ID: 969611992

View in Genome Browser
Species Human (GRCh38)
Location 4:8232592-8232614
Sequence AAACCCTGCCCCAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 419}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969611992_969611996 1 Left 969611992 4:8232592-8232614 CCTGCTTCCCTGGGGCAGGGTTT 0: 1
1: 0
2: 2
3: 36
4: 419
Right 969611996 4:8232616-8232638 AAGGTCTCACATCCCACATGTGG 0: 1
1: 0
2: 0
3: 25
4: 202
969611992_969612000 19 Left 969611992 4:8232592-8232614 CCTGCTTCCCTGGGGCAGGGTTT 0: 1
1: 0
2: 2
3: 36
4: 419
Right 969612000 4:8232634-8232656 TGTGGCCCACTTGGCTCTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 201
969611992_969611997 10 Left 969611992 4:8232592-8232614 CCTGCTTCCCTGGGGCAGGGTTT 0: 1
1: 0
2: 2
3: 36
4: 419
Right 969611997 4:8232625-8232647 CATCCCACATGTGGCCCACTTGG 0: 1
1: 0
2: 1
3: 10
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969611992 Original CRISPR AAACCCTGCCCCAGGGAAGC AGG (reversed) Intronic
900009320 1:91453-91475 AAACCCGAGCCCAGGGATGCGGG + Intergenic
900029039 1:357414-357436 AAACCCGAGCCCAGGGATGCGGG + Intergenic
900409054 1:2504661-2504683 AAAGGCAGCCCCAGGGAGGCCGG - Exonic
901040538 1:6360441-6360463 AGACCCTGGCCCTGGGATGCCGG - Intronic
901655591 1:10767488-10767510 AAAGCCAGGCCCAGGGAGGCCGG + Intronic
902492077 1:16790166-16790188 AAGGCCTGCCTCTGGGAAGCAGG + Intronic
903165839 1:21519870-21519892 AAACCCTGCACCAAGGAATTAGG + Intronic
903243549 1:21999768-21999790 AGACCCTACGCCAGGGAAGAAGG - Intergenic
903266441 1:22160813-22160835 AGACACTGCCCCAGGGACCCTGG + Intergenic
905036038 1:34918851-34918873 CCACCCTGCCCCAGGGGATCTGG + Intronic
905352037 1:37354214-37354236 AAAAGCAGCCCCAGGGAAGATGG + Intergenic
905888733 1:41506340-41506362 AAACCATGAGCCAGGCAAGCAGG + Intergenic
906142283 1:43540817-43540839 GACCCCTGACCCAGGGAAGGAGG - Intronic
907491310 1:54810580-54810602 GAACCCGGCCCTGGGGAAGCAGG - Intronic
908774229 1:67624985-67625007 AACCCCAGCTGCAGGGAAGCTGG + Intergenic
908852185 1:68387206-68387228 TGACCCTGCCCCAGGAAAGCGGG - Intergenic
908951509 1:69568002-69568024 ACACCCAGCCCCAGTGCAGCGGG + Intergenic
909222859 1:72984558-72984580 TTGCCCTGCCCCAGGAAAGCGGG + Intergenic
909223895 1:72992670-72992692 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
909927261 1:81452520-81452542 AAACCCATCCCCAAGCAAGCAGG + Intronic
910094011 1:83499315-83499337 AAACCCTGCCCCAAGGACAGAGG + Intergenic
910123372 1:83814611-83814633 CAACCCTGCCACAGGGATGATGG - Intergenic
910328084 1:86033919-86033941 AAACCCTGTCACAGGGAAAGAGG + Exonic
910909417 1:92217933-92217955 GAACCCTGCCCCAGGCACCCTGG + Exonic
911883019 1:103265693-103265715 AAACCCACCCCCAGGGGAGTGGG + Intergenic
913088634 1:115460926-115460948 AAGCCTTGCCCCCAGGAAGCTGG - Intergenic
915034323 1:152909663-152909685 GTACCCTGCCCAAGGGAAGAGGG + Intronic
915047570 1:153031142-153031164 AAGCCCTGCCTCAAGGAAACAGG - Intergenic
915073689 1:153292477-153292499 ACACCCTGCCCCAGGGCTGCGGG - Intergenic
915919592 1:159964418-159964440 AAGGACTGCCGCAGGGAAGCAGG + Intergenic
915977282 1:160399862-160399884 GAACCCTGCCTTAGGGAAGAAGG - Intergenic
916118825 1:161510648-161510670 AAACCCTGTGCCAGTGAGGCTGG + Intronic
918073342 1:181150114-181150136 AAACCACTCCCCAGGGAACCAGG - Intergenic
918216046 1:182392281-182392303 AACCCCTGCCCGCAGGAAGCGGG - Intergenic
920311061 1:205048525-205048547 CACCCCTGCACCAGGGCAGCTGG + Intronic
920743219 1:208600783-208600805 AGACCCAGCCACAGGGAAGCTGG - Intergenic
920829172 1:209449833-209449855 TGCCCCTGCCCCAGGAAAGCAGG - Intergenic
920829189 1:209449897-209449919 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
921212207 1:212910474-212910496 TTGCCCTGCCCCAGGAAAGCGGG - Intergenic
921519919 1:216146511-216146533 TGCCCCTGCCCCAGGAAAGCGGG - Intronic
921733203 1:218598600-218598622 TCCCCCTGCCCCAGGAAAGCTGG + Intergenic
922342969 1:224672240-224672262 ATACACCTCCCCAGGGAAGCAGG - Intronic
922606880 1:226894988-226895010 GCAACCTGCCCCTGGGAAGCAGG - Intronic
922722446 1:227905823-227905845 GGGCCCTTCCCCAGGGAAGCGGG - Intergenic
923467169 1:234259476-234259498 CAACCCTGCCCCAGAGGAACTGG - Intronic
923528369 1:234792371-234792393 AAGGCCTGCCTCTGGGAAGCAGG - Intergenic
923933210 1:238727048-238727070 ACTCCCTGCCTCACGGAAGCAGG - Intergenic
1064235969 10:13575539-13575561 AAACCTTTCCCCATGGAATCTGG + Intergenic
1065326813 10:24556812-24556834 CATCCCTGCCCCACGGAATCTGG + Intergenic
1065443411 10:25773953-25773975 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1066575548 10:36820352-36820374 AGATCCTGCACCAGGGCAGCAGG - Intergenic
1067686169 10:48466960-48466982 TAACCCTTCGCCTGGGAAGCAGG + Intronic
1068592554 10:58865768-58865790 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1069593582 10:69656421-69656443 CACCACTGCCCCAGGGAAGAGGG - Intergenic
1069794575 10:71043890-71043912 CCACCCTGCCCCAGGGGAGAAGG - Intergenic
1070288055 10:75098052-75098074 GAACCCTTCCCCAGGGAACAAGG + Intronic
1070474648 10:76819296-76819318 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1070474687 10:76819424-76819446 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1070474706 10:76819488-76819510 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1070474725 10:76819552-76819574 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1070616238 10:77971465-77971487 AAACCCAGCTCCAGAGAGGCTGG - Intronic
1070810075 10:79293216-79293238 CAACCAGGCCCCAGGGGAGCAGG - Intronic
1073105474 10:101030206-101030228 AAACCCTGCGCCATGGCGGCTGG + Exonic
1073201860 10:101741672-101741694 AATGTCTGCCCGAGGGAAGCTGG + Intergenic
1074771507 10:116737870-116737892 GAAACCTGCCCCACTGAAGCGGG - Intronic
1075248497 10:120845855-120845877 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1075516030 10:123109014-123109036 GAGAGCTGCCCCAGGGAAGCTGG - Intergenic
1075736619 10:124668338-124668360 ATACCCTGCGGCAGGGGAGCCGG - Intronic
1076773111 10:132677860-132677882 AAAGCGTGCCCCGTGGAAGCCGG - Intronic
1077537355 11:3130779-3130801 CCAACCTGCCGCAGGGAAGCAGG + Intronic
1077542158 11:3151831-3151853 AAAGCCCGCCCCAGGGAGGCAGG - Intronic
1077980988 11:7300740-7300762 AAACCCTGTCCCAGGTAATCAGG - Intronic
1078447655 11:11416732-11416754 CAACCATCCCCCAGGGTAGCAGG + Intronic
1078599620 11:12718501-12718523 AACCCTTGCCCCACAGAAGCTGG - Intronic
1079447261 11:20568773-20568795 TGCCCCTGCCCCAGGAAAGCAGG - Intergenic
1080115344 11:28615671-28615693 CAACTCTGCCCAAGGGAAGCTGG - Intergenic
1080752130 11:35160306-35160328 AGAACCTGCCCCATCGAAGCTGG - Intronic
1081356606 11:42121557-42121579 TTCCCCTGCCCCAGGAAAGCGGG - Intergenic
1081591294 11:44425078-44425100 AAACCCTGCCCCAGGCCATCCGG + Intergenic
1081669398 11:44934757-44934779 CAGTCCTGCCCCAGGGAGGCAGG - Exonic
1081779227 11:45698596-45698618 GAACCCTGCCACTGGGAAGCAGG + Intergenic
1083853223 11:65379660-65379682 AAGTCCTGCCACAGGGAAGTGGG + Intronic
1084426801 11:69088539-69088561 CAACCCTACTCCAGAGAAGCAGG - Intronic
1084479539 11:69410733-69410755 GAAGCCTCCCCCAGTGAAGCAGG + Intergenic
1085361032 11:75887430-75887452 AAAACCTGCGCCAGGCACGCTGG - Intronic
1087396758 11:97609983-97610005 AACCCCTACCCCATGGAAGCAGG - Intergenic
1089278288 11:117354570-117354592 AAACCTTGCTCCATGGAACCTGG - Intronic
1090850800 11:130569049-130569071 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1090872154 11:130758193-130758215 TGCCCCTGCCCCAGGAAAGCAGG + Intergenic
1090872171 11:130758254-130758276 TGCCCCTGCCCCAGGAAAGCAGG + Intergenic
1091461516 12:646848-646870 CAACCCTTGTCCAGGGAAGCAGG - Intronic
1091905823 12:4188395-4188417 AACCCCTGCCCCACGGTAGCTGG - Intergenic
1094509866 12:31089778-31089800 AGACCCTACCCCATGGAAGTGGG + Intronic
1096627958 12:52906771-52906793 TAGCCCTGACCCAGGGAAGGGGG + Intronic
1097417258 12:59327958-59327980 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1098167764 12:67715651-67715673 ATACCTAGCCACAGGGAAGCTGG - Intergenic
1098401983 12:70086188-70086210 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1098402002 12:70086252-70086274 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1098402021 12:70086316-70086338 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1098402039 12:70086380-70086402 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1100725692 12:97406128-97406150 AACCAATCCCCCAGGGAAGCAGG - Intergenic
1102111770 12:110370710-110370732 CCTCCCTGCCCCAGGGCAGCAGG - Intergenic
1102689261 12:114747626-114747648 AAAACATGTCCCAGGAAAGCCGG - Intergenic
1103782504 12:123408396-123408418 AAACCCTGCCCCAGCAGGGCAGG - Exonic
1103909748 12:124345722-124345744 AAACCCTTCCCCTGGCAATCAGG + Intronic
1104063084 12:125284439-125284461 AACCCCTGCTCCACGGCAGCGGG - Intronic
1104575506 12:129962766-129962788 TACGCCTGCCCCAAGGAAGCCGG - Intergenic
1104740965 12:131173389-131173411 AACCCATGCCCCTGGGAAGATGG + Intergenic
1105217782 13:18299425-18299447 AAACCCTGCCCCAGCAGGGCAGG - Intergenic
1106943239 13:34799649-34799671 TGCCCCTGCCCCAGGAAAGCAGG - Intergenic
1107651944 13:42553623-42553645 AAACTGTGCCCCATGGAACCTGG - Intergenic
1107683368 13:42872223-42872245 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1108512765 13:51170776-51170798 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1108883167 13:55146371-55146393 AAACCCTGCTTCAGGGAGGAAGG + Intergenic
1111459081 13:88517685-88517707 TGCCCCTGCCCCAGGAAAGCAGG + Intergenic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1113705012 13:112424563-112424585 TAACCCTGTGCCATGGAAGCAGG - Intronic
1113936182 13:113996265-113996287 AGGCCCTGCCCCGGGGGAGCGGG - Intronic
1114075415 14:19158898-19158920 AAACCCTGCCGCGGAGAAGCGGG + Intergenic
1114075470 14:19159118-19159140 AAACCGCGCCACAGAGAAGCAGG + Intergenic
1114086798 14:19240861-19240883 AAACCGCGCCACAGAGAAGCAGG - Intergenic
1114086854 14:19241082-19241104 AAACCCTGCCGCGGAGAAGCGGG - Intergenic
1114483545 14:23049447-23049469 AAACCTTCCCCATGGGAAGCTGG - Intronic
1115240796 14:31250011-31250033 TGCCCCTGCCCCAGGAAAGCAGG + Intergenic
1115240813 14:31250067-31250089 TGCCCCTGCCCCAGGAAAGCAGG + Intergenic
1115240833 14:31250131-31250153 TGCCCCTGCCCCAGGAAAGCAGG + Intergenic
1115392232 14:32866445-32866467 CAACCCTGCCACAGGGAACCTGG - Intergenic
1115862699 14:37706333-37706355 GAAGCCATCCCCAGGGAAGCAGG - Intronic
1116613305 14:47105141-47105163 TGCCCCTGCCCCAGGAAAGCGGG - Intronic
1116952717 14:50894196-50894218 TGCCCCTGCCCCAGGAAAGCGGG - Intronic
1117057112 14:51923828-51923850 CACCCCTACCCCAGGGAATCTGG - Intronic
1117954325 14:61111101-61111123 CAACCTTCCCCCAGTGAAGCAGG + Intergenic
1120450933 14:84665994-84666016 ACACCTTTCTCCAGGGAAGCAGG + Intergenic
1122040779 14:98986145-98986167 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1122047229 14:99032900-99032922 TCACCCGGCTCCAGGGAAGCTGG + Intergenic
1123055201 14:105566203-105566225 GGACCTTGCCCCAGGGGAGCTGG - Intergenic
1123079650 14:105686047-105686069 GGACCTTGCCCCAGGGGAGCTGG - Intergenic
1123158692 14:106256293-106256315 AAACCCTGTCCCATGGAAAAGGG + Intergenic
1202898328 14_GL000194v1_random:22456-22478 AAACCGCGCCACAGAGAAGCAGG - Intergenic
1202898383 14_GL000194v1_random:22676-22698 AAACTGTGCCGCAGAGAAGCGGG - Intergenic
1125045539 15:35239647-35239669 TGCCCCTGCCCCAGGAAAGCGGG - Intronic
1125045558 15:35239711-35239733 TGCCCCTGCCCCAGGAAAGCAGG - Intronic
1126469303 15:48990731-48990753 AAGCCCTGCCCCAGATAATCAGG + Exonic
1126997611 15:54462680-54462702 AAGCCCTGCCCCTGGGGAGGTGG - Intronic
1128090775 15:64917300-64917322 ACACCCTCCCCCAGGACAGCTGG - Intronic
1128571332 15:68735393-68735415 ACAAGCTGCCCCATGGAAGCAGG + Intergenic
1129182549 15:73886361-73886383 AAACCATCTCCCAGGGCAGCTGG + Intronic
1129267687 15:74402823-74402845 ACACCCTCCCCCAAGGAAACAGG - Intergenic
1131183256 15:90254834-90254856 AGACCCTGTCTCAGGGAAGGGGG + Intronic
1131882741 15:96876681-96876703 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1131882760 15:96876745-96876767 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1132381243 15:101368265-101368287 AAACAGGGCCCCAGGGGAGCGGG + Intronic
1132883818 16:2173695-2173717 CACCCCTGGCCCAGGGCAGCAGG + Intronic
1133048093 16:3100253-3100275 AACCCCGCCCCCAGGGAAGTGGG + Intergenic
1133566297 16:6997783-6997805 AAACCCTACCTCAGAGAAACAGG - Intronic
1133975308 16:10596167-10596189 AGTCCCAGCCCCAGGGAACCAGG - Intergenic
1134256729 16:12618595-12618617 AAGATCTGCCCCAGGGAAGGGGG + Intergenic
1134832130 16:17332143-17332165 ACAGTCAGCCCCAGGGAAGCAGG - Intronic
1136021906 16:27445858-27445880 AAACCAAGCCCCAGGGAAGGAGG + Intronic
1136229508 16:28878279-28878301 AGCCCCAGCCCCAGGGAAGTGGG - Intergenic
1136682499 16:31976345-31976367 AAGCCCTGCCCCAGAGCAGCTGG - Intergenic
1136782759 16:32917513-32917535 AAGCCCTGCCCCAGAGCAGCTGG - Intergenic
1136887038 16:33936337-33936359 AAGCCCTGCCCCAGAGCAGCTGG + Intergenic
1137441850 16:48504759-48504781 AACCCCTGCCCTGCGGAAGCTGG + Intergenic
1137918792 16:52464095-52464117 AGACCCTGCCCTAGGCATGCCGG - Exonic
1139226120 16:65234562-65234584 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1139752716 16:69119329-69119351 AATCCCTTTCCCAGGGGAGCAGG - Exonic
1139943236 16:70621143-70621165 TGCCCCTGCCCCAGGAAAGCAGG + Intronic
1141796490 16:86278742-86278764 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1141796510 16:86278806-86278828 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1141796530 16:86278870-86278892 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1141796550 16:86278934-86278956 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1141796570 16:86278998-86279020 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1141796587 16:86279062-86279084 AAGTCCTGCCCCAGGAAAGCGGG - Intergenic
1141865417 16:86746723-86746745 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1142055710 16:87994500-87994522 AACCACTGCACCAGAGAAGCGGG - Intronic
1142205298 16:88780022-88780044 AAACCCAGACCCAGAGAAGGGGG + Intronic
1203085410 16_KI270728v1_random:1181497-1181519 AAGCCCTGCCCCAGAGCAGCTGG - Intergenic
1143516628 17:7422468-7422490 AGACCCTGCCTCAGGGGAGGGGG - Intergenic
1144305610 17:13966897-13966919 AAACCCTGCTTCATGGAAGAAGG - Intergenic
1145964541 17:28907383-28907405 TAGCCCTGCTCCTGGGAAGCAGG + Intronic
1146086798 17:29837870-29837892 AAGCCCTGCCCCTTGCAAGCTGG + Intronic
1146100687 17:29978935-29978957 CCCCCCTGCCCCAGGGAAGCTGG - Intronic
1146814929 17:35935054-35935076 AAACGTTGATCCAGGGAAGCAGG - Intronic
1147119378 17:38326934-38326956 AAAGTCAGCCCCAAGGAAGCAGG - Exonic
1147143023 17:38469683-38469705 GAGCCCTGCCCCAGAGCAGCTGG - Intronic
1147447811 17:40485484-40485506 AAAACATGCCCCTGGGAGGCGGG + Intronic
1148243319 17:46014011-46014033 CAACCCTGCCCCAGGGGAGCTGG - Intronic
1148676853 17:49450818-49450840 AAACCCACCCCCAGGAAGGCAGG + Intronic
1149595260 17:57861526-57861548 AAACCCTGCCCCAGGCCGGGAGG + Exonic
1152235607 17:79136742-79136764 AATGCCTGCCCCAGGGCAGGCGG + Intronic
1152378701 17:79931180-79931202 ACCCCCTGCCCCACGGGAGCTGG - Intergenic
1152564087 17:81092449-81092471 AGGCCCTGCCCCAGAGAGGCAGG + Intronic
1152950719 17:83229142-83229164 AAACCCGAGCCCAGGGATGCGGG - Intergenic
1153144933 18:2020354-2020376 AGCTCCTGCCCAAGGGAAGCAGG + Intergenic
1154215104 18:12410009-12410031 CACCCCTGCCCCAGGCAACCAGG + Intronic
1155444686 18:25898979-25899001 AAACCCTGACCCACAGAACCAGG - Intergenic
1157431080 18:47627175-47627197 AAGGCCTGGCCCAGGGTAGCAGG + Intergenic
1158560230 18:58507297-58507319 CATCCCTACCCCAGGGCAGCTGG - Intronic
1158566291 18:58556822-58556844 CATCCCTGCCCCAGGGGAGACGG + Intronic
1159022168 18:63152295-63152317 AACACCAGCCCCAAGGAAGCAGG - Intronic
1161661511 19:5549475-5549497 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1162833620 19:13302319-13302341 AATCCCTGCTCCACGGAGGCAGG + Intronic
1162956640 19:14102500-14102522 AAACTCTGCCCCAGGCAGCCGGG - Intronic
1163025586 19:14509524-14509546 AAAACCTGCCCCAGGCCAGGCGG - Intergenic
1163906834 19:20155549-20155571 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1164143295 19:22493500-22493522 AACCCCCGCCCCATGGAAGGAGG + Intronic
1164152762 19:22569212-22569234 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1164747658 19:30628001-30628023 AAGCCCTCCCCACGGGAAGCAGG - Intronic
1164845466 19:31428904-31428926 AAGCCCTGCCCTGGGGAAGAAGG - Intergenic
1165144489 19:33722618-33722640 ATGCCCAGCCCCAGGGAAGAGGG - Intronic
1167454209 19:49590147-49590169 AAGCCCCGCCCCAGGTAAGAAGG - Intronic
1167524623 19:49975979-49976001 AAACCCTGCTCAGGAGAAGCAGG - Intergenic
1167527177 19:49991779-49991801 AAACCCTGTCATTGGGAAGCCGG - Intronic
1202648400 1_KI270706v1_random:160356-160378 AAAACCTGCCGCGGAGAAGCGGG + Intergenic
925107655 2:1306661-1306683 ACACCCTGGCCGAGGGAGGCTGG - Intronic
925565508 2:5249784-5249806 AAATCTTGCCCCAGGAAGGCAGG + Intergenic
927232385 2:20836610-20836632 TTACCCTGCCCCAGGGAAAATGG + Intergenic
927428751 2:23008847-23008869 AAAGCCTGCCCCGGGGCAGAGGG - Intergenic
927988585 2:27430745-27430767 ATACCCTGGGCCAGGCAAGCTGG - Intronic
928135128 2:28682274-28682296 AGACCCTGCCCCAGAGTAGGTGG - Intergenic
929538872 2:42804264-42804286 AAACCATGACCCAGGCATGCTGG - Intergenic
929816655 2:45237948-45237970 AATCCCTGCCCCAGGCTAGGAGG - Intergenic
929992246 2:46800398-46800420 AGACCTTGCCCTTGGGAAGCCGG + Intergenic
930940099 2:57001878-57001900 AAACCTTTCCACAGGGCAGCAGG + Intergenic
930954885 2:57193955-57193977 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
930954904 2:57194019-57194041 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
931236649 2:60418294-60418316 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
931236666 2:60418356-60418378 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
931236684 2:60418420-60418442 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
931236718 2:60418548-60418570 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
931625526 2:64253350-64253372 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
931625543 2:64253411-64253433 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
931625561 2:64253475-64253497 TGGCCCTGCCCCAGGAAAGCAGG - Intergenic
932128604 2:69167624-69167646 AAAGCTTGCCCCTGGGGAGCAGG - Intronic
932359032 2:71089824-71089846 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
932359051 2:71089888-71089910 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
933079065 2:77966093-77966115 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
934296527 2:91747224-91747246 AAACCCTGCCCCAGCAGGGCAGG + Intergenic
934885969 2:98025296-98025318 CCACCCCACCCCAGGGAAGCTGG + Intergenic
934996606 2:98967431-98967453 CAGCCCTGCACCAGGGAGGCTGG - Intergenic
940792464 2:158043236-158043258 AAGCCCAGCCTCAGGGGAGCTGG + Intronic
941353182 2:164460102-164460124 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
941456403 2:165715235-165715257 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
942547109 2:177076563-177076585 CAGCCCTGCCCCAGAGCAGCTGG - Intergenic
944088905 2:195882843-195882865 AAGCTCGGGCCCAGGGAAGCGGG - Intronic
946346987 2:219118729-219118751 TAAACCCGCCCCAGGGAAGGGGG + Intronic
947140905 2:227018588-227018610 AAAAGGAGCCCCAGGGAAGCTGG + Intronic
948217735 2:236244341-236244363 AGACCCTCGCCCAGGGAGGCGGG + Intronic
948467645 2:238159861-238159883 CAGGGCTGCCCCAGGGAAGCCGG + Intronic
948511143 2:238466135-238466157 AAACCCCTTCCCAGGGATGCTGG - Intergenic
948516600 2:238507979-238508001 GGACCCTGCTCCAGGGAAGGTGG + Intergenic
949086473 2:242160112-242160134 AAACCCGAGCCCAGGGATGCGGG - Intergenic
1168876266 20:1174299-1174321 AAAGCTGGCCCCAGGGGAGCAGG - Intronic
1171199049 20:23226426-23226448 AAGTCCTGCCCCTGGGAATCTGG + Intergenic
1172458964 20:35100857-35100879 AAACCCTGCCTTGGGGAAGAGGG - Intergenic
1172478227 20:35254671-35254693 AATCCCTGGGCCAGGGAAGTAGG - Exonic
1173275005 20:41572710-41572732 TAACTCTGGCCCAGGCAAGCAGG + Intronic
1173823940 20:46035462-46035484 CCAACCTGCCCCAGGGAAGTAGG + Exonic
1173837981 20:46138299-46138321 ATCCCCTGCCCCAGTGAAGGTGG + Intergenic
1175878626 20:62243609-62243631 AAACCCAGGCTCAGTGAAGCTGG - Intronic
1176112295 20:63416146-63416168 AAGTCCTGCCCCAGGGCAGGGGG + Intronic
1176231034 20:64033011-64033033 CAACCCTGCCCCACGGAGACCGG - Exonic
1176299977 21:5094911-5094933 AAACCCTTCCCCAGGGCTTCAGG - Intergenic
1176603452 21:8812334-8812356 AAAACCTGCCACGGAGAAGCGGG - Intergenic
1176618068 21:9038669-9038691 AAACTGTGCCGCAGAGAAGCAGG - Intergenic
1176707081 21:10125024-10125046 AAACCGCGCCGCAGTGAAGCTGG + Intergenic
1176707187 21:10125438-10125460 AAACCGCGCCACAGAGAAGCAGG + Intergenic
1179857045 21:44167000-44167022 AAACCCTTCCCCAGGGCTTCAGG + Intergenic
1179888907 21:44326101-44326123 AGGCCCTGCCCCAGGGAGCCAGG - Intronic
1180034367 21:45236174-45236196 AAGCCCTTGCCCAGGCAAGCAGG + Intergenic
1180291010 22:10851650-10851672 AAACCCTGCCGCGGAGAAGCGGG + Intergenic
1180291065 22:10851873-10851895 AAACCGCGCCACAGAGAAGCAGG + Intergenic
1180345735 22:11703892-11703914 AAAACCTGCCACGGAGAAGCGGG - Intergenic
1180353451 22:11821915-11821937 AAACCGCGCCACAGAGAAGCAGG - Intergenic
1180353501 22:11822136-11822158 AAACCCAGCCACGGAGAAGCGGG - Intergenic
1180384740 22:12170221-12170243 AAACCCAGCCACGGAGAAGCGGG + Intergenic
1180384790 22:12170442-12170464 AAACCGCGCCACAGAGAAGCAGG + Intergenic
1180493812 22:15881075-15881097 AAACCCTGCCGCGGAGAAGCGGG + Intergenic
1180493868 22:15881295-15881317 AAACCGCGCCACAGAGAAGCAGG + Intergenic
1180560680 22:16612235-16612257 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1180560717 22:16612363-16612385 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1180592754 22:16955224-16955246 ATGCCCTGTCCCGGGGAAGCAGG + Intergenic
1182030815 22:27157878-27157900 AAACCCAGCCACATGGAAGGGGG - Intergenic
1182069737 22:27455108-27455130 AAACCCTGAGGCAGGAAAGCAGG - Intergenic
1182230737 22:28835841-28835863 AGAGCCTGGCCCAGGGAAGCAGG + Intergenic
1182676193 22:32041888-32041910 AATGCCTGCCCAAAGGAAGCAGG - Intergenic
1183369286 22:37423319-37423341 TGACCCTGCCCTAGGGAAGCTGG - Intronic
1183529891 22:38347648-38347670 ACACTCTGCCCCTGGGAGGCTGG + Intronic
1184177006 22:42794225-42794247 ACACCCTGGCCCAGGGATGGCGG - Intergenic
1184554262 22:45224855-45224877 AACCCCTGACCCAGGGAAGAGGG - Intronic
1185058067 22:48591610-48591632 AGAGCCTGCTCCAGGGCAGCGGG + Intronic
949190576 3:1244382-1244404 TGGCCCTGCCCCAGGAAAGCGGG + Intronic
949190595 3:1244446-1244468 TGGCCCTGCCCCAGGAAAGCGGG + Intronic
950023257 3:9803669-9803691 ACACCCTCCCCCAGAGCAGCTGG + Intronic
950077402 3:10196714-10196736 AAGACCTGCCCAAGGGAAACAGG - Intronic
950481473 3:13246947-13246969 AAATCCTGCCCCTGGAACGCTGG + Intergenic
951040577 3:17984592-17984614 AAACTGAGCCCCAGGGAAGCAGG - Intronic
953214900 3:40908984-40909006 AACCCCAGCCCCAGGAAGGCTGG + Intergenic
953298117 3:41742153-41742175 TAACCCACCCCCAGGGAAACAGG + Intronic
954122883 3:48510551-48510573 AAAGCATGCCCCTGGGAAACTGG + Intergenic
954371218 3:50170461-50170483 AAGTCCTTCCCCAAGGAAGCAGG - Intronic
954451363 3:50573422-50573444 ATGCCCTGACCCTGGGAAGCCGG - Intronic
954969490 3:54639285-54639307 TGCCCCTGCCCCAGGAAAGCGGG + Intronic
955404499 3:58617448-58617470 AGAGGCTGCCACAGGGAAGCTGG - Intronic
955800503 3:62681211-62681233 AAAACCTGCCCTAGGGCAGAAGG - Intronic
955832170 3:63015880-63015902 CACCCCTCCCCCAGGGAACCAGG + Intergenic
958701195 3:97592648-97592670 AAACCCTGCCCTCAGGAAGCTGG - Exonic
960619320 3:119623643-119623665 ACACCCAGCGTCAGGGAAGCAGG - Intronic
960867787 3:122219464-122219486 AAACCCAGCACCAGAGTAGCTGG + Intronic
961730379 3:128960770-128960792 TGCCCCTGCCCCAGGAAAGCGGG - Intronic
963753749 3:149211669-149211691 AAACTCTGCCCCAGCTAAGGTGG - Intronic
966940997 3:184746927-184746949 AGCCCCTGCCCCAGCCAAGCAGG - Intergenic
966982559 3:185152347-185152369 GCTCCCTGTCCCAGGGAAGCGGG - Intronic
967034417 3:185637448-185637470 ACATCCTTCCCCAGGGATGCAGG + Intergenic
969147733 4:5138922-5138944 AAATCCTTCCCCAGGGCTGCAGG - Intronic
969227767 4:5810366-5810388 AGCCCCTGCCCCAGGAAAGAGGG + Exonic
969611992 4:8232592-8232614 AAACCCTGCCCCAGGGAAGCAGG - Intronic
974428614 4:61769060-61769082 TGCCCCTGCCCCAGGAAAGCGGG + Intronic
974563768 4:63556206-63556228 AAACCCTGGCCCAAGAAAGTGGG - Intergenic
975934120 4:79558788-79558810 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
976608236 4:87002582-87002604 AAACCCTGTCTCAGGCATGCTGG - Intronic
977198637 4:94089353-94089375 TGCCCCTGCCCCAGGAAAGCAGG + Intergenic
977217340 4:94297858-94297880 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
977330627 4:95632851-95632873 AAACACTGCTTCAGGGAGGCAGG - Intergenic
979578539 4:122325889-122325911 ATACCCTTCCCCAGGACAGCTGG - Intronic
980609294 4:135136601-135136623 AAATTCTGCCCTAGGGAATCTGG + Intergenic
980897938 4:138877540-138877562 AAACTCTGCCCCACAGAAGATGG + Intergenic
981539463 4:145833470-145833492 TGCCCCTGCCCCAGGAAAGCGGG - Intronic
982180675 4:152746037-152746059 TGCCCCTGCCCCAGGAAAGCGGG + Intronic
983055269 4:163094063-163094085 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
983055305 4:163094207-163094229 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
983687662 4:170430714-170430736 GAACCCTACCACAGGGAAGCTGG - Intergenic
983900518 4:173128599-173128621 TAAGGCTTCCCCAGGGAAGCTGG - Intergenic
985314218 4:188637487-188637509 AAACCCTGTCCCACAGAAACTGG - Intergenic
985391706 4:189497221-189497243 AAACCCTGCTCGAGGGAAATAGG - Intergenic
985634478 5:1028998-1029020 AAAACCTGCCCCCGGGCCGCTGG - Intronic
985967278 5:3347358-3347380 AATGGCTCCCCCAGGGAAGCTGG - Intergenic
987188183 5:15446132-15446154 AAATCCTGCCCTGGGGAAGGCGG - Intergenic
987498328 5:18673545-18673567 TTCCCCTGCCCCAGGAAAGCGGG + Intergenic
987525452 5:19044584-19044606 ATACCCTCCCACTGGGAAGCCGG + Intergenic
988579223 5:32454549-32454571 AAGCCCAGCTACAGGGAAGCTGG + Intergenic
990310276 5:54531106-54531128 AAGCCCTGCCTCAGGGAGCCAGG - Intronic
991599295 5:68336493-68336515 AAACTCTGCCTCATGGAAGAAGG + Intergenic
995604256 5:113834310-113834332 AAACTCTGCCCAAGGGCTGCAGG + Intergenic
997257871 5:132443215-132443237 AATCCTTGCCCCTGGGAATCTGG - Intronic
997769893 5:136544419-136544441 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
998185365 5:139975217-139975239 AAGCACTGCACCAGAGAAGCTGG - Intronic
998504355 5:142660238-142660260 AAACCATGCCGCAGGGAGGGCGG - Intronic
998996596 5:147873595-147873617 TGCCCCTGCCCCAGGAAAGCGGG + Intronic
999104135 5:149054500-149054522 AAACTTTGTCCCAGGGAAGCAGG - Intronic
999180694 5:149668372-149668394 AAATCATGGCCCTGGGAAGCTGG - Intergenic
999257408 5:150217224-150217246 ACAGCATGCCCCAGGGAAGCAGG + Intronic
999281384 5:150368757-150368779 ACACCCTGCCACTGGGAAGACGG + Exonic
999316260 5:150585947-150585969 AAACCAGGCCCCATGGAAGGAGG + Intergenic
999712751 5:154332844-154332866 AAGCCCAACCCCAGGGCAGCTGG - Intronic
1000640468 5:163696389-163696411 CAACTCTGCCCCTGGGCAGCCGG - Intergenic
1001281783 5:170391218-170391240 TATCTCTCCCCCAGGGAAGCAGG - Intronic
1002744951 5:181462957-181462979 AAACCCGAGCCCAGGGATGCGGG - Intergenic
1002926088 6:1606496-1606518 AATCACTGCCCCAGTGCAGCAGG + Intergenic
1003258198 6:4492165-4492187 AAAACATGCCCCATGGAAACTGG + Intergenic
1003362242 6:5439065-5439087 AATCGCTGCCCCTAGGAAGCAGG - Intronic
1003921709 6:10838639-10838661 AAGCCCCGCCCCGGGGAAGGCGG - Intronic
1006012520 6:31054560-31054582 ATCACCTGCCACAGGGAAGCAGG + Intergenic
1006066901 6:31468615-31468637 AAAACCTACAACAGGGAAGCTGG - Intergenic
1006116407 6:31778237-31778259 AAGCCCAGCCCCAGGCATGCAGG + Intronic
1006199409 6:32273961-32273983 AAACCCTGATTCAGAGAAGCAGG - Intergenic
1007377817 6:41468554-41468576 CAGCCCTGTCCCAGGGAAGACGG - Intergenic
1007944731 6:45815892-45815914 CAGCCCTGCCACAGGGCAGCAGG - Intergenic
1010586943 6:77665407-77665429 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1012894577 6:104933999-104934021 ATGACCTGCCTCAGGGAAGCAGG - Intergenic
1013891479 6:115032817-115032839 TGCCCCTGCCCCAGGAAAGCAGG - Intergenic
1015271174 6:131339899-131339921 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1019129804 6:169865374-169865396 CAACCCTGCCCCAAGGAAGAGGG - Intergenic
1020008127 7:4792956-4792978 AAGCCCCGCCCCAGGGCAGGAGG - Intronic
1021973128 7:25984547-25984569 AAACCCTGGCCCAGGAGAGTTGG + Intergenic
1021978063 7:26028765-26028787 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1022950113 7:35330561-35330583 AAAACCAGCCTCAGGGAACCAGG - Intergenic
1023042047 7:36180709-36180731 AATCCCTTCCTCTGGGAAGCTGG + Intronic
1023623051 7:42092001-42092023 AAACCCTCTGCCTGGGAAGCAGG + Intronic
1023699124 7:42875441-42875463 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1024274392 7:47666230-47666252 AAACCCTGCAGCAGGTAAGGGGG - Intergenic
1024697360 7:51870791-51870813 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1024697379 7:51870855-51870877 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1024697398 7:51870919-51870941 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1024697417 7:51870983-51871005 TGCCCCTGCCCCAGGAAAGCAGG - Intergenic
1024855055 7:53769456-53769478 AAAACCTGGATCAGGGAAGCAGG - Intergenic
1026602301 7:71786856-71786878 CACCCCTGCCCCAAAGAAGCAGG + Exonic
1029620429 7:101687006-101687028 ACCCCCTGCCCCAGGGAGGTGGG + Intergenic
1030289349 7:107856911-107856933 AGAGCCTGCTCCAGGGAAGGTGG - Intergenic
1030751683 7:113238171-113238193 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1032264852 7:130363519-130363541 CAACCCTGCCCCAGGACAGCAGG - Intronic
1032353870 7:131191114-131191136 AAACACTGCCTAAGGGCAGCTGG + Intronic
1033463350 7:141567685-141567707 ATAATCTTCCCCAGGGAAGCTGG - Intronic
1034327288 7:150248137-150248159 AGCTCCTGTCCCAGGGAAGCAGG + Intronic
1034765921 7:153721320-153721342 AGCTCCTGTCCCAGGGAAGCAGG - Intergenic
1035587743 8:788688-788710 AAACACTGCCCCCAGGAAGGAGG - Intergenic
1036183790 8:6607148-6607170 ATAACCTGCCCCAGGGGAGAAGG - Intronic
1037933131 8:22895917-22895939 GAAACCTGCCCATGGGAAGCAGG - Intronic
1038503106 8:28061913-28061935 AAACCCTGATCCAGGGCAGTGGG + Intronic
1040427427 8:47303099-47303121 AAACAAAGCCACAGGGAAGCTGG - Intronic
1040428787 8:47317439-47317461 AAACAAAGCCACAGGGAAGCTGG + Intronic
1041613178 8:59875335-59875357 AAACAAAGCCCCCGGGAAGCTGG - Intergenic
1042159825 8:65881443-65881465 AAACCCAGGCCCAGTGAATCAGG - Intergenic
1042796229 8:72665977-72665999 AAACCCTGTCCCAGGGGACATGG - Intronic
1044416843 8:91948880-91948902 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1044416862 8:91948944-91948966 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1044416880 8:91949005-91949027 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1044543807 8:93436793-93436815 AAACCATGCTCCAGGGACCCTGG - Intergenic
1044924942 8:97201858-97201880 TGCCCCTGCCCCAGGAAAGCAGG - Intergenic
1046827903 8:118711932-118711954 AAACTCTGCCACAGGCAAGGGGG - Intergenic
1047738727 8:127789841-127789863 AAAGACTGCCCCAGGGAGGTGGG - Intergenic
1048301295 8:133253131-133253153 ATACCCTTCCCGAGGGTAGCTGG + Intronic
1050496193 9:6245048-6245070 AAAGCCTGACCCTGGGAAGTAGG - Intronic
1050596213 9:7206911-7206933 AGAGCCTGCCACAGGGAAGCAGG + Intergenic
1050722674 9:8608575-8608597 ATCCCCTGCTCCAGGGCAGCAGG + Intronic
1051052410 9:12949286-12949308 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1051686164 9:19660167-19660189 AGTTCCTGCCCTAGGGAAGCAGG + Intronic
1053644383 9:40112179-40112201 AAACCGCGCCGCAGTGAAGCTGG + Intergenic
1053761670 9:41352896-41352918 AAACCGCGCCACAGAGAAGCAGG - Intergenic
1053761775 9:41353309-41353331 AAACCGCGCCGCAGTGAAGCTGG - Intergenic
1054325020 9:63708609-63708631 AAACCGCGCCGCAGAGAAGCGGG + Intergenic
1054325232 9:63709426-63709448 AAACCGCGCCGCAGTGAAGCTGG + Intergenic
1054325338 9:63709840-63709862 AAACCGCGCCACAGAGAAGCAGG + Intergenic
1054540263 9:66264014-66264036 AAACCGCGCCACAGAGAAGCAGG - Intergenic
1054540368 9:66264428-66264450 AAACCGCGCCGCAGTGAAGCTGG - Intergenic
1056437459 9:86588081-86588103 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1056437477 9:86588145-86588167 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1056437496 9:86588209-86588231 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1056437515 9:86588273-86588295 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1056437533 9:86588337-86588359 TGCCCCTGCCCCAGGAAAGCAGG + Intergenic
1056793197 9:89639461-89639483 AACCTCTGCCACAGGGGAGCAGG + Intergenic
1056948888 9:91026076-91026098 AACCCCTGTGTCAGGGAAGCAGG - Intergenic
1057683722 9:97215470-97215492 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1057683743 9:97215534-97215556 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1057683764 9:97215596-97215618 TGCCCCTGCCCCAGGAAAGCGGG - Intergenic
1057696255 9:97324839-97324861 AAACGCTGCCCTAGGGAGGGAGG + Intronic
1057751074 9:97793706-97793728 AAATACTGCCCCAAGGGAGCTGG + Intergenic
1058348240 9:103990389-103990411 AAATCCTGACCCAGGGAGGTTGG + Intergenic
1059574416 9:115474343-115474365 TACCCCTGCCCCAGAAAAGCAGG - Intergenic
1059960131 9:119556518-119556540 AAAGCCTGGCCCAGGGACGGAGG + Intergenic
1060407904 9:123381865-123381887 AAAGCCGGCCCCAGGGAAGCTGG + Exonic
1060832445 9:126724903-126724925 AATCCCTGGCTCAGGTAAGCGGG - Intergenic
1061405555 9:130391432-130391454 AGAACCTGCCACAGGGAAGGAGG - Intronic
1061562565 9:131415420-131415442 AGCCCCAGCCCCAGGGGAGCGGG - Intronic
1061751031 9:132777098-132777120 AAAGCCAGCCCAGGGGAAGCAGG + Intronic
1061807374 9:133144033-133144055 AGACCCTGCCTCAGGGGAGCTGG - Intronic
1062460406 9:136660424-136660446 AGACCCTCCCCAAGGGAAGGAGG - Intronic
1202791826 9_KI270719v1_random:93898-93920 AAACCGCGCCGCAGTGAAGCTGG + Intergenic
1202791933 9_KI270719v1_random:94313-94335 AAACCGCGCCACAGAGAAGCAGG + Intergenic
1185960868 X:4545077-4545099 TGCCCCTGCCCCAGGAAAGCAGG + Intergenic
1186896565 X:14009734-14009756 AAACACTGCCCCAGGCCAGCAGG + Intronic
1187279702 X:17848630-17848652 TACCCCTGCCCCAGGGAGGCTGG + Intronic
1189794657 X:44634735-44634757 AATCCCTTTCCCAGGGGAGCGGG + Intergenic
1195908886 X:109869941-109869963 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1196533748 X:116817229-116817251 TGCCCCTGCCCCAGGAAAGCGGG + Intergenic
1200659411 Y:5942148-5942170 TGCCCCTGCCCCAGGAAAGCAGG - Intergenic
1201151394 Y:11097284-11097306 AAACCGCGCCACAGAGAAGCAGG - Intergenic