ID: 969603996

View in Genome Browser
Species Human (GRCh38)
Location 4:8193168-8193190
Sequence AGGTCGTTCTAGAAGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969603996_969604003 7 Left 969603996 4:8193168-8193190 CCTCCCCTCTTCTAGAACGACCT 0: 1
1: 0
2: 0
3: 11
4: 122
Right 969604003 4:8193198-8193220 TCCTGCGCGCCTGTTTCTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 94
969603996_969604009 21 Left 969603996 4:8193168-8193190 CCTCCCCTCTTCTAGAACGACCT 0: 1
1: 0
2: 0
3: 11
4: 122
Right 969604009 4:8193212-8193234 TTCTGCTGGACAGGGCCAATGGG No data
969603996_969604005 12 Left 969603996 4:8193168-8193190 CCTCCCCTCTTCTAGAACGACCT 0: 1
1: 0
2: 0
3: 11
4: 122
Right 969604005 4:8193203-8193225 CGCGCCTGTTTCTGCTGGACAGG 0: 1
1: 0
2: 0
3: 4
4: 56
969603996_969604008 20 Left 969603996 4:8193168-8193190 CCTCCCCTCTTCTAGAACGACCT 0: 1
1: 0
2: 0
3: 11
4: 122
Right 969604008 4:8193211-8193233 TTTCTGCTGGACAGGGCCAATGG 0: 1
1: 0
2: 2
3: 15
4: 189
969603996_969604006 13 Left 969603996 4:8193168-8193190 CCTCCCCTCTTCTAGAACGACCT 0: 1
1: 0
2: 0
3: 11
4: 122
Right 969604006 4:8193204-8193226 GCGCCTGTTTCTGCTGGACAGGG 0: 1
1: 0
2: 0
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969603996 Original CRISPR AGGTCGTTCTAGAAGAGGGG AGG (reversed) Intronic
903197837 1:21706137-21706159 AGTTCTTTGTAGAAGAGTGGCGG - Exonic
904070193 1:27789758-27789780 AGCTGGATCTAAAAGAGGGGCGG + Intronic
906038808 1:42770354-42770376 AGGTAGTTCCAGATTAGGGGTGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
921608285 1:217180304-217180326 AGGACTTTCTAGAAAGGGGGAGG - Intergenic
921712188 1:218384087-218384109 AAGATGTTCTAGAAGAGGAGAGG - Intronic
1065427031 10:25616475-25616497 AATTCGTGCCAGAAGAGGGGTGG - Intergenic
1068732745 10:60377166-60377188 AGGTCCTTGCAGAAGAGGGGAGG + Intronic
1072294558 10:93996424-93996446 TGGTGCTTCTGGAAGAGGGGTGG + Intronic
1073539472 10:104306701-104306723 AGGTAGTGCTAGTAGTGGGGAGG - Intergenic
1078008695 11:7552756-7552778 AGGGCATTCCAGGAGAGGGGGGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078940872 11:16003900-16003922 AGGTTTTTCTAGAAGTAGGGAGG - Intronic
1080604001 11:33848949-33848971 ATGTCGTTTTAGAGGAGGGAGGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090637566 11:128700465-128700487 AGGGCTTTCTAGGAGAGTGGAGG + Intronic
1091919848 12:4295378-4295400 AGGTAAGTCTAGAAGAGGGTGGG + Intronic
1092273894 12:7044699-7044721 AGCTCGTTATAGAATAGGGGTGG - Intronic
1093215983 12:16361588-16361610 CTGTCGTTGGAGAAGAGGGGAGG + Intronic
1097119331 12:56719490-56719512 AGTTCCTTCTAGAAAAGGGCTGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097289969 12:57906414-57906436 ACGTCATGCTAGAAGAGGTGAGG + Intergenic
1098958873 12:76717259-76717281 AAGTAGTTTTAAAAGAGGGGAGG - Intergenic
1101000592 12:100353796-100353818 AGGGCTTCCTAGATGAGGGGAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101802184 12:108032063-108032085 AGGGCATTCTAAAAGAGGTGAGG + Intergenic
1102460929 12:113099225-113099247 AGGTAGTTCAAGAACAAGGGAGG - Exonic
1104933424 12:132352322-132352344 AGGGCGTTCTGGATGAGGGGGGG - Intergenic
1106014253 13:25853214-25853236 AGGTATTTTTAGAAGAGGCGGGG - Intronic
1106875079 13:34063114-34063136 AGGTTTTTCTTGAAGAGGTGAGG - Intergenic
1109083972 13:57946370-57946392 AGGTGGTGGTAGAAGAGGGAAGG + Intergenic
1113384349 13:109834490-109834512 AGGTTGTTCTCGTAGAGGGAAGG - Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1117026091 14:51621531-51621553 AGGTTGTTCGAGAAGATGGGTGG + Intronic
1119122610 14:72093156-72093178 TGGTCGTCCTTGAAGAGGGAAGG - Intronic
1119167436 14:72506800-72506822 AGGTCGTACTTGAATAGGGTGGG + Intronic
1122149713 14:99718315-99718337 AGCCCTTTCTAGAAGAGGAGTGG - Intronic
1128843414 15:70869357-70869379 AGCTCCTTCCAGAAGAGGGGAGG - Intronic
1131813305 15:96196593-96196615 AAGAAGTTCTGGAAGAGGGGAGG + Intergenic
1132531721 16:454168-454190 AGTTGGCTCTAGATGAGGGGAGG - Intronic
1132875415 16:2135007-2135029 AGGTGGGTCCAGAAGAAGGGGGG - Intronic
1134519569 16:14912353-14912375 AGGTGGGTCCAGAAGAAGGGGGG + Intronic
1134554362 16:15153882-15153904 AGGTGGGTCCAGAAGAAGGGGGG - Intergenic
1134707241 16:16311009-16311031 AGGTGGGTCCAGAAGAAGGGGGG + Intergenic
1134960300 16:18401116-18401138 AGGTGGGTCCAGAAGAAGGGGGG - Intergenic
1141922817 16:87147272-87147294 AGGTAGTTGCAGATGAGGGGTGG + Intronic
1142493326 17:292721-292743 CTGTCGTTCTGGAAGAGGAGAGG - Intronic
1142518346 17:447935-447957 AGGCCGGGCTAGACGAGGGGCGG + Intergenic
1145247152 17:21276831-21276853 AGGTCCCTCTGGAAGTGGGGGGG - Intergenic
1146517330 17:33499377-33499399 AGGTCATTCTAGAGCAGGGAGGG + Intronic
1147774629 17:42891928-42891950 AGCTGGCTCTGGAAGAGGGGAGG + Intergenic
1149355476 17:55834961-55834983 AGGTCATTCTAGAATAGGGTGGG + Intronic
1151271109 17:72996671-72996693 AGGTCGTACTAGAGTAGGGTGGG - Intronic
1160038106 18:75319939-75319961 AGGTCGTACTGGACGAGGGTGGG - Intergenic
1160918967 19:1510894-1510916 AGGAGGTTCTGGAAGAGGTGGGG + Exonic
1161345998 19:3768983-3769005 AGGGAGTTCTGGAGGAGGGGAGG - Intergenic
1161907904 19:7170953-7170975 AGCTCAGTCTTGAAGAGGGGTGG + Intronic
1167852699 19:52214097-52214119 AGCTGGTTCTAGAAGATGAGTGG + Intronic
926915102 2:17883716-17883738 AGGAGGTTGTAGAAGAGGGCTGG + Intronic
927494366 2:23542679-23542701 AGATCGTTCTTGCAGAGGAGGGG + Intronic
930551131 2:52836142-52836164 AGGTCATACTAGAATAGGGTGGG - Intergenic
930975999 2:57462018-57462040 AGCTCTTTCCATAAGAGGGGTGG - Intergenic
939882202 2:147643216-147643238 ATATCCTTCTAGAAGAGGAGGGG - Intergenic
943802303 2:192076670-192076692 AGGTGGTGCTAGTAGAGGGTGGG - Intronic
946999402 2:225436529-225436551 AGGTCATACTAGAAGAGGGTAGG - Intronic
948398095 2:237662275-237662297 AGGTCGTACTAGATTAGGGTGGG - Intronic
948953009 2:241267104-241267126 AGGAGGTCCTAGAACAGGGGTGG + Intronic
1170040190 20:12032267-12032289 AGGTGGTTCTAGAGGTGGGGCGG + Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1172765309 20:37347555-37347577 AGTTCATTCTAGAAGAGGATGGG + Intronic
1173278473 20:41605200-41605222 AGGTGGTTCTAGGTGAAGGGGGG + Intronic
1173864004 20:46302787-46302809 AGGGCTTTCAAGAAGAGGTGAGG - Intronic
1174654154 20:52156226-52156248 AGGCCGTGCTAAAGGAGGGGTGG - Intronic
1174725721 20:52859677-52859699 AGGTCTTCCTGGAAGAGGAGGGG - Intergenic
1179381601 21:40904196-40904218 AGGTCCTGCTAGAAAAGGGAGGG - Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
950873330 3:16248044-16248066 CAGTCGTTTTTGAAGAGGGGCGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952341961 3:32454517-32454539 AGGTGGTTCTAGAAGCAGGAAGG - Exonic
953550478 3:43898649-43898671 AGGTTGTTCTAGGAGATGTGGGG - Intergenic
957480198 3:80782897-80782919 AGGTCATACTGGAAGAGGGTGGG - Intergenic
958271957 3:91511548-91511570 AGGTCCTTCTGGAAGAGGCCTGG - Intergenic
959976746 3:112469363-112469385 AGGTCTTTCTGGAAGAGAGTAGG - Intronic
963222211 3:142825249-142825271 AGGTCAGTCTGGAAGTGGGGTGG + Intronic
963270177 3:143278677-143278699 AGGTCGTGCTGGAACAGGGCGGG - Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
964793442 3:160473912-160473934 AGTCCTTTCTAGAAGACGGGAGG - Intronic
964868865 3:161291283-161291305 AGGTGTTTGTAGAAGAGGGTTGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967229703 3:187325817-187325839 AGGTCATACTGGAAGAGGGTGGG - Intergenic
969603996 4:8193168-8193190 AGGTCGTTCTAGAAGAGGGGAGG - Intronic
983599585 4:169511230-169511252 AGGGCCTTCTTGAAGAGGGGAGG - Intronic
986201812 5:5586092-5586114 AGATCTTTCTAGAAAAAGGGCGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992157975 5:73973348-73973370 AGGTCATACTAGAATAGGGTGGG + Intergenic
999018085 5:148131203-148131225 ATGGCATTCAAGAAGAGGGGTGG - Intronic
999018579 5:148137443-148137465 AGGACTGTCTAGAAGAGAGGTGG + Intergenic
999375506 5:151083816-151083838 AGCAAGTTCCAGAAGAGGGGTGG + Intronic
1001798555 5:174523266-174523288 AGGTCGTTATAGAAGTGAGGAGG - Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007904821 6:45448885-45448907 AGGTTGTTCTACAAGAAGTGAGG + Intronic
1008983154 6:57509589-57509611 AGGTCCTTCTGGAAGAGGCCTGG + Intronic
1010883105 6:81203417-81203439 AGGTGGGTCTTGAAGAGGGCAGG - Intergenic
1011515618 6:88149360-88149382 AGCATGTTCTAGAAGAGGTGAGG - Intronic
1013006881 6:106081987-106082009 AAGCCATTCTGGAAGAGGGGAGG - Intergenic
1016050301 6:139523639-139523661 AGCTGGTTGGAGAAGAGGGGTGG + Intergenic
1016813946 6:148286664-148286686 GTGTCCTTCTAGAAGAGGAGGGG - Intronic
1018224082 6:161610856-161610878 AGGTTGTGATAGGAGAGGGGTGG + Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1041214455 8:55585927-55585949 AGGTCATACTAGAGGAGGGTGGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052313127 9:27090172-27090194 AAGTTGTTCAAGAAGAGTGGGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056084421 9:83131326-83131348 AGGTTGTTAGAGAAGAGGAGGGG + Intergenic
1057842009 9:98493987-98494009 AGGTCATACTAGAATAGGGGAGG + Intronic
1058839546 9:108892739-108892761 AGGTTGGGCTAGAGGAGGGGTGG + Intronic
1061490526 9:130941510-130941532 ACATCGTTCTGGAAGAAGGGAGG + Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186285734 X:8042248-8042270 AGCTCTTTGTAGAAGAGGGCAGG - Intergenic
1190247441 X:48699962-48699984 AAGTCATTCCAGAAAAGGGGTGG + Intronic
1190712984 X:53082725-53082747 ATGTCATTCTCGAGGAGGGGGGG + Exonic
1195039344 X:101000024-101000046 AGCCTGTTCTAGAAGAGGAGTGG + Intergenic
1195379353 X:104256066-104256088 AGATAGTTCTAGAAAAAGGGAGG - Intergenic
1195447419 X:104970535-104970557 AGATGCTTCTAGAAAAGGGGTGG + Intronic