689933 AGTGATCTGAGTAGGGCAGGAGG + Intergenic
987160770 5:15139956-15139978 AGTGCTCTGGGTGAGGCAGGAGG - Intergenic
987441469 5:17961953-17961975 TGTGCTCTGGGTAGAGAGGGTGG + Intergenic
990823078 5:59864881-59864903 CGTGCTCTGAGTAGGTCCACTGG - Intronic
997199407 5:132000709-132000731 CCTGATGTGGGTAGGGCCTGGGG - Intronic
999307199 5:150527301-150527323 CGTGCTCAGAATAGGGCCTGTGG - Intronic
999329799 5:150665208-150665230 CGTGCTCTCGGAAGGGAAGGAGG + Intronic
999453541 5:151696489-151696511 GCTGCTCTGGGGAGGGTCGGAGG + Intergenic
1001163801 5:169345048-169345070 CTGGCTCTGGGTAGGGACAGAGG + Intergenic
1002097433 5:176839700-176839722 GGCGCTCTGGGGAGGGCCTGGGG + Intronic
1002799990 6:513228-513250 CGTGCTCTTGGTACGGCACGTGG - Intronic
1003017310 6:2478458-2478480 AGGCCTCTGGGTAGGGCCAGAGG + Intergenic
1005305962 6:24514449-24514471 CATGCTCTGGCCAGGCCCGGTGG + Intronic
1006898952 6:37487760-37487782 CATGCTCTGGGCAGAGCCTGCGG + Intronic
1007997648 6:46325582-46325604 CTTGCTCTGGGGACGGCTGGAGG + Intronic
1014094154 6:117441473-117441495 CCTCATCTGGGTAGGGCTGGGGG + Intronic
1019648638 7:2144401-2144423 CGTGCTTTGGAGAGGGCTGGTGG - Intronic
1019733264 7:2638764-2638786 TGTGCTATGGGTAGGGGCTGGGG + Intronic
1020009037 7:4798610-4798632 CCTGCCCGGGTTAGGGCCGGTGG + Intronic
1024579082 7:50787555-50787577 AGTGCCCTGGGCAGGGACGGTGG + Intronic
1027526052 7:79270097-79270119 CCTTCTCTGGGTGGGGCCGCAGG - Intronic
1033377052 7:140771854-140771876 TGTGCTCAGGGTAGAGCCAGGGG + Intronic
1034458796 7:151186802-151186824 CGTGCTCTGAGTACGGGCCGGGG - Exonic
1034895287 7:154872514-154872536 GGTGCTCTGGGTGGGGCCTGAGG - Intronic
1037154512 8:15684093-15684115 AGTGCTCTGGGGAGGGAAGGCGG + Intronic
1037304759 8:17493697-17493719 AGTGCTCTGGGTCGGGGCGGTGG + Intergenic
1037309305 8:17537575-17537597 AGTGCTGTGGGGAGGGCAGGAGG + Intronic
1038319426 8:26513941-26513963 GGTGCTCAGGGGAGGGCTGGAGG - Exonic
1039259922 8:35760328-35760350 CGTGTTCTGGCTAGGCACGGTGG - Intronic
1040550490 8:48433598-48433620 CGTCCTCTGGCTTGGGCTGGTGG + Intergenic
1043873882 8:85463937-85463959 CGTGCTCGGGGGCGGCCCGGGGG - Exonic
1047725312 8:127679249-127679271 CTGGCTTTGGGGAGGGCCGGGGG + Intergenic
1048952547 8:139508332-139508354 CGTGCTCTGGGTGTGCCCTGGGG + Intergenic
1049017378 8:139930394-139930416 CGTGGTGTCGGTAGGGCAGGTGG + Intronic
1049395514 8:142398361-142398383 TGTGTTTTGGGTAGGGCCGGGGG - Intronic
1049579844 8:143406348-143406370 CGTGCTGTGGGTAGAGGTGGGGG - Intergenic
1049581126 8:143411462-143411484 CAAGCCCTGGGTAGGGCCTGGGG + Intergenic
1056757246 9:89389438-89389460 CATGCTCTGGGTGGGGCAAGTGG + Intronic
1058583852 9:106485977-106485999 AGTGCTCTGGGTTGGGGCAGGGG + Intergenic
1058879424 9:109273671-109273693 CGTGCTCTGAGGTGGGCTGGGGG - Intronic
1060476486 9:123990721-123990743 GGTGATCTGGGTAGGTCCGTGGG + Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1062227766 9:135463161-135463183 GGTGCTCTGGGTGGGGCCCCTGG - Intergenic
1062528896 9:136991223-136991245 GGTGCTGTGGGGAGGGCCAGTGG - Intergenic
1062681994 9:137787250-137787272 CGTGGTCTTGGTAGGGGCGTGGG - Intronic
1185431633 X:14737-14759 CGGGCGCTGGGTGGGGCCGCGGG - Intergenic
1185432896 X:19752-19774 CGGGCGCTGGGTGGGGCCGCGGG - Intergenic
1185440957 X:227456-227478 CGGGCGCTGGGTGGGGCCGCGGG - Intergenic
1185442248 X:232574-232596 CGGGCGCTGGGTGGGGCCGCGGG - Intergenic
1189028986 X:37430019-37430041 CGTGCTGTGGGAGGGGCCTGGGG - Intronic
1190708518 X:53049270-53049292 GGTGCACTGGGTAGGGCTGGGGG - Exonic
1196886537 X:120251203-120251225 GGTGCCCTGGGTAGGCCCCGGGG + Intronic
1200009610 X:153111308-153111330 CATTTTCTGGGCAGGGCCGGAGG - Intergenic
1200029990 X:153288614-153288636 CATTTTCTGGGCAGGGCCGGAGG + Intergenic