ID: 969612653

View in Genome Browser
Species Human (GRCh38)
Location 4:8235913-8235935
Sequence CATGCACCCCGAAGCGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969612646_969612653 -1 Left 969612646 4:8235891-8235913 CCAGGGCCAGGGCCCAGGTCTGC 0: 1
1: 1
2: 13
3: 111
4: 773
Right 969612653 4:8235913-8235935 CATGCACCCCGAAGCGGGGACGG 0: 1
1: 0
2: 0
3: 7
4: 78
969612641_969612653 11 Left 969612641 4:8235879-8235901 CCAGTGGGAGGCCCAGGGCCAGG 0: 1
1: 0
2: 11
3: 73
4: 710
Right 969612653 4:8235913-8235935 CATGCACCCCGAAGCGGGGACGG 0: 1
1: 0
2: 0
3: 7
4: 78
969612645_969612653 0 Left 969612645 4:8235890-8235912 CCCAGGGCCAGGGCCCAGGTCTG 0: 1
1: 1
2: 11
3: 72
4: 603
Right 969612653 4:8235913-8235935 CATGCACCCCGAAGCGGGGACGG 0: 1
1: 0
2: 0
3: 7
4: 78
969612647_969612653 -7 Left 969612647 4:8235897-8235919 CCAGGGCCCAGGTCTGCATGCAC 0: 1
1: 0
2: 1
3: 24
4: 326
Right 969612653 4:8235913-8235935 CATGCACCCCGAAGCGGGGACGG 0: 1
1: 0
2: 0
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969612653 Original CRISPR CATGCACCCCGAAGCGGGGA CGG Intronic
900887591 1:5426235-5426257 CTTTCACCCAAAAGCGGGGAGGG - Intergenic
902368019 1:15990019-15990041 CATGCAGCCAGACCCGGGGACGG + Intergenic
904236593 1:29121236-29121258 GAAGTACCCCGACGCGGGGACGG + Exonic
906109641 1:43313977-43313999 CATGCACCCAGGGGCGGGGCGGG - Intronic
912384852 1:109266154-109266176 CAGGCAGCCCGAAGCGGGTACGG - Exonic
922752453 1:228076932-228076954 CGTGCAGCCCCAAGCTGGGAAGG + Intergenic
1065190052 10:23199866-23199888 CATGCCACAGGAAGCGGGGAGGG - Intergenic
1070272312 10:74968130-74968152 GAAGCACACTGAAGCGGGGAGGG - Intronic
1070828254 10:79403670-79403692 CAGGAACCCAGAAGAGGGGAGGG - Intronic
1072902267 10:99419034-99419056 CATGTACCAGGAAGCAGGGAAGG - Intronic
1075060514 10:119253677-119253699 CATCCACCCCGGAGCTGGGCTGG - Intronic
1077031572 11:470417-470439 CAGGCTCCCCGAGGCTGGGACGG - Intronic
1077332792 11:1990694-1990716 CATGCACCCCAAAGCCCAGAGGG - Intergenic
1089299931 11:117492542-117492564 CATGCACCCCTGAGAGGTGAGGG + Intronic
1090194102 11:124800238-124800260 GAGGCACCCCGAGGCGTGGAAGG + Exonic
1090320397 11:125838183-125838205 CATGAACCCAGGAGCCGGGAAGG + Intronic
1090358331 11:126155638-126155660 CATGCACTCCCAAGCGTGGATGG + Intergenic
1202815775 11_KI270721v1_random:45870-45892 CATGCACCCCAAAGCCCAGAGGG - Intergenic
1091395888 12:154082-154104 CGTGGGCCTCGAAGCGGGGAGGG - Intronic
1091695666 12:2626508-2626530 CATGCACTCTGAAGAAGGGAAGG - Intronic
1091754207 12:3041127-3041149 AAAGGACCCTGAAGCGGGGAGGG + Intergenic
1103207086 12:119138380-119138402 CATGCGCCCCGAAGTGCAGAGGG - Intronic
1113480511 13:110616403-110616425 CACACACCCCGAACCGGGGGCGG - Intronic
1115770940 14:36663434-36663456 CATGGCCACCGAACCGGGGATGG - Exonic
1118644097 14:67820150-67820172 CAGGCTGCCCGAAGCGGGAAGGG - Intronic
1129266373 15:74395658-74395680 CATGCAGCCCTAGGTGGGGACGG - Intergenic
1134379077 16:13707745-13707767 CATGGACCAGGAAGCGGGGAAGG - Intergenic
1138659803 16:58510316-58510338 CAGGCAGCCCCAAGCTGGGAAGG + Intronic
1141610467 16:85178351-85178373 CATGGAGCCAGAAGAGGGGACGG + Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148052301 17:44775315-44775337 CATGCTCCCCGCCGCGGGGCTGG - Intronic
1148482376 17:47968467-47968489 CATGCACCACCACGCCGGGATGG + Intronic
1152129535 17:78467539-78467561 TATGCAGCCCGCAGAGGGGAGGG + Intronic
1152260038 17:79261847-79261869 GATGGAACCCGAAGAGGGGAGGG + Intronic
1161066617 19:2241681-2241703 CAAGAAGCCCGAGGCGGGGAGGG + Intronic
1162042383 19:7978679-7978701 CATGCACCCTGAAGGGGTGGCGG + Intronic
1162808632 19:13151612-13151634 AAAGCACCCCGCAGCGGGTAGGG - Intronic
1163325179 19:16599003-16599025 CATGTGTCCCCAAGCGGGGAGGG - Intronic
1164479415 19:28599970-28599992 CCAGCTCCCCGAAGCTGGGAGGG - Intergenic
1165948475 19:39459169-39459191 CATACACCCTGAAGGGAGGAGGG - Exonic
1166041382 19:40204900-40204922 CCTGCACCCCGAGGAGGGGCTGG - Intronic
932426828 2:71643085-71643107 CAAGCTCCCTGAAGCTGGGATGG - Intronic
934473528 2:94577290-94577312 CATGCATCCCTAAGCAGGGCCGG + Intergenic
934522054 2:95025792-95025814 CATGGCCCCCGCAGCGGCGACGG + Exonic
937204799 2:120228862-120228884 CATGGACCCGGATGCAGGGAGGG - Intergenic
938496804 2:131802017-131802039 CCCGCTCCCCCAAGCGGGGAAGG - Intergenic
948265607 2:236633293-236633315 CATGCACCCCAAAGCAGTGAGGG - Intergenic
1169843317 20:9963155-9963177 GATGCACCCCCATGCTGGGAGGG - Intergenic
1172691452 20:36793296-36793318 CATGCTCCCCCAGGTGGGGAAGG - Exonic
1181140653 22:20802506-20802528 CCTGAACCCCGTAGTGGGGAGGG - Intronic
1182729380 22:32474956-32474978 CCTGGACCCGGAAGCGGCGACGG - Exonic
1182753262 22:32658330-32658352 CATCCACCCGAAAGCGGGGTTGG - Intronic
1183829035 22:40408382-40408404 CAGGCGCCCCCAAGCAGGGATGG - Exonic
1185136865 22:49078285-49078307 CATCCACCTCACAGCGGGGAGGG + Intergenic
950584044 3:13880261-13880283 CCTGCACCCCGGAGCAGGGAGGG - Intergenic
954637112 3:52076998-52077020 CATGCTCCCCAAAGAGGGGCTGG + Intronic
957050074 3:75404833-75404855 CATGAACCCCTAAGAGTGGAGGG + Intergenic
962350449 3:134651999-134652021 CATACACTCCAATGCGGGGAGGG - Intronic
965079459 3:164019114-164019136 CATGCATTCGGAAGTGGGGATGG + Intergenic
966734278 3:183176615-183176637 CCTGCACCCCAGAGCTGGGAAGG - Intergenic
969476618 4:7425820-7425842 CAAGCATCCCGAGGCAGGGACGG + Intronic
969612653 4:8235913-8235935 CATGCACCCCGAAGCGGGGACGG + Intronic
971063949 4:23005936-23005958 CAGGCACCAGGAAGCAGGGAAGG + Intergenic
976895414 4:90104154-90104176 CATGGAACCTGATGCGGGGAAGG + Intergenic
1002134823 5:177101027-177101049 CATGCTGCCGGGAGCGGGGAGGG - Intergenic
1002468740 5:179422143-179422165 CATGGTCCCCAAAGAGGGGATGG + Intergenic
1004619451 6:17320355-17320377 CATGCATTCGGAAGCGGGGACGG + Intergenic
1005695211 6:28345456-28345478 CAGGCACCACTGAGCGGGGAGGG - Intronic
1011830553 6:91366000-91366022 AATGCACACTGAAGTGGGGAGGG + Intergenic
1019707415 7:2503125-2503147 CATACACCCCGCATTGGGGAGGG + Intergenic
1026200378 7:68209273-68209295 CAGGCAACTCGAAGTGGGGAGGG + Intergenic
1033158980 7:138980808-138980830 CATGGAACCCGAAGCGGGTCTGG - Intronic
1035066413 7:156108433-156108455 CGTGGACCCCGGGGCGGGGATGG - Intergenic
1039369730 8:36972582-36972604 CCTGCACACTGAGGCGGGGAAGG + Intergenic
1043359263 8:79451909-79451931 CATGAACACTGAAGCAGGGAAGG + Intergenic
1053684801 9:40511212-40511234 CATGCATCCCTAAGCAGGGCCGG - Intergenic
1053934765 9:43139495-43139517 CATGCATCCCTAAGCAGGGCCGG - Intergenic
1054278926 9:63113744-63113766 CATGCATCCCTAAGCAGGGCCGG + Intergenic
1054297896 9:63346675-63346697 CATGCATCCCTAAGCAGGGCCGG - Intergenic
1054395910 9:64651193-64651215 CATGCATCCCTAAGCAGGGCCGG - Intergenic
1054430554 9:65156388-65156410 CATGCATCCCTAAGCAGGGCCGG - Intergenic
1054499826 9:65865133-65865155 CATGCATCCCTAAGCAGGGCCGG + Intergenic
1054810000 9:69427027-69427049 CATGCCCCCGGCAGCAGGGAGGG + Intergenic
1062699716 9:137892578-137892600 CAGGCACCCCGAAGGGGCCAAGG + Intronic
1190713900 X:53088280-53088302 CCTGACCCCCGAAGCGGGGAGGG + Exonic
1193490517 X:82143326-82143348 CATGAACCTCGCAGAGGGGAAGG - Intergenic