ID: 969608546

View in Genome Browser
Species Human (GRCh38)
Location 4:8214352-8214374
Sequence TGGGTGTGTCGTCCCCCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969608546 Original CRISPR TGGGTGTGTCGTCCCCCGCC GGG Intronic
903894996 1:26596825-26596847 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
912527035 1:110291185-110291207 TGGGTGAGTCTTCCCAGGCCTGG + Intergenic
916105022 1:161423627-161423649 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
921533212 1:216311168-216311190 TAGGTCTGTCATCCCCAGCCTGG - Intronic
1067431136 10:46246867-46246889 TGGGTGGCTCGGCCCCAGCCAGG - Intergenic
1067442271 10:46315360-46315382 TGGGTGGCTCGGCCCCAGCCAGG + Intronic
1069386124 10:67884789-67884811 AGGCCGCGTCGTCCCCCGCCGGG + Exonic
1071829779 10:89360293-89360315 TGGGTGTGTCCTCCCCAACATGG - Intronic
1072117239 10:92376598-92376620 TGGGGGGGTCGGCCCCTGCCCGG + Intergenic
1074151923 10:110766943-110766965 TGGGGGGGTCACCCCCCGCCCGG - Intronic
1074151977 10:110767069-110767091 TGGGGGGGTCACCCCCCGCCCGG - Intronic
1077668783 11:4138062-4138084 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1083118933 11:60491781-60491803 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1088658863 11:112026932-112026954 TGGGGGGGTCAGCCCCCGCCTGG - Intronic
1089420969 11:118331577-118331599 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
1089421021 11:118331703-118331725 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
1090323009 11:125863264-125863286 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1090402614 11:126458677-126458699 TGGATTTGTGGTCCCCCGTCTGG - Intronic
1096257155 12:50070427-50070449 TGTGTGTGTCGCCCCACACCAGG + Intronic
1097126986 12:56783580-56783602 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1099255420 12:80307909-80307931 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1101424877 12:104579690-104579712 TGGATGTGCCCTCCCCTGCCGGG - Intronic
1107493342 13:40901097-40901119 TGGGGGGGTCACCCCCCGCCCGG + Intergenic
1108502108 13:51078287-51078309 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1112692995 13:101916978-101917000 TGGCGGTGGCGACCCCCGCCGGG - Intronic
1113473569 13:110563572-110563594 TGTTTGTGTCGTCCCAGGCCAGG - Intergenic
1114427969 14:22637902-22637924 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1115622305 14:35152592-35152614 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1116005232 14:39285414-39285436 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1116841087 14:49821213-49821235 TGGGGGGGTCAGCCCCCGCCAGG + Intronic
1118584763 14:67341561-67341583 TGGGGGGGTCAGCCCCCGCCAGG + Intronic
1119594948 14:75925175-75925197 TGGGGGGGTCAGCCCCCGCCAGG - Intronic
1122665574 14:103327157-103327179 TGCGTGTGTTCTCCCCCTCCAGG - Intergenic
1123886229 15:24730634-24730656 TGGGTGTGGAGTCCCAGGCCCGG - Intergenic
1124240458 15:28023982-28024004 TGGGTGTGTGGTCTCCTGTCTGG - Intronic
1125459381 15:39893770-39893792 TGGGGGGGTCAGCCCCCGCCTGG - Intronic
1125459533 15:39894123-39894145 TGGGGGGGTCAGCCCCCGCCTGG - Intronic
1125500895 15:40239865-40239887 TGTGTGTGCCGTCCCCCTGCTGG + Intronic
1125591013 15:40854461-40854483 TGGGGGTGTCGTCACACTCCAGG - Exonic
1128489770 15:68134706-68134728 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1128489963 15:68135133-68135155 TGGGGGGGTCAGCCCCCGCCAGG - Intronic
1128490012 15:68135230-68135252 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1131376135 15:91925082-91925104 TGGGTGTGCCTTCCCCAGTCAGG - Intronic
1132700207 16:1219030-1219052 TGGCTGTGTCGTCCCCAGCCAGG + Exonic
1136062313 16:27735129-27735151 TGGGAGGGTCGTACCCTGCCTGG - Intronic
1136535116 16:30894445-30894467 TGCGTGTGTCCGCCCTCGCCAGG + Intronic
1136773027 16:32857855-32857877 TGGGTGTCTCCTCCTCCTCCTGG - Intergenic
1136897588 16:34003664-34003686 TGGGTGTCTCCTCCTCCTCCTGG + Intergenic
1138642350 16:58396506-58396528 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1138738619 16:59280852-59280874 TGGGTGTGTCCTCAGCCTCCAGG - Intergenic
1139329298 16:66175159-66175181 TGGGTGGGTCATCGCCAGCCAGG + Intergenic
1203075452 16_KI270728v1_random:1119965-1119987 TGGGTGTCTCCTCCTCCTCCTGG - Intergenic
1147338416 17:39740252-39740274 TGGGTGTGTCGTGCCCCTCCTGG + Intronic
1148749103 17:49934620-49934642 TGGGTGTGTCCTCCCCAGGATGG - Intergenic
1149532159 17:57404243-57404265 TGGGTGTGGACTCCCCCTCCAGG + Intronic
1157511347 18:48277639-48277661 TTGGTGTGTCCTCACCAGCCGGG - Intronic
1157629424 18:49080579-49080601 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1162164008 19:8739839-8739861 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1164192393 19:22926825-22926847 TGGGGGTGTCAGCCCCCGCCCGG + Intergenic
1164192622 19:22927358-22927380 TGGGGGTGTCAGCCCCCGCCCGG + Intergenic
1164192803 19:22927763-22927785 TGGGGGTGTCAGCCCCCGCCCGG + Intergenic
1164192900 19:22927963-22927985 GGGGGGTGTCAGCCCCCGCCCGG + Intergenic
1164238919 19:23366185-23366207 TGGGGGGGTCAGCCCCCGCCGGG - Intronic
1165199480 19:34132872-34132894 TGGGGGGGTCAGCCCCCGCCAGG + Intergenic
1165350842 19:35274513-35274535 TGGGTGTGGTGGCTCCCGCCCGG + Intronic
1165901203 19:39170113-39170135 TGGGTCTGTCTTCCACTGCCAGG - Intronic
1166531958 19:43548108-43548130 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
925756333 2:7135636-7135658 TGGCTGTGCCCTCCCCTGCCTGG + Intergenic
927645735 2:24875658-24875680 TGGGTGGGGAGTCCCCCTCCCGG + Intronic
929075756 2:38077350-38077372 CGGGGGTGGCTTCCCCCGCCTGG + Intronic
930607943 2:53511483-53511505 TAGCTGGGTCATCCCCCGCCGGG + Intergenic
930665541 2:54095993-54096015 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
930833818 2:55773602-55773624 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
931576460 2:63722609-63722631 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
934763702 2:96869316-96869338 AGGGTGTGGGGTGCCCCGCCTGG - Intronic
939578566 2:143922299-143922321 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
945409259 2:209489003-209489025 GGTGTGTGTCGTCCCCTGCTGGG - Intronic
946304251 2:218846854-218846876 TGGGGGTGTCGCCCCCCGCCCGG + Intergenic
947402423 2:229743109-229743131 TGGGGGGGTCAGCCCCCGCCAGG + Intergenic
948706436 2:239795994-239796016 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
948864519 2:240768546-240768568 TGTGTGTGTCATGCCCCACCTGG + Intronic
1169189381 20:3648166-3648188 TGGGTGGGTCGAGCCCCTCCTGG - Exonic
1170202607 20:13760756-13760778 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
1170645750 20:18194707-18194729 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1171957377 20:31471350-31471372 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1172237776 20:33389538-33389560 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
1172907351 20:38379181-38379203 TGGGGGTGTCAGCCCCCCCCCGG + Intergenic
1176129663 20:63491368-63491390 TGGGGGTCTTGTCCCCCCCCAGG + Intronic
1179646349 21:42778552-42778574 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1185074867 22:48677766-48677788 CGGGCGTGGCGTCCCCCTCCTGG + Intronic
949225796 3:1693494-1693516 TGGGTTTGTCCTCGCCCACCAGG - Intergenic
952152390 3:30606975-30606997 CGGGTGAGTGGTCCCCAGCCCGG + Exonic
952342942 3:32460259-32460281 TGGGTCTGTCTTCCCCTACCTGG - Intronic
959415251 3:106073827-106073849 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
959419393 3:106111967-106111989 TGGGGGGGTCAGCCCCCGCCTGG - Intergenic
960924309 3:122780496-122780518 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
961789068 3:129363397-129363419 TGGGGGTGTCAGACCCCGCCCGG - Intergenic
963911333 3:150820414-150820436 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
967428466 3:189354605-189354627 TGGGTGTGTGGTACCACACCTGG + Intergenic
967982131 3:195072028-195072050 TGGGTGAGTCCTCTCCCTCCTGG - Intronic
968411729 4:395950-395972 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
968667275 4:1828546-1828568 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
969608546 4:8214352-8214374 TGGGTGTGTCGTCCCCCGCCGGG + Intronic
982075393 4:151732054-151732076 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
982191973 4:152866486-152866508 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
984803855 4:183736098-183736120 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
985750046 5:1668377-1668399 TAGGTGTGTCCTCCCCAGCCTGG + Intergenic
989211554 5:38862408-38862430 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
989379704 5:40800547-40800569 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
992469678 5:77042800-77042822 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
992663715 5:78985341-78985363 TGGGGGTGCCGTCCCGCGCCGGG - Exonic
992914268 5:81432757-81432779 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
993162672 5:84312177-84312199 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
993162720 5:84312274-84312296 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
999180995 5:149670301-149670323 TGGGGGGGTAGCCCCCCGCCCGG - Intergenic
1000636136 5:163645632-163645654 TGGGTGGGGCGTCACCAGCCAGG + Intergenic
1002013812 5:176305404-176305426 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
1003305868 6:4927694-4927716 TGGGTGTGTTGGCTCACGCCTGG - Intronic
1005606773 6:27484998-27485020 TGGGGGTGTCAGCCCCCGCCCGG - Intergenic
1006844848 6:37055120-37055142 TGCGTGTGGCTTCCCCTGCCTGG + Intergenic
1007644006 6:43366879-43366901 TTGCTCTGTCGTCCCCAGCCTGG + Intronic
1014316014 6:119865647-119865669 TGAGTGTGTCATCCTCCCCCAGG + Intergenic
1015643542 6:135363756-135363778 TGGGGGGGTCAACCCCCGCCCGG - Intronic
1016973520 6:149786306-149786328 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1018295432 6:162339339-162339361 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
1021713845 7:23443154-23443176 TGGGTGTGGTGTCACCAGCCTGG - Intronic
1021991888 7:26148247-26148269 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1022830171 7:34057820-34057842 TGTGTGTGTGTTCCCCCTCCTGG - Intronic
1025011586 7:55402590-55402612 TGGGGGGGTCATCCCCCGCCTGG - Intronic
1025821564 7:64968131-64968153 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
1029488155 7:100855779-100855801 TGGCTGTGCCGTCTCCCTCCTGG + Exonic
1035445768 7:158942056-158942078 TGGATGTGTCGTCCTGCACCAGG - Exonic
1035649643 8:1255110-1255132 TGTGTGTGTCCTCTCCTGCCCGG + Intergenic
1035649674 8:1255264-1255286 TGTGTGTGTCCTCTCCTGCCTGG + Intergenic
1035649699 8:1255389-1255411 TGTGTGTGTCCTCTCCTGCCTGG + Intergenic
1035649717 8:1255509-1255531 TGTGTGTGTCATCTCCTGCCTGG + Intergenic
1035649739 8:1255657-1255679 TGTGTGTGTCGTCTCCTGCCTGG + Intergenic
1035649765 8:1255834-1255856 TGTGTGTGTCCTCTCCTGCCTGG + Intergenic
1035649780 8:1255924-1255946 TGTGTGTGTCCTCTCCTGCCTGG + Intergenic
1035649790 8:1255983-1256005 TGTGTGTGTCCTCTCCTGCCTGG + Intergenic
1035649795 8:1256012-1256034 TGTGTGTGTCCTCTCCTGCCCGG + Intergenic
1035649806 8:1256073-1256095 TGTGTGTGTCTTCTCCTGCCCGG + Intergenic
1035649811 8:1256102-1256124 TGTGTGTGTCCTCTCCTGCCTGG + Intergenic
1035649837 8:1256246-1256268 TGTGTGTGTCCTCTCCTGCCTGG + Intergenic
1035649842 8:1256275-1256297 TGTGTGTGTCCTCTCCTGCCCGG + Intergenic
1035649853 8:1256336-1256358 TGTGTGTGTCCTCTCCTGCCCGG + Intergenic
1035649878 8:1256485-1256507 TGTGTGTGTCCTCTCCTGCCTGG + Intergenic
1037767884 8:21782980-21783002 TGGGTGTGACGTTCCCAGCAGGG - Intronic
1040069557 8:43179229-43179251 TGGGGGGGTCAGCCCCCGCCCGG - Intronic
1053612905 9:39733265-39733287 TGGGTGTGGAGTCCCCTCCCAGG + Intergenic
1053870945 9:42491207-42491229 TGGGTGTGGAGTCCCCTCCCAGG + Intergenic
1054240609 9:62609137-62609159 TGGGTGTGGAGTCCCCTCCCAGG - Intergenic
1054554744 9:66643659-66643681 TGGGTGTGGAGTCCCCTCCCAGG - Intergenic
1055390874 9:75821172-75821194 GGGGTGTGTCGACCCCTGCTGGG + Intergenic
1056929280 9:90861252-90861274 TGGGGGTGTTGTTCCCTGCCTGG + Intronic
1059121124 9:111641528-111641550 TGGGGGGGTCGGACCCCGCCCGG + Intronic
1059466283 9:114470752-114470774 TGGGTGTGTAGACCCCAGGCCGG - Intronic
1062070169 9:134551171-134551193 TGGGTGTGACGTCTCCCACACGG - Intergenic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1185584680 X:1235681-1235703 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1185584752 X:1235828-1235850 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1188477174 X:30602499-30602521 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1190174756 X:48139320-48139342 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic
1190908459 X:54750715-54750737 TGGGTGTGTCTACCTCCTCCAGG + Intronic
1190938304 X:55016026-55016048 TGTGTGTGTGTTCCCCAGCCTGG + Intronic
1191010180 X:55749362-55749384 TGGGGGGGTCAGCCCCCGCCCGG + Intronic
1192537769 X:71942999-71943021 TGTGTGTGTCTTTCCCAGCCTGG + Intergenic
1194765870 X:97845043-97845065 TGGGTGTTTCTTTCGCCGCCTGG - Intergenic
1195013082 X:100752337-100752359 AGGGTGTGATGTTCCCCGCCCGG + Intergenic
1195257499 X:103104467-103104489 TGGGGGGGTCAGCCCCCGCCCGG - Intergenic
1201335823 Y:12878929-12878951 TGGGGGGGTCAGCCCCCGCCCGG + Intergenic