ID: 969608645

View in Genome Browser
Species Human (GRCh38)
Location 4:8215035-8215057
Sequence GTGTGCGCACCTGGTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969608641_969608645 2 Left 969608641 4:8215010-8215032 CCTCACTAGCAAGATAACAACAC 0: 1
1: 0
2: 3
3: 63
4: 715
Right 969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG 0: 1
1: 0
2: 2
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969608645 Original CRISPR GTGTGCGCACCTGGTGCTCA GGG Intronic
900645526 1:3707089-3707111 GTGTGCGCACCCTGCACTCAGGG + Intronic
901063224 1:6483310-6483332 GTGGGGGCACCTGGTGCTCAAGG - Intronic
902375767 1:16029307-16029329 CTGTGCACACCTGGGGGTCAGGG - Intronic
916476507 1:165174599-165174621 GTGTGAGCACCTGGAGCAGAGGG + Intergenic
916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG + Intronic
918388709 1:184036865-184036887 GTGTGCGCAGAGGGTGCTGATGG - Intronic
918546276 1:185688142-185688164 CTGTGGGCACTTGGTGGTCAGGG - Intergenic
922771407 1:228185656-228185678 GTGCGTTCACGTGGTGCTCACGG + Intergenic
922773017 1:228198986-228199008 CTGTACCCACATGGTGCTCAAGG + Intergenic
923237138 1:232045353-232045375 GTGTGCATTCCTGGTGCTCCTGG - Intergenic
924067591 1:240241445-240241467 GTGTGTGCACATGGCTCTCAGGG + Intronic
1063463899 10:6231068-6231090 CTGTCCGGACCTGGTGCTCTGGG + Intronic
1067265017 10:44734277-44734299 GAGTGTCCACCTGGTGGTCAGGG - Intergenic
1069566704 10:69468193-69468215 GTGTGTGCACCTGGTGATTAAGG - Intronic
1076378390 10:130008319-130008341 GTGAGCAAAACTGGTGCTCATGG - Intergenic
1076501703 10:130942285-130942307 GTGTGGGCAGCTGTGGCTCAAGG - Intergenic
1077378412 11:2216212-2216234 CTGGGCGCACCGGATGCTCAGGG + Intergenic
1078515602 11:12019480-12019502 GTGTGCTCAGCTGGGGCTCATGG + Intergenic
1091325429 11:134683441-134683463 CTGTGGGCTCCTGGAGCTCAGGG + Intergenic
1091369981 11:135049657-135049679 GTGGGGGGACCCGGTGCTCAGGG + Intergenic
1091401234 12:182041-182063 GTGAGGGGACCTGGTGCACAGGG - Intergenic
1093309102 12:17556536-17556558 ATCTGCCCACCTGGAGCTCATGG + Intergenic
1096953064 12:55495666-55495688 GTGTGCTGGCCTGGTACTCAGGG - Intergenic
1113891903 13:113740374-113740396 GCGTGTGCACCTGCAGCTCAGGG + Intergenic
1114418726 14:22561855-22561877 GTGTGGGCAGGAGGTGCTCAGGG + Intergenic
1118767710 14:68921255-68921277 GTGTGCTCACACGCTGCTCAGGG + Intronic
1122112698 14:99513364-99513386 GGGTGAACACCTGCTGCTCATGG - Exonic
1122857092 14:104565189-104565211 GTCTCCCCACCTGGTGCTCCAGG + Intronic
1124417723 15:29487490-29487512 GTTTTGGCATCTGGTGCTCAAGG + Intronic
1125685364 15:41560239-41560261 AGGTGCGGACCTGATGCTCAGGG + Intronic
1132650760 16:1020584-1020606 CTGTGCGGTCCTGGTGCACAGGG + Intergenic
1135231950 16:20716718-20716740 GTGTGGGCTCCTAGAGCTCAGGG + Intronic
1136990401 16:35148216-35148238 CTGTGCACACCTGGATCTCATGG - Intergenic
1139334378 16:66220922-66220944 GCTTGCTCAGCTGGTGCTCAGGG - Intergenic
1139547892 16:67658196-67658218 GTGTGGGGACCTGGGGGTCAGGG + Exonic
1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG + Intronic
1143508627 17:7383442-7383464 GGGTGGGCTCCTTGTGCTCAGGG - Exonic
1143514153 17:7411117-7411139 CTGGGCGAACCTGGTGCTCCCGG + Intronic
1144092657 17:11871901-11871923 GGTTTCACACCTGGTGCTCAGGG - Intronic
1152311950 17:79556886-79556908 CTGTGTCCAGCTGGTGCTCAGGG + Intergenic
1152391447 17:80006166-80006188 GAGAGCGCTCCTGGTGCTCTGGG - Intronic
1153233916 18:2967571-2967593 GTGTGCCCACCAGATGCTAAGGG + Intronic
1154040965 18:10855493-10855515 GTCTGTGCACCTGGTGGTCCTGG - Exonic
1157771946 18:50356742-50356764 ATCTGCCCACATGGTGCTCACGG + Intergenic
1161967123 19:7554996-7555018 ATATGCGCAGCTGGTGCTCGGGG + Exonic
1163420028 19:17209199-17209221 GTATGCCCACTTGGTGGTCAAGG - Intronic
1163634274 19:18431151-18431173 GTGTGCGCACAGGGTGCTTGGGG + Intronic
1163950787 19:20583305-20583327 CTGTGCCCACCTGGAGTTCATGG + Intronic
1163967304 19:20758756-20758778 CTGTGCCCACCTGGAGTTCATGG - Intronic
1165308038 19:35014060-35014082 GTGTGTGCACCGAGGGCTCACGG - Intronic
1165831093 19:38730820-38730842 ATGGGCGCACCTGCTGCTCAGGG - Exonic
1167037600 19:47003305-47003327 GTGTGCACAGAGGGTGCTCATGG + Exonic
1167774479 19:51545727-51545749 GTGTGTGCCTCTGATGCTCAGGG + Intergenic
1168624243 19:57904315-57904337 GTGTGGGCTCCTAGAGCTCAGGG + Intronic
926304946 2:11631141-11631163 GTGCATGCAGCTGGTGCTCATGG - Intronic
926310282 2:11669952-11669974 GTCCGCGCACGTGGTGCTGAAGG - Exonic
926706301 2:15840142-15840164 CTGCAGGCACCTGGTGCTCAGGG + Intergenic
928377507 2:30787687-30787709 CTCTGCGCACTTGCTGCTCAGGG - Intronic
932415296 2:71569980-71570002 CTGGAGGCACCTGGTGCTCAGGG + Intronic
934551840 2:95267560-95267582 GTGGGAGCACCTGGGGCTCTTGG + Intergenic
935413318 2:102788404-102788426 GTGTGCTCACCTGGTCCCCTGGG + Intronic
935538918 2:104326429-104326451 GTGGGAGCACCTGATGGTCAGGG + Intergenic
935720003 2:105971690-105971712 GTGTGGCCACCTAGGGCTCAGGG - Intergenic
935932133 2:108138814-108138836 GATTGCCCACCTGTTGCTCATGG - Intergenic
936036939 2:109120541-109120563 GAGTGGGCACCTTGTGCTCTAGG + Intergenic
936271418 2:111052294-111052316 GTGTGCTCTCATGGTGCTGAAGG - Intronic
936952289 2:117990096-117990118 GTGTGGGCACCTGTTATTCAAGG + Intronic
937223715 2:120356450-120356472 GTGTGCACACCTGATTCTGAAGG - Intergenic
937337629 2:121071585-121071607 GTGCACCCACCTGGTGCTGATGG - Intergenic
938091576 2:128438030-128438052 GTGTGTGCATCTGGTGCTGGTGG + Intergenic
947612837 2:231534188-231534210 GTGTGCCCACAGGGTGCTCCTGG + Intergenic
947765924 2:232637288-232637310 GGGAGAGCACCAGGTGCTCAGGG - Intronic
948577971 2:238966276-238966298 GAGTGGGGACCTGGTTCTCACGG + Intergenic
948596650 2:239083716-239083738 GTGTGGGCACCTGGTCCTGCTGG - Intronic
1169665317 20:8027858-8027880 GTGTTCTCATCTGGAGCTCAGGG - Intergenic
1172105045 20:32511765-32511787 GTGTCCCCTCCTGGGGCTCAAGG - Intronic
1175404516 20:58717634-58717656 CTGTGCACACCTGGGGCTGAGGG + Intronic
1180590729 22:16935076-16935098 GTGAGGGCAGCTGCTGCTCAGGG + Intergenic
1181174425 22:21027711-21027733 CTGTGGGTACCTGGTGATCAGGG + Exonic
1184233567 22:43171299-43171321 ATCTGAGCACCTGGAGCTCAGGG - Intronic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
950187522 3:10954184-10954206 GTGTGGGTAGCTGGTGCTCAGGG + Intergenic
950674907 3:14548837-14548859 GAGGGAGCACCTGGTTCTCATGG - Intergenic
950775413 3:15345723-15345745 GAGAGAGCAGCTGGTGCTCATGG + Intergenic
954216642 3:49128495-49128517 GTGTGGGCATTTGGTGCCCAAGG - Exonic
968577532 4:1374879-1374901 GGGTGCTCACATGGTCCTCAAGG - Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
971149336 4:24014556-24014578 GTGTTCTCATCTGGAGCTCAGGG + Intergenic
972613115 4:40673442-40673464 GTGTCCTCACCTAGAGCTCAGGG + Intergenic
977714460 4:100166560-100166582 GTGTCCACACCTGGTGTTCGGGG + Intergenic
978044716 4:104112271-104112293 GTGTGGGCACATGGTGCTGTGGG - Intergenic
982526142 4:156481991-156482013 GTGTGCGCACCTGGGGCCGGTGG + Intergenic
982811404 4:159830628-159830650 GTGTGCGCACCTGATGAAAAGGG - Intergenic
985731978 5:1554330-1554352 GTGGGGGCACCTGGGGCCCAGGG + Intergenic
992139331 5:73780204-73780226 GTGTGCCAACCTGCAGCTCAGGG + Intronic
997379971 5:133428610-133428632 GTGTGACCACTTGGTGCTCAGGG - Intronic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1002655094 5:180739704-180739726 GTGTGTGCTCCTGGTGGTGATGG - Exonic
1005670957 6:28105574-28105596 GAGACCACACCTGGTGCTCAGGG - Intergenic
1005890926 6:30137107-30137129 ATGTCCGCAGTTGGTGCTCACGG - Exonic
1008280663 6:49592116-49592138 GTGTCCACACCTGGTGATGAGGG + Intergenic
1019135993 6:169908001-169908023 GAGACCCCACCTGGTGCTCAGGG + Intergenic
1026863312 7:73807901-73807923 GTGGGGGCAGCTGGTGCTCGTGG + Intronic
1033052153 7:138015296-138015318 CTGTGAGCACCAGCTGCTCATGG + Intronic
1034401503 7:150864534-150864556 GTGAGTGTACGTGGTGCTCAGGG - Intergenic
1035255911 7:157627197-157627219 GCGTGAGCTCCTGGTGGTCAGGG + Intronic
1036616764 8:10393819-10393841 GTGTGCACACGTGGTGCACAGGG - Intronic
1036659327 8:10697846-10697868 GTGTGGCCACCTGCTGCTCGTGG - Exonic
1039429980 8:37518659-37518681 GTGTGCGCGCTTCGTTCTCAGGG + Intergenic
1040818131 8:51530128-51530150 GTGTGTGCATCTGGAGTTCATGG + Intronic
1042078375 8:65021130-65021152 CTGAGTGCACCTGGTGTTCAAGG - Intergenic
1049616189 8:143576746-143576768 GTGTGCCCACCTGGGGCTGGGGG - Exonic
1049834001 8:144721346-144721368 GTGAGCCCAGCTGGTGCTCTGGG - Exonic
1052817114 9:33110265-33110287 CTGTGAGCACCTGGTGCAAATGG + Intronic
1055290639 9:74778823-74778845 GGGTGAACACCTGCTGCTCATGG - Intronic
1056554574 9:87677889-87677911 ATGGGCGCACCTGGTGCACGTGG + Intronic
1060934937 9:127509249-127509271 GGATGGCCACCTGGTGCTCATGG + Intronic
1062290421 9:135791915-135791937 CAGTGCCCACCTGGTGCTCAGGG - Intronic
1189061943 X:37763703-37763725 TTGTGGGCACCTGGTTCTGAAGG - Intronic
1199746010 X:150772318-150772340 CTGACCTCACCTGGTGCTCATGG - Intronic