ID: 969609343

View in Genome Browser
Species Human (GRCh38)
Location 4:8218286-8218308
Sequence CATCGTCGATGGGGTCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969609343_969609358 17 Left 969609343 4:8218286-8218308 CCCCCAGGACCCCATCGACGATG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 969609358 4:8218326-8218348 ATGCCCGGCAACCCGCTGATGGG 0: 1
1: 0
2: 0
3: 2
4: 22
969609343_969609357 16 Left 969609343 4:8218286-8218308 CCCCCAGGACCCCATCGACGATG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 969609357 4:8218325-8218347 GATGCCCGGCAACCCGCTGATGG 0: 1
1: 0
2: 0
3: 3
4: 36
969609343_969609354 2 Left 969609343 4:8218286-8218308 CCCCCAGGACCCCATCGACGATG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 969609354 4:8218311-8218333 ATGGGTGGCCCTGTGATGCCCGG 0: 1
1: 0
2: 0
3: 19
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969609343 Original CRISPR CATCGTCGATGGGGTCCTGG GGG (reversed) Exonic
904266694 1:29322425-29322447 TATCGGCGATGGCTTCCTGGAGG + Intronic
905091560 1:35434717-35434739 CTTCGTTGAGGGGTTCCTGGAGG + Exonic
906995785 1:50792662-50792684 CATCATCCATGAGGTCCTGGAGG + Intronic
915607076 1:156959166-156959188 CAGAGTGGATGGGGTACTGGGGG + Intronic
919845619 1:201640341-201640363 CTTCCTGGATGAGGTCCTGGAGG + Intronic
1070772459 10:79090324-79090346 CATCCCCCATGGGGACCTGGAGG + Intronic
1074581218 10:114721346-114721368 CATGCTCAATGGGGTCCTGCTGG - Intergenic
1075875579 10:125803354-125803376 CAGCTTCCACGGGGTCCTGGAGG - Intronic
1084537349 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG + Intergenic
1093243115 12:16701995-16702017 CAAAGTCCATGGGTTCCTGGAGG + Intergenic
1104994341 12:132644717-132644739 CTTCGTGAATGGGGTCCTGGAGG + Intronic
1104994440 12:132644989-132645011 CTTCGTGAATGGGGTCCTGGGGG + Intronic
1105402125 13:20105170-20105192 CACCGTGGCTGGGGTCCAGGTGG + Intergenic
1108574272 13:51778086-51778108 CATCGTGGGAAGGGTCCTGGAGG + Intronic
1118753403 14:68822203-68822225 CATCCTGGATGGGGTGCAGGTGG - Intergenic
1119766239 14:77189959-77189981 CATAGTAAATAGGGTCCTGGGGG + Intronic
1121853075 14:97240539-97240561 GATCAGCGATGGGGACCTGGAGG - Intergenic
1136297999 16:29314570-29314592 CAACCTCGATGGGGGTCTGGAGG + Intergenic
1139518074 16:67463747-67463769 CAGGGTGGGTGGGGTCCTGGGGG - Intronic
1142059640 16:88021075-88021097 CAACCTCGATGGGGGTCTGGAGG + Intronic
1148858180 17:50590593-50590615 CATCTTCGATGGTGTCATTGTGG + Exonic
1154274602 18:12948151-12948173 CATCGTGGATGAGATCCTTGTGG - Exonic
1168318520 19:55494679-55494701 CATGGTGGACGGGGGCCTGGAGG - Exonic
946620762 2:221560180-221560202 CATCTTCCTTGGGGTCCGGGAGG - Intronic
1172991266 20:39038714-39038736 CATCCTTGCTGGGATCCTGGAGG + Exonic
1180918672 22:19506972-19506994 CTTCGTGGATGGGGTCCCAGTGG + Intronic
1183351471 22:37337038-37337060 CATCGGGGATGGTGGCCTGGAGG - Intergenic
953211095 3:40875890-40875912 CAGCTTCTATGGGCTCCTGGAGG + Intergenic
954212150 3:49103925-49103947 CAGTGTCGATGGGGTCCAAGGGG + Exonic
954583409 3:51715750-51715772 CATCTTCGGTGGGGCCCGGGAGG + Exonic
954615414 3:51966810-51966832 CTTCTTGGCTGGGGTCCTGGGGG - Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968935043 4:3605425-3605447 CATCGGAGCTGGGGTCCTGCCGG - Intergenic
969609343 4:8218286-8218308 CATCGTCGATGGGGTCCTGGGGG - Exonic
970401101 4:15718720-15718742 CATCGTCTCTTGGGTCCTGCAGG + Intronic
995182182 5:109239471-109239493 CATCGTCAATGGTTTCCTGAGGG - Intergenic
999685883 5:154102785-154102807 CAGCGTGTATGGGGTCCTGAAGG - Intronic
1006401301 6:33819220-33819242 CATGGTAGATGGGCTCCAGGAGG + Intergenic
1009933719 6:70207191-70207213 CATCTTCCACTGGGTCCTGGGGG - Exonic
1016349862 6:143155469-143155491 CAACATTGATGGGGACCTGGAGG + Intronic
1019512867 7:1426742-1426764 CTGGGTTGATGGGGTCCTGGGGG + Intergenic
1025209344 7:57011900-57011922 CATCCTCCCTGGGGTCCAGGTGG - Intergenic
1025662601 7:63564954-63564976 CATCCTCCCTGGGGTCCAGGTGG + Intergenic
1027440327 7:78212478-78212500 CACCGGCTATGGGGTGCTGGAGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1062576966 9:137213432-137213454 CATCTTGGCTGGGGGCCTGGAGG + Intronic
1190303257 X:49068248-49068270 ATTAGTCCATGGGGTCCTGGTGG + Intronic
1192719629 X:73678487-73678509 GATAGTCCCTGGGGTCCTGGGGG + Intronic
1195567830 X:106363323-106363345 CATTGTAGATGGAGTCTTGGTGG - Intergenic
1196009378 X:110870860-110870882 CATCCTCAATGGGATCCAGGAGG + Intergenic
1198282687 X:135157374-135157396 TATCGTCAATGTGGTCATGGTGG - Exonic
1198284962 X:135180317-135180339 TATCGTCAATGTGGTCATGGTGG - Intergenic
1198288272 X:135215148-135215170 TATCGTCAATGTGGTCATGGTGG + Intergenic