ID: 969608983

View in Genome Browser
Species Human (GRCh38)
Location 4:8216654-8216676
Sequence GTCCATGGAGAAGGGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969608974_969608983 4 Left 969608974 4:8216627-8216649 CCAGCAGTGGCTGGGGTCACTGG 0: 1
1: 0
2: 2
3: 40
4: 381
Right 969608983 4:8216654-8216676 GTCCATGGAGAAGGGCCCTGGGG No data
969608973_969608983 8 Left 969608973 4:8216623-8216645 CCTGCCAGCAGTGGCTGGGGTCA 0: 1
1: 0
2: 3
3: 26
4: 295
Right 969608983 4:8216654-8216676 GTCCATGGAGAAGGGCCCTGGGG No data
969608966_969608983 29 Left 969608966 4:8216602-8216624 CCCGACCACAGCAGGAGGGGGCC 0: 1
1: 0
2: 1
3: 39
4: 264
Right 969608983 4:8216654-8216676 GTCCATGGAGAAGGGCCCTGGGG No data
969608967_969608983 28 Left 969608967 4:8216603-8216625 CCGACCACAGCAGGAGGGGGCCT 0: 1
1: 1
2: 4
3: 59
4: 3612
Right 969608983 4:8216654-8216676 GTCCATGGAGAAGGGCCCTGGGG No data
969608968_969608983 24 Left 969608968 4:8216607-8216629 CCACAGCAGGAGGGGGCCTGCCA 0: 1
1: 0
2: 4
3: 29
4: 460
Right 969608983 4:8216654-8216676 GTCCATGGAGAAGGGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969608983 Original CRISPR GTCCATGGAGAAGGGCCCTG GGG Intronic
No off target data available for this crispr