ID: 969607275

View in Genome Browser
Species Human (GRCh38)
Location 4:8208768-8208790
Sequence TGCAGGTGGTCAGCAAATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969607270_969607275 -4 Left 969607270 4:8208749-8208771 CCGGGCGAGTGCACGCCACTGCA 0: 1
1: 0
2: 0
3: 66
4: 179
Right 969607275 4:8208768-8208790 TGCAGGTGGTCAGCAAATGCGGG 0: 1
1: 0
2: 4
3: 44
4: 246
969607269_969607275 1 Left 969607269 4:8208744-8208766 CCACACCGGGCGAGTGCACGCCA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 969607275 4:8208768-8208790 TGCAGGTGGTCAGCAAATGCGGG 0: 1
1: 0
2: 4
3: 44
4: 246
969607266_969607275 19 Left 969607266 4:8208726-8208748 CCTAGGAATGGGCTCTGGCCACA 0: 1
1: 0
2: 0
3: 14
4: 224
Right 969607275 4:8208768-8208790 TGCAGGTGGTCAGCAAATGCGGG 0: 1
1: 0
2: 4
3: 44
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969607275 Original CRISPR TGCAGGTGGTCAGCAAATGC GGG Intronic
900307371 1:2017700-2017722 AGTAGGTGCTCAGCAAATGTAGG - Intergenic
900427856 1:2588608-2588630 TGCTGGTGGTCAGCAAAGGTGGG + Exonic
900835745 1:5002511-5002533 AGCAGGTGCTTAGCAAGTGCTGG + Intergenic
901006385 1:6173660-6173682 TGCAGGGGCTCAGCAATGGCAGG + Intronic
901078495 1:6570346-6570368 TGCAGGTGGTGAGAAAAGGAGGG + Intronic
901530959 1:9852190-9852212 GGAAGGAGGTCAGCACATGCCGG - Intronic
901756796 1:11446300-11446322 TGCAGGTGCTCAGCACATGCCGG - Intergenic
902166315 1:14574693-14574715 AGCAGGTGCTCAACAAATGATGG - Intergenic
902616424 1:17625916-17625938 TGCAGGGGGTCAGCGAATGACGG + Intronic
902830529 1:19009567-19009589 TGTGGGTGTTCAGTAAATGCAGG - Intergenic
903640552 1:24857003-24857025 TGCAGGCGCCCAGCAAATGCTGG + Intergenic
903678422 1:25081339-25081361 AGCAGGAGCTCAGCAAATGTTGG + Intergenic
903934024 1:26882390-26882412 TGCATGTGCTCAGCAAAAGAGGG - Intronic
904089898 1:27937430-27937452 TGTAGGTGGTCCGTAAATGTAGG + Intronic
905237716 1:36561582-36561604 TTCACGTGGCCAGGAAATGCTGG - Intergenic
909663503 1:78109108-78109130 AGATGGTGGTCAGCAACTGCTGG + Intronic
918261706 1:182802140-182802162 CCCAGGTGTTCAGCAAAGGCTGG - Intronic
918838105 1:189496348-189496370 TGCAATAGGTCAGAAAATGCAGG - Intergenic
921230125 1:213061497-213061519 TGCAGGTGGTCATGAAAGGGAGG + Intronic
921264941 1:213414597-213414619 TGCAGGTGGTCAGAAGGGGCTGG - Intergenic
921875467 1:220191050-220191072 TGCAGGTAAGCTGCAAATGCTGG - Exonic
922337279 1:224627964-224627986 TGTTGCTGGTCAGCAAATGGAGG + Intronic
922935539 1:229419616-229419638 TGTAGGTGCTCAGCAAGTGTCGG + Intergenic
923631473 1:235651388-235651410 GGGAGGTGGGCAGGAAATGCAGG - Intergenic
923688805 1:236173573-236173595 TGCTGCTGGTCAGCAAATGCAGG - Intronic
1064931687 10:20635736-20635758 TTCCAGAGGTCAGCAAATGCAGG - Intergenic
1065862205 10:29881459-29881481 TGAACGTGGCCAGCAACTGCGGG + Intergenic
1066208393 10:33212484-33212506 TGGAGGTGGTCACCAGAGGCTGG + Intronic
1066269355 10:33807241-33807263 AGCAGGTGGTCTCCGAATGCAGG + Intergenic
1068566595 10:58582729-58582751 TGCAGGTGGCCTCCAAAAGCTGG - Intronic
1070187061 10:74074473-74074495 TGCAGGTCATCAGCATATGCAGG + Intronic
1070479484 10:76868450-76868472 TTCCAGTGGTCAGCAAATGCAGG - Intergenic
1070641983 10:78176925-78176947 TGCAGGTAGGCAGCCAGTGCAGG + Intergenic
1070759613 10:79015901-79015923 TGCTGGTGCTCAGCAAACACAGG - Intergenic
1072002574 10:91211432-91211454 GGCAGGAGTTCAACAAATGCTGG - Intronic
1072663662 10:97379140-97379162 AGCAGGTGGCCAGCCAGTGCTGG - Intronic
1073773558 10:106761756-106761778 GGCAGGTGTTCAGTAAATGTTGG - Intronic
1075617666 10:123903294-123903316 AGAAGGTGCTCAGTAAATGCTGG + Intronic
1077944759 11:6884130-6884152 TACAGGAGAGCAGCAAATGCAGG + Intergenic
1080625858 11:34030051-34030073 AGTAGGTGGTCAGTAAATGGTGG + Intergenic
1081106654 11:39078706-39078728 TGCAGCTGGCCAGCACCTGCTGG + Intergenic
1081353245 11:42081436-42081458 TGCAGAAGCTGAGCAAATGCAGG - Intergenic
1082947566 11:58775905-58775927 TGCAGGTGTTCCTCAAATTCAGG - Intergenic
1083868025 11:65468975-65468997 TGCAGGTGGACAGGCACTGCAGG - Intergenic
1084273937 11:68042512-68042534 TGGAGGTGGCCAGAAAATCCCGG - Intronic
1084442689 11:69184106-69184128 TGCAGGTGCTCTGCAAACCCAGG - Intergenic
1087371223 11:97287368-97287390 TGTAGGTGGTCAGTAAACGTAGG + Intergenic
1089014724 11:115156663-115156685 TGCTGCTGGTCAGCAAATGAAGG - Intergenic
1089152006 11:116371590-116371612 TGCAGGCGGTGAGCAGAAGCAGG + Intergenic
1089575753 11:119441894-119441916 TGCAGACGCTGAGCAAATGCTGG - Intergenic
1089627443 11:119760650-119760672 AGCAGGTGCTCAGGAGATGCCGG + Intergenic
1090201463 11:124860827-124860849 TGCTGGTAATCAGCAGATGCTGG + Intergenic
1090315188 11:125780117-125780139 TCCAGGTGGGCAGCAAGTCCAGG - Intergenic
1091293318 11:134454614-134454636 TGGAGCTGCTCAGCAAGTGCTGG + Intergenic
1091830295 12:3544496-3544518 TGCAGCTCGACAGCAAATACAGG + Intronic
1093771023 12:23018728-23018750 AGCAGATGTTCAGCAAATGTGGG + Intergenic
1094156656 12:27344504-27344526 AGCAGGTTGTCAGTAAAGGCAGG + Intronic
1096465888 12:51847705-51847727 TGTAGGTGATCAGCAAATGCTGG - Intergenic
1098870838 12:75815204-75815226 TGCAGTAGGTCATCAAAAGCAGG - Intergenic
1099118653 12:78660417-78660439 TACAGGTGGTCAGTGAATGTTGG + Intergenic
1101041714 12:100762242-100762264 TGCAGATGCTCAGCATATGGAGG + Intronic
1101962597 12:109260999-109261021 GGTAGGTGGTCAGAAAATACTGG + Intronic
1102033510 12:109758326-109758348 TACAGGTGCTCAGAAAAGGCTGG - Intronic
1105534761 13:21255240-21255262 TGCAGGTGCTCAGTAAACACTGG + Intergenic
1107386169 13:39912011-39912033 TGCAGGTGTACAGCACATTCTGG + Intergenic
1108091261 13:46852372-46852394 TGGAGGTAGTCAGCAAAGGGGGG + Intronic
1110575396 13:77049161-77049183 TGCTGGAGGTCAGCAAGTGAAGG - Intronic
1110817038 13:79873089-79873111 TGCATGTGATTAGCAGATGCAGG + Intergenic
1112369860 13:98784997-98785019 AGAAGGTGTTCAGCAGATGCTGG - Intergenic
1114051345 14:18921406-18921428 TGCAGCTGGCCAGAAATTGCTGG - Intergenic
1114111217 14:19480519-19480541 TGCAGCTGGCCAGAAATTGCTGG + Intergenic
1114369974 14:22076078-22076100 TTCAGGTGGACAGCAGAAGCTGG - Intergenic
1115583814 14:34789494-34789516 TGCAGGTAGTCATAAAATACTGG - Intronic
1118704735 14:68470414-68470436 TGCAGGTCCCCAGAAAATGCAGG + Intronic
1118710393 14:68514034-68514056 TACAGGTGCTCAGCAAACGGTGG + Intronic
1121264309 14:92589438-92589460 TGCAAGTGTTCAGCAAATACTGG + Intronic
1121357608 14:93229266-93229288 TGCAGGTTTTAAGAAAATGCAGG + Intergenic
1121439349 14:93939090-93939112 TGCAGGTGGGCAGCGCACGCTGG - Exonic
1121489621 14:94348617-94348639 AGTAGGTGCTCAGCAAAAGCTGG + Intergenic
1121936529 14:98024500-98024522 AGTAGCTGCTCAGCAAATGCTGG - Intergenic
1122300000 14:100726209-100726231 TGCAGGGGGTCGGCACATGGGGG + Intronic
1122587574 14:102820054-102820076 TGCGGGTGGTGAGCCCATGCTGG + Intronic
1124214655 15:27796603-27796625 GGCAGGTGCTCAGCGAGTGCTGG + Intronic
1125735249 15:41920311-41920333 TGGAGGTGGTCAGAATAGGCTGG - Intronic
1127474290 15:59318117-59318139 TGCATGTGGTCACCACATGTAGG + Intronic
1127601550 15:60542791-60542813 TGCAGGTTCTCAGCAAGTGGAGG - Intronic
1128759990 15:70210043-70210065 AGTAGGTGCTCAGTAAATGCTGG + Intergenic
1128767116 15:70257991-70258013 GGCAGGTGCTCAGGAAATGCAGG - Intergenic
1131449575 15:92528101-92528123 TGCAGTTGGAGAGCAAGTGCAGG - Intergenic
1131524950 15:93145440-93145462 AGCAGGTGCTCAGCCAGTGCTGG - Intergenic
1131908161 15:97166562-97166584 TGTAGGAGCTCAGCAAATACTGG + Intergenic
1132659182 16:1053996-1054018 AGTAGGTGCTCAGCAAATGCCGG + Intergenic
1133558927 16:6932014-6932036 TGCAGGAGGTTAGCTACTGCAGG - Intronic
1133969973 16:10560543-10560565 AGCAGGTGCTCAATAAATGCTGG - Intronic
1135147045 16:19971805-19971827 TGCAGGTGGGTAGGAAATGCAGG + Intergenic
1135739059 16:24957724-24957746 GGAAGGTGGTAAGAAAATGCAGG + Intronic
1136083705 16:27869347-27869369 AGCAGGTGCTCAGTAAATGTCGG + Intronic
1137055862 16:35746466-35746488 TGCAGGTGGGCAGGAAAGGGAGG - Intergenic
1137934372 16:52620257-52620279 TGCAGGTGGAGAGGAAATGGGGG - Intergenic
1140224721 16:73068028-73068050 GGTAGGTGCTCAGCAAATGTGGG - Intergenic
1140454681 16:75098169-75098191 TGCAGCCGGTCAGCAACAGCTGG - Intronic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1141640471 16:85338091-85338113 GACAGGTGGTCAGCAAGAGCAGG - Intergenic
1143581584 17:7830774-7830796 TGTAGGTGGTCAGCAGGCGCCGG - Exonic
1143753677 17:9050852-9050874 ACCAGGTGCTCAGGAAATGCTGG + Intronic
1144636133 17:16910419-16910441 AGCAGATGGTCAGCAAACACAGG - Intergenic
1144645937 17:16973408-16973430 TGCAGACGGTCAGCAAACACAGG + Intergenic
1144718089 17:17448218-17448240 TGGAGGAGGTCAGCTAATTCTGG - Intergenic
1146025955 17:29321130-29321152 TGCAAGTGTTCAGCAAATTATGG - Intergenic
1146160829 17:30558793-30558815 TGCAGGTGGTGGGCTACTGCAGG + Exonic
1147529821 17:41265311-41265333 TGCAAGGGGTCATCAAATCCTGG + Intergenic
1150123752 17:62623389-62623411 TGGAGATGTTCAGAAAATGCAGG + Intergenic
1151497295 17:74466537-74466559 TGGAGCCGGTCAGAAAATGCAGG - Exonic
1151620529 17:75242254-75242276 GGCACGTGCTCAGCAAATGCTGG + Intronic
1151967421 17:77438626-77438648 TGCAGGTGAACAGAAAATGCAGG + Intronic
1153723294 18:7929718-7929740 TGAAGGTTTTCAGCAGATGCTGG + Intronic
1155060473 18:22223838-22223860 TGCTGGCGGTGAGCAACTGCGGG + Intergenic
1155250580 18:23949666-23949688 TGCAGCTTGTCAGCAAAAGGGGG - Intronic
1155450953 18:25962384-25962406 GTCAGGTGGTCAGCAAGTGTTGG - Intergenic
1159544178 18:69818492-69818514 TTCAGGTGGACAGCAACTTCAGG - Intronic
1159600848 18:70427338-70427360 AGCAGGGGCTCAGCAAATGTTGG + Intergenic
1159628650 18:70724019-70724041 TTCAGTTTGTCAGCAAATACTGG + Intergenic
1160168553 18:76533665-76533687 TGGAGGTGGTCTGCAGGTGCAGG + Intergenic
1160415702 18:78709317-78709339 AGCAGGTGGTCAGCATATTGAGG + Intergenic
1160702310 19:513572-513594 AGTAGGTGCTCAGTAAATGCTGG - Intronic
1160702380 19:514068-514090 AGTAGGTGCTCAGCAAATGTGGG - Intronic
1160702446 19:514524-514546 AGTAGGTGCTCAGTAAATGCAGG - Intronic
1160758983 19:773080-773102 GGCAGGTGTGGAGCAAATGCTGG + Intergenic
1160979137 19:1808482-1808504 AGCAGGTGCTCAGTAACTGCTGG - Intronic
1160979141 19:1808522-1808544 AGCAGGTGCTCAGTAAATGCTGG - Intronic
1160979146 19:1808562-1808584 AGCAGGTGCTCAGTAAATGCTGG - Intronic
1160979150 19:1808602-1808624 AGCAGGTGCTCAGTAAATGCTGG - Intronic
1161262591 19:3346024-3346046 AGCAGGTGCTCAATAAATGCGGG + Intergenic
1162870573 19:13583349-13583371 AGCAGGTGGTTAGTAAAGGCTGG - Intronic
1165706877 19:37982647-37982669 TGCATGTGGCCTGCAAAAGCTGG - Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166121886 19:40691344-40691366 AGCAGGTGGTCAGCACGTGGGGG + Intergenic
1166172064 19:41035360-41035382 TGGAGGTTGCAAGCAAATGCAGG + Intergenic
1166810063 19:45509090-45509112 GGCAGGGGTTCAGGAAATGCGGG - Intronic
929588989 2:43133159-43133181 TGCAGGTGCTCAGCAGGTGCAGG + Intergenic
930579310 2:53190722-53190744 TGTAGGTGGTCAGCTAATATGGG - Intergenic
931670849 2:64645325-64645347 TGCAGGTCTTCGTCAAATGCAGG - Intronic
933293330 2:80461911-80461933 TGCAAGTTGTCAGCAAGGGCAGG + Intronic
934524966 2:95046175-95046197 AGCAGGTGGGCAGCAGGTGCAGG + Intronic
934590898 2:95549485-95549507 TAAAGGTGGTTAGCAGATGCTGG + Intergenic
935863756 2:107362819-107362841 TGCAGCAGGTCGGCAGATGCTGG + Intergenic
935959765 2:108413473-108413495 TGCAGGGTGTCACCAAGTGCTGG + Intergenic
937077741 2:119119145-119119167 AGCAGGTGTGCAGCAAATGATGG - Intergenic
937423559 2:121778430-121778452 GGCAGCTCGACAGCAAATGCAGG - Intergenic
938159727 2:128974255-128974277 TGCAGGTGGTCCCAAACTGCAGG - Intergenic
938596218 2:132789902-132789924 AGCAGGTGCTCAGCAAATGGTGG + Intronic
939825633 2:147012083-147012105 TGCAGGTGGCCTCCAAAAGCAGG + Intergenic
940574470 2:155483342-155483364 TACAGAAGGTCAGCAAAGGCTGG - Intergenic
940583237 2:155608248-155608270 AGTAGGTGATCAGTAAATGCTGG - Intergenic
942306121 2:174609083-174609105 TGCAGGTGGACAGTAAATGGTGG + Intronic
945294197 2:208154709-208154731 TACAGGTGGACAGCAAGGGCTGG - Intergenic
946189446 2:218000508-218000530 AGTAGGTGCTCAGCAAATGCTGG - Intronic
946730192 2:222702004-222702026 TCCAGGTGCTAGGCAAATGCAGG + Intronic
946862185 2:224010775-224010797 AGCAAGTGTTCAGTAAATGCTGG + Intronic
946914781 2:224507105-224507127 GTCATGTGGTCAGCAAATGGGGG - Intronic
947945885 2:234101877-234101899 AGCAGGTGTTCAGCGAATGTTGG + Intergenic
948162767 2:235838544-235838566 TACATATGGTCAGTAAATGCTGG - Intronic
948251405 2:236532966-236532988 TGTATCTGGTAAGCAAATGCAGG + Intergenic
948600219 2:239103695-239103717 TGCAGGAGCTCAGCGGATGCTGG - Intronic
1168963121 20:1882181-1882203 AGCAGGTGCCCAGCAAATGTGGG - Intergenic
1170640728 20:18150393-18150415 TGCCGTTGGTCAGAAAATGCTGG + Intronic
1171371139 20:24662712-24662734 TGCAGGCGGTTAGAAAGTGCAGG - Intronic
1173859893 20:46276453-46276475 TGTAGGTGGTCAGCAAAGAGAGG + Intronic
1174505670 20:51015946-51015968 TGCAGGTGGCCTCCAAAGGCTGG + Intronic
1175316809 20:58054425-58054447 AGTAGGTGCTCAACAAATGCTGG - Intergenic
1175829574 20:61954760-61954782 TGCACGTGGGCAGCAGATGCAGG - Intronic
1178582139 21:33846246-33846268 GGCAGGTGGGCAGGAAAGGCAGG - Intronic
1178892315 21:36530455-36530477 AGCAGGTGTTCAGTAAAAGCTGG - Intronic
1178899642 21:36588814-36588836 TGGGGATGGTCAGCAAATGCAGG - Intergenic
1179038625 21:37782420-37782442 TGCAGGTGGTAAGCATTTACAGG - Intronic
1179250707 21:39668916-39668938 GGTAGGTGCTCAGTAAATGCAGG + Exonic
1179343337 21:40533086-40533108 TGCAGTTAGTCAGCAAAAGCAGG + Intronic
1179379861 21:40888404-40888426 TGCAGGTGGGCACCCATTGCTGG + Intergenic
1180469818 22:15643781-15643803 TGCAGCTGGCCAGAAATTGCTGG - Intergenic
1181727366 22:24820740-24820762 AGTAGGCGCTCAGCAAATGCTGG - Intronic
1181811831 22:25407930-25407952 AGCAGGTGCTCAGTAAATGTTGG + Intergenic
1181994892 22:26869517-26869539 TGCAGGTGCTCTGTAAAAGCAGG - Intergenic
1182191744 22:28468240-28468262 TGCAGCTGATCTACAAATGCTGG + Intronic
1182546383 22:31079148-31079170 AACAGGTGTTCAGCAAATGCTGG + Intronic
1182578154 22:31287656-31287678 AGTAGGTGGTCAGTAAATGATGG - Intronic
1184146159 22:42612494-42612516 GGCAAGTGTTCAGCAAAGGCTGG - Intronic
1184544114 22:45154143-45154165 TCCAGGTGGACACTAAATGCAGG - Intergenic
1184577915 22:45388551-45388573 AGGAGGGGCTCAGCAAATGCTGG - Intronic
1184587027 22:45454812-45454834 TCCAGGTGGCCAGCAATGGCTGG - Intergenic
1185050038 22:48549561-48549583 TGCAGGGACTCAGCAAAAGCAGG + Intronic
1185278434 22:49959920-49959942 TGGAGGTGGACAGCAGCTGCTGG + Intergenic
949695383 3:6688554-6688576 GGTCGGTGGTCAGGAAATGCTGG - Intergenic
950157514 3:10734144-10734166 TGAAGGTGCTCACCAGATGCTGG + Intergenic
950396031 3:12734744-12734766 TCCAGGTGGGCAGCAGAGGCAGG - Exonic
950674880 3:14548659-14548681 AGTAGGTGCTCAGCAAATGCTGG - Intergenic
950793374 3:15491427-15491449 TGGAGATGGTCGGCAGATGCTGG - Intronic
953081881 3:39628711-39628733 TGCAGGTTCTCACCAAATGCTGG + Intergenic
953636571 3:44669985-44670007 TGCAGGTGGGCAGCAAGGGTAGG + Intergenic
955830216 3:62993383-62993405 AGTAGGTGCTCAGTAAATGCTGG + Intergenic
959162904 3:102741269-102741291 TGCGGGTGGCCAGGAAATGTGGG - Intergenic
962498667 3:135966655-135966677 TCTTGGTGGTCAGCAAATGTAGG + Intronic
963693175 3:148531138-148531160 TGCAAGTTCTCAGCAGATGCAGG + Intergenic
964862851 3:161221368-161221390 TGCGGGTTTTCAGCAAATCCAGG + Intronic
969035381 4:4249195-4249217 TGCAGCTGCTCAGAAAATGTTGG - Intergenic
969060431 4:4429704-4429726 TACAGGGGCACAGCAAATGCTGG - Intronic
969082916 4:4633659-4633681 TGCAAGTGCTCAGCAAATGGTGG + Intergenic
969607275 4:8208768-8208790 TGCAGGTGGTCAGCAAATGCGGG + Intronic
971170917 4:24231594-24231616 TGCAGCTGGGCAGCTAATTCGGG - Intergenic
972121488 4:35709917-35709939 TGCAGGTGGTCTGATATTGCAGG + Intergenic
972359424 4:38313875-38313897 GGAAGGTAATCAGCAAATGCTGG + Intergenic
972924460 4:43986002-43986024 TGCAGGCTGTCAGCAAGTGCAGG + Intergenic
977785809 4:101033892-101033914 TGCTGGTGGTGAGCAAAAGAAGG - Intronic
979359915 4:119749488-119749510 TGCAGATGGTCTGCCACTGCAGG + Intergenic
983041171 4:162929592-162929614 TGCAGGTGATTTGCAAATCCAGG + Intergenic
983460291 4:168018303-168018325 TGCATGTGGACAGAAAATGGTGG - Intergenic
983909279 4:173218827-173218849 AGCAGGGGGTCAATAAATGCTGG - Intronic
984486991 4:180383017-180383039 TGCAAGTGTTCAGAAAATGAAGG + Intergenic
987681349 5:21140125-21140147 TGGGGGTGGTGAGCAAATACAGG - Intergenic
992881399 5:81113951-81113973 GGCAGGCGGCCAGCAAATGTGGG - Intronic
995064313 5:107842971-107842993 TGAAGGTGCTGACCAAATGCTGG + Intergenic
997420919 5:133766092-133766114 TGTAGGTGCTCAATAAATGCTGG + Intergenic
998989949 5:147804558-147804580 TGCAGCTGAGCAGGAAATGCAGG + Intergenic
999233139 5:150074166-150074188 TCCAGGTGTTCAGCTGATGCTGG - Intronic
1000407655 5:160905765-160905787 TGCAGATAGTCAATAAATGCTGG + Intergenic
1000648810 5:163790200-163790222 TGCAGCTGCACAGCAAATGCTGG + Intergenic
1000957456 5:167559888-167559910 TGTGGGTGGTCGACAAATGCAGG + Intronic
1001281043 5:170386644-170386666 TGCAGGTTGTCAGGAGAGGCAGG + Intronic
1002644908 5:180648322-180648344 TACAGGTGGTGAGCAAAGGCAGG + Intronic
1002648328 5:180673447-180673469 TCCTGGTGGTCAGCGCATGCTGG - Intergenic
1002937802 6:1688244-1688266 AGTAGGTGCTCAGCAAATGCTGG - Intronic
1003714922 6:8635546-8635568 GGCAGGTGGACAGCAAATGAGGG - Intergenic
1005577741 6:27205688-27205710 TGCAGGTGGTAAGTAAATTTTGG + Intergenic
1006443805 6:34067878-34067900 TGCAGATGCTCAGTAAATGTGGG - Intronic
1007617064 6:43186451-43186473 TGCAGGTGGGCAGCACATGGTGG + Exonic
1007777188 6:44230343-44230365 TGCAGGATGGCACCAAATGCTGG - Exonic
1007810567 6:44482868-44482890 TGTAGGTGCTCAGTAAATGATGG - Intergenic
1008012846 6:46487494-46487516 TGAAGGTGCTCAGGAAATGGAGG - Intronic
1008420002 6:51287497-51287519 AGCAGGTGGTTAATAAATGCTGG + Intergenic
1008682070 6:53883280-53883302 TGTAGGTGGTCAGTAAATACTGG + Intronic
1011245621 6:85318319-85318341 TGCAGGGGGGCAGGAAATGTAGG + Intergenic
1012018862 6:93890266-93890288 TCCAGGTGGTTTGAAAATGCTGG + Intergenic
1012760791 6:103297984-103298006 TGCAGGTGGCCCGCAGAAGCTGG - Intergenic
1015634000 6:135258165-135258187 TGTTGGGGGTCAGCAAATGATGG - Intergenic
1016395660 6:143621040-143621062 GGCAGGTGGGCAGCAGATGGGGG + Intronic
1017249016 6:152260082-152260104 TCCAGGAGGTCTGCAGATGCCGG + Intronic
1018921969 6:168181635-168181657 TGCAGGTGCTCAGTAAATGCTGG - Intergenic
1020001395 7:4758252-4758274 AGCAGGTGGGCAGCAATGGCTGG - Intronic
1021649007 7:22814709-22814731 TGTATGTGGTCAGCAAATATTGG - Intronic
1023231231 7:38032101-38032123 TGCAGGTGGGCAGCAGATATAGG - Intergenic
1023395052 7:39744690-39744712 TGCAGGAGCTCAACAAATGAGGG - Intergenic
1024432753 7:49309179-49309201 TACAGGAGGTCAGGAAATCCTGG + Intergenic
1024566623 7:50686671-50686693 TGCAGGTGCTCAAAAAATGGTGG - Intronic
1025711075 7:63910484-63910506 TGCAGGTTTTCAGCAAATCCAGG - Intergenic
1026885032 7:73935899-73935921 TGCAGGTGGTCACCAGAAGCTGG + Intergenic
1029707391 7:102283016-102283038 TGCAGGTGGTCAGCGAACCTGGG - Intronic
1032188218 7:129745909-129745931 TCCTGGTGGTCTGCAAAAGCAGG + Intronic
1032954196 7:136951446-136951468 TACAGCTGGTCAGCAAAGCCAGG - Intronic
1035302372 7:157906016-157906038 TGCAGGGGGTCAGCATCTCCGGG + Intronic
1035591832 8:822248-822270 AGCAGGAAGTAAGCAAATGCTGG - Intergenic
1036419928 8:8586031-8586053 TGGAGGTGGTGAGAAAAGGCAGG - Intergenic
1037993010 8:23333769-23333791 AGCAGGTGCTCAGTGAATGCTGG - Intronic
1038745295 8:30249553-30249575 TACAGATGGGCAGCAACTGCGGG - Intergenic
1039403251 8:37291215-37291237 TACAGGTGGACAGTAAAGGCAGG + Intergenic
1039985927 8:42448019-42448041 TGAAGGTGGACAGCAGACGCTGG - Intronic
1040047118 8:42975364-42975386 AGCAGGTGCTCAGTAACTGCGGG - Intronic
1042793604 8:72635644-72635666 TGGAGGTCCTCTGCAAATGCTGG + Intronic
1044365667 8:91342348-91342370 TGGTGGTGGAAAGCAAATGCTGG - Intronic
1047034788 8:120925477-120925499 AGCAGGTGCTCAGCAAGTGTTGG + Intergenic
1047071774 8:121353090-121353112 GGCAGGTGTTCAGCAGATGCTGG - Intergenic
1047606736 8:126482019-126482041 TGCTGGAGGTCAATAAATGCCGG - Intergenic
1048438170 8:134436996-134437018 TGCAAGGGGGCAGCAAAGGCTGG + Intergenic
1048576246 8:135692248-135692270 TGCTGGTTGTCAGGAAATGTAGG + Intergenic
1049234451 8:141505454-141505476 AGCAGGTGCTCAGCAAATACTGG + Intergenic
1049292648 8:141812806-141812828 TGCAGGGGGTCAGGAGATGAGGG - Intergenic
1052731478 9:32291319-32291341 TGCAGGTGGTCAGGGAAGTCGGG + Intergenic
1053473130 9:38360892-38360914 AACAGATGCTCAGCAAATGCTGG + Intergenic
1056335043 9:85560053-85560075 TGGAGGGGGTCTCCAAATGCTGG - Intronic
1056821276 9:89843838-89843860 AGCAGGTGCTCAGTAAATGCCGG - Intergenic
1057471740 9:95363255-95363277 GGCAGGTGTTCAGGAAGTGCTGG + Intergenic
1059421834 9:114197055-114197077 AGCAGGTGTTCAGGAAATGGGGG + Intronic
1060108943 9:120892888-120892910 AGCAGGTGTTCAGGAAATGAGGG + Intronic
1060181603 9:121538197-121538219 TGGAGGTGCTCAGGAAATGTTGG - Intergenic
1060258363 9:122052534-122052556 AGCAGGTGTTCAAAAAATGCTGG + Intronic
1060526773 9:124325334-124325356 TGCAGGTGGTCTGAAAGTGCTGG + Intronic
1060689349 9:125642840-125642862 TGGAGGAGGTCCCCAAATGCTGG - Intronic
1060882844 9:127130315-127130337 AGCAGGTGCTCAGTAAATGCTGG + Intronic
1061503830 9:131019557-131019579 AGCAGGTGCTCACTAAATGCTGG - Intronic
1062052079 9:134452799-134452821 TGCATGTGGGCAGCAAATGTGGG + Intergenic
1189247455 X:39574643-39574665 TGCAGGTGCTTAGCCATTGCAGG + Intergenic
1192446714 X:71216393-71216415 CACAGGTGGTAAGCAAGTGCTGG - Intronic
1192548286 X:72031655-72031677 AGCTGGTTCTCAGCAAATGCTGG + Intergenic
1195646917 X:107242485-107242507 TGCACGGGGTCAGCACATGCTGG - Intronic
1198029757 X:132743541-132743563 TGTAAGTGGTCAATAAATGCTGG - Intronic
1198735006 X:139775762-139775784 TCCAGGTGGCCAGCTCATGCAGG + Intronic
1200842763 Y:7800185-7800207 TGCAGATGGTTATCAGATGCTGG + Intergenic