ID: 969608645

View in Genome Browser
Species Human (GRCh38)
Location 4:8215035-8215057
Sequence GTGTGCGCACCTGGTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969608641_969608645 2 Left 969608641 4:8215010-8215032 CCTCACTAGCAAGATAACAACAC 0: 1
1: 0
2: 3
3: 63
4: 715
Right 969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969608645 Original CRISPR GTGTGCGCACCTGGTGCTCA GGG Intronic