ID: 969613470

View in Genome Browser
Species Human (GRCh38)
Location 4:8239659-8239681
Sequence CTGGCTCCTTCCTGTTTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969613470 Original CRISPR CTGGCTCCTTCCTGTTTAGT TGG Intronic
900578575 1:3396237-3396259 GTGGATCCTACCTGTTTAGTCGG + Intronic
901054837 1:6444231-6444253 CTGGCTCCTCCCTGATTAGGAGG - Intronic
901494529 1:9613596-9613618 CTTGCCCCTTCCTGTGGAGTGGG + Exonic
901676637 1:10889242-10889264 CTGGCTCCCTGCTTATTAGTGGG + Intergenic
902479526 1:16704371-16704393 CTGGCTCCTCCCTGATTAGGAGG + Intergenic
903830008 1:26169131-26169153 CTGGCCCCTTCCAGCTGAGTTGG + Intergenic
904346040 1:29870655-29870677 CTGCCTCCTTCCAGGTTAGAGGG - Intergenic
904366070 1:30011690-30011712 CTGGCTCCTTCCTGCTGCCTGGG + Intergenic
907103028 1:51854424-51854446 CTGCCTACTTCCTGTTGAATTGG - Intronic
907793704 1:57693206-57693228 CTAGCTACTTCCTGCTAAGTAGG - Intronic
908262153 1:62347548-62347570 CTGCCTCCTTCCTGTGGAGCTGG + Intergenic
908387181 1:63653789-63653811 CTGGCTCCTGCTTGTTAGGTTGG + Intronic
910617441 1:89215234-89215256 CTGGCTGCTTCCTGCTGAGGAGG - Intergenic
910738891 1:90494131-90494153 CTGGTTCCTTCTTATTTGGTAGG + Intergenic
917575540 1:176317452-176317474 CTGGCTACTTCTTGTTGAATTGG + Intergenic
918742914 1:188158977-188158999 ATGGCTCATTCCTGTTCAGTAGG - Intergenic
919603730 1:199653519-199653541 CTGGTTTCTTCCTCTTTAGATGG - Intergenic
923985557 1:239377773-239377795 CTGCCTCCTGCCTCCTTAGTCGG - Intergenic
924542534 1:244994989-244995011 CTGGCTCCTTGTTGTTTAACAGG + Intronic
1064719025 10:18209081-18209103 CTGCTTCCTTCCTCTTTTGTAGG + Intronic
1070023635 10:72610659-72610681 CTGGCTCCCTCCTTGTCAGTTGG - Intronic
1070312113 10:75281484-75281506 CTGTCTCCTTCCTATTCAGCTGG - Intergenic
1070873122 10:79776104-79776126 CTGGCTCCTTGCTACTTAGCTGG + Intergenic
1071608945 10:87017878-87017900 CAGGATCCATCCTGTTTAGGAGG + Intergenic
1074365214 10:112852499-112852521 CTTGCGGCTTCCTCTTTAGTGGG - Intergenic
1075120571 10:119661508-119661530 CTGGTTCATTCCTGTTTATTTGG + Intronic
1076422695 10:130342388-130342410 CTGGCTCCTTCCTGGCTTGGCGG + Intergenic
1076652240 10:131997810-131997832 GTGGCTGCTTCCTGTTTTGAAGG - Intergenic
1077378493 11:2216526-2216548 CGGGCTCCCTGCTGTTTAGAGGG - Intergenic
1079222479 11:18575906-18575928 CTGGCTTCTTCCTGCTGAGGGGG - Intronic
1083733904 11:64668835-64668857 CAGGCTCCTGCCTGCTGAGTTGG - Intronic
1084006812 11:66327326-66327348 CTGCCTCCTGCCTGGCTAGTGGG + Intergenic
1084770755 11:71341534-71341556 CTGGCTCCTTCTTGTCATGTGGG + Intergenic
1085392664 11:76190369-76190391 CTGGCTCCTTCCTGTCTCCCTGG + Intronic
1087794137 11:102437903-102437925 CTGGCTCCTTCCTGTCATGCAGG + Intronic
1087833911 11:102850748-102850770 TTTGCTTCTTCCTATTTAGTTGG - Intergenic
1088831617 11:113541306-113541328 CTGGCTTCTTGCTCTTTTGTTGG + Intergenic
1092337445 12:7645858-7645880 CTGGCTACTTCCTGTTGAAAAGG - Intergenic
1092477662 12:8832703-8832725 CTGGCTTCTTCCTGCTGAGAGGG + Intronic
1092733769 12:11559401-11559423 ATTGCCCCTTCCTGTTTAATGGG - Intergenic
1094196109 12:27751649-27751671 CTGGCTCCCTCCTGTCCAGACGG + Intronic
1094527452 12:31241560-31241582 CTGGCTACTTCCTGCTGAATTGG - Intergenic
1096658633 12:53107217-53107239 CTGGCTACTTCCTGCTGAGAGGG + Intronic
1097659292 12:62411278-62411300 CTGGCTCCTCACTTTTTAGATGG + Intronic
1097663378 12:62454574-62454596 CTGGCTCTTTTCTGTTGAATGGG - Intergenic
1101475626 12:105044550-105044572 CTAGCTTCTTGCTGTTTAATGGG + Intronic
1101810655 12:108104752-108104774 CTCTCTCCTTCCTGGTCAGTGGG + Intergenic
1102928225 12:116842953-116842975 CTGGCTGCTTCCTGCTTTCTCGG + Intronic
1107402806 13:40085872-40085894 CTGGCTCCTTCCTGAATACATGG + Intergenic
1107988830 13:45799342-45799364 CTGCCTCCTTCCTGGATAATAGG + Intronic
1108372746 13:49787254-49787276 CTGGCTCCTTGCTGATAAGAAGG + Intronic
1110933241 13:81249731-81249753 CTGTCTCCTTCATGATTTGTGGG + Intergenic
1111921729 13:94419355-94419377 CTTCTTCCTTCCTGTTCAGTAGG - Intergenic
1112190554 13:97173395-97173417 CAGCCTCCTTCCTGCATAGTGGG - Intergenic
1113207181 13:107930528-107930550 CTAGCTCCTTCCTCATTAGAGGG + Intergenic
1115852421 14:37598705-37598727 CAGGGTCCTTCCTATTTAGCAGG + Intronic
1116261034 14:42626770-42626792 CTGGTTTCTTCCTCTTTAATTGG - Intergenic
1116627984 14:47291380-47291402 CTCGCTGCTTCCTGTTCACTAGG + Intronic
1118299566 14:64603062-64603084 CTGGCTCCTTCATGTTGATCTGG + Intergenic
1118550748 14:66947100-66947122 CTGGCTCCTCCCTGATTTCTAGG + Intronic
1119558638 14:75572369-75572391 CTCGCTCCTTCCAGTTCAGCCGG - Intergenic
1121202012 14:92125644-92125666 CTGGCCCCTTTCTGTTCATTAGG + Intronic
1121359387 14:93242655-93242677 CTAGCTTCTTCCTGTTTTTTAGG + Exonic
1121656258 14:95598019-95598041 CCGGCTCCTGCCTGATTAGCAGG - Intergenic
1121793291 14:96714963-96714985 CTTGCTCTTTCATGTTGAGTAGG - Intergenic
1121904463 14:97727030-97727052 CTAGCTCCTACCTGTTCTGTAGG + Intergenic
1123700094 15:22907820-22907842 CTGGCTCCAGCATGTGTAGTTGG + Intronic
1124214723 15:27796962-27796984 CTGGTTCCTTCCTGTGAGGTTGG - Intronic
1125342437 15:38688265-38688287 CTGGGTGCTTCCTGTTGAGAGGG - Intergenic
1128292427 15:66488156-66488178 CTAGCTCTTTCCTGTTCAGAAGG + Intronic
1128664666 15:69529403-69529425 CCTGCTCCTTTCTGATTAGTTGG + Intergenic
1129572072 15:76698973-76698995 CTTTCACCTTCCTGTTTAGCTGG + Intronic
1130065227 15:80597296-80597318 CTGGCTTCTTCCTGTTTATGTGG - Exonic
1130103199 15:80909460-80909482 TTTTCTCCTTCCTGTTTGGTTGG - Intronic
1132158889 15:99518331-99518353 CTGGTTCTTTCCTGTGTTGTGGG + Intergenic
1132343703 15:101093945-101093967 GTGGCTGCTTCCAGTTCAGTGGG + Intergenic
1133849388 16:9487880-9487902 CTGATTCCTTCCTCTTTTGTAGG - Intergenic
1136999877 16:35219740-35219762 CTGCCTCCTTCCTCTTTCATGGG - Intergenic
1137032019 16:35532543-35532565 CTGCCTCCTTCCTCTTTTCTGGG - Intergenic
1137460306 16:48655381-48655403 CTGGCTTCTTCCTGCTGAGAGGG + Intergenic
1138388337 16:56651851-56651873 CTGGCTGCTCCCTTTATAGTCGG - Intronic
1138504768 16:57472689-57472711 CAGGCTCCTTCCTGCTTTGTAGG - Exonic
1138900623 16:61264870-61264892 CTGGCTCCTTCCTGTAGCTTTGG - Intergenic
1140731611 16:77861706-77861728 CTGGCTTCTTCCAGTCAAGTGGG - Intronic
1141140839 16:81495859-81495881 CTGACAGCTTCCTGTCTAGTTGG - Intronic
1143631405 17:8142448-8142470 CTGGCTGCTGCCTGTGAAGTGGG + Exonic
1144044175 17:11440010-11440032 CAGGCTGCCTCCTGTTTATTTGG - Intronic
1144733379 17:17541374-17541396 CTCCCTGCTTCCTGTTTGGTGGG - Intronic
1146503439 17:33384094-33384116 CTGGCCCCCACCTGTTAAGTAGG + Intronic
1147907035 17:43830165-43830187 CTGGGTCCTTCCTCTTTGGAAGG + Intronic
1148565032 17:48627540-48627562 CAGGCTCCTTCCTCTTTGGATGG - Intronic
1149929321 17:60734776-60734798 CTTTCTCCTTCGTATTTAGTTGG + Intronic
1151444462 17:74154041-74154063 CTTGCACCTTCCTGGTGAGTAGG - Intergenic
1151947922 17:77329586-77329608 CTCGTTCCTTCCTGTTTCGTGGG + Intronic
1156165452 18:34414629-34414651 GTGACTCCTTCCTGGTTAGTGGG - Intergenic
1157081198 18:44527218-44527240 CTGGCTCCTTTCTGTCTATCAGG - Intergenic
1157678111 18:49582592-49582614 CTGGCTCCTCCCTGAGCAGTCGG - Intronic
1160346747 18:78138335-78138357 CTGGTTCCATCCTGTTGTGTGGG + Intergenic
1166248985 19:41552673-41552695 CTGGCTACTTCCTGCTGAGAGGG + Intronic
1166439498 19:42799528-42799550 CAGGCTCCTCCCTGTTCAGCTGG + Intronic
1166457539 19:42955069-42955091 CAGGCTCCTCCCTCTTTAGCTGG + Intronic
1166467865 19:43049508-43049530 CAGGCTCCTCCCTGTTCAGCTGG + Intronic
1166474483 19:43110296-43110318 CAGGCTCCTCCCTGTTCAGCTGG + Intronic
1166488452 19:43235373-43235395 CAGGCTCCTCCCTGTTCAGCTGG + Intronic
1166495129 19:43295851-43295873 CAGGCTCCTCCCTGTTCAGCTGG + Intergenic
1167685892 19:50956069-50956091 CAGCCTCCTTCCTGTGTAGCTGG + Intergenic
1202713563 1_KI270714v1_random:30277-30299 CTGGCTCCTCCCTGATTAGGAGG + Intergenic
924972682 2:143432-143454 CTGGCTGCTTCCTGCTGAGAGGG + Intergenic
924987682 2:287267-287289 CTGGATGCTTCCTTTTCAGTTGG + Intronic
925093284 2:1172557-1172579 CTGGCTTGTTTCTGTTTAGCAGG + Intronic
925124040 2:1441121-1441143 CAGGCTCCTTCCTGTTTGCATGG + Intronic
933949922 2:87320100-87320122 GTGTCTCCTTCCTGTTGGGTGGG + Intergenic
936288453 2:111199756-111199778 CTGGCTCTTTGCTATTTATTGGG - Intergenic
936330270 2:111541497-111541519 GTGTCTCCTTCCTGTTGGGTGGG - Intergenic
946970664 2:225087478-225087500 CTACCTGCTTCCTGTTTAGCAGG - Intergenic
947828708 2:233124284-233124306 CTGGCTCCTGCCTGTTCTGGGGG + Intronic
948227736 2:236324860-236324882 CTTGCCCCTTCCTGCTTAGCAGG - Intronic
1174347341 20:49940167-49940189 CTGGCTCCCTACTGTTTATGAGG + Intronic
1177207706 21:18029637-18029659 CTGGAACCTTCCTGTTTTGGGGG + Intronic
1179495736 21:41770175-41770197 CAGCCTCCTCCCTGCTTAGTAGG + Intergenic
1183185252 22:36288182-36288204 CTGGCACCTTCATATGTAGTTGG + Intronic
1183667284 22:39253251-39253273 CCAGCTCCTTCCTGTTTTGATGG + Intergenic
1183838664 22:40478900-40478922 CTGGCTCCTTCCTGCTGAAAAGG - Intronic
950500993 3:13363705-13363727 CTGTCTCCTTCCTAGTTAGCAGG - Intronic
950864959 3:16181638-16181660 CTGCCTCCTTCCTCTTTTGCAGG - Intronic
950929170 3:16771855-16771877 CTGGCTACTTCCTGCTGAATAGG - Intergenic
951817283 3:26768282-26768304 CTCCCTCATTCCTCTTTAGTGGG - Intergenic
954800828 3:53186067-53186089 CTGGCTTCTTCCCGCTTAGGTGG + Intronic
955666368 3:61353622-61353644 CTGGCTCCCTCCTTCTAAGTTGG + Intergenic
957465392 3:80583138-80583160 CTGGCAACTTCCTATTGAGTTGG + Intergenic
958004456 3:87793502-87793524 TTGGCGCCTTCCTGTTTGGAGGG + Intergenic
959181802 3:102989692-102989714 TTGTCTTCTTCATGTTTAGTGGG + Intergenic
959294595 3:104519892-104519914 CTGTCTACTTCCTTTTTTGTTGG - Intergenic
959320836 3:104873092-104873114 CTGTCTCCTTTCTCATTAGTTGG - Intergenic
960654687 3:119989917-119989939 CTGGCTACTTCCTGCTGACTAGG - Intronic
963836135 3:150059728-150059750 CTGGCTTCTTCCAGTTTGGCTGG + Intergenic
964327673 3:155564732-155564754 CTGGCTCCTTATTGTTCAATTGG - Intronic
965148554 3:164939654-164939676 CTGACTCCTTCTTGTTTATAAGG - Intergenic
967486226 3:190034502-190034524 CTGGCTTCTTTCTGTTTTATGGG - Intronic
969613470 4:8239659-8239681 CTGGCTCCTTCCTGTTTAGTTGG + Intronic
970321746 4:14881654-14881676 CTGGCTCCTTCTTGTTTTCTAGG - Intergenic
971097584 4:23425237-23425259 CTGGCTCCATCTTGTTTGATTGG - Intergenic
972236224 4:37137085-37137107 AGGGCTCCTTCCTTATTAGTGGG + Intergenic
975730214 4:77330313-77330335 CTGGCTACTTCCTGTTAAAAAGG + Intronic
976939803 4:90685973-90685995 CAGGCCCCTTCCTATTGAGTGGG + Intronic
977352157 4:95902334-95902356 CTGGCTGATTTTTGTTTAGTAGG + Intergenic
978343430 4:107740722-107740744 CTGGCTACTTCCTGCTGAGAGGG - Intergenic
978372743 4:108045717-108045739 CTGGCAACTACCTGTTTAGCTGG - Intergenic
980724745 4:136743506-136743528 CTGGCTTCTTCCTGCTGAGGAGG + Intergenic
981490448 4:145333963-145333985 CTGGCACCTGCCAGTTTACTTGG - Intergenic
982439213 4:155415455-155415477 TTTGCTACTTCCTGTTCAGTAGG + Intergenic
982473947 4:155827314-155827336 CTGTCTTCTTCATGTTGAGTAGG - Intergenic
985207066 4:187550159-187550181 CTGGCTGCTTCCTGCTGAGGAGG + Intergenic
988779832 5:34510211-34510233 CAGGCTCCTTCCTGTTCTCTAGG - Intergenic
989444013 5:41507820-41507842 CTGGCTGCTACATGTTTACTTGG - Intronic
990965491 5:61442390-61442412 CTGGCTGCTTCATGCTTAGGAGG + Intronic
998524610 5:142831152-142831174 CTGTCTCCACCCTGTTGAGTTGG + Intronic
998821707 5:146063271-146063293 CTGGCTCCTTCTAGTTTTATTGG - Intronic
999438655 5:151584159-151584181 CTGTCTCCTTCCTGGTTCCTAGG - Intergenic
999625613 5:153517352-153517374 CTTGCTTCTTCCTGTTTTGTGGG + Intronic
999900989 5:156086904-156086926 CTGGCTACTTCCTGCTGAATGGG + Intronic
1000254807 5:159527379-159527401 CTGCCTCCTAGCTGTTGAGTGGG + Intergenic
1002287061 5:178170585-178170607 CTGGCTACTTCCTGCTGAGAGGG + Intergenic
1002993009 6:2255307-2255329 CTAATTCCTTCCTGTTGAGTTGG - Intergenic
1004406855 6:15340761-15340783 GTGTCTCGTTCCTCTTTAGTGGG + Intronic
1005807843 6:29491641-29491663 CTGGCTCTTCCCAGGTTAGTAGG - Intergenic
1006479080 6:34277398-34277420 CCTGCTCCCTCCTGTTCAGTGGG - Intergenic
1009907926 6:69891657-69891679 CTAGGTCCTTCCTGTTTTATGGG - Intronic
1012137803 6:95580252-95580274 CTGGCTCTTTGCTGTTTCATTGG - Intronic
1015021618 6:128482704-128482726 CTAGCACCTTGCTGTTTGGTTGG - Intronic
1015456474 6:133432228-133432250 CTGGCTCCCTCATGTCTACTGGG - Intronic
1017358804 6:153542080-153542102 CTGGATCCATCCTGTTTCTTGGG - Intergenic
1021976479 7:26015944-26015966 CTTGCTCATTCCTGTCCAGTAGG + Intergenic
1025859246 7:65311125-65311147 CTGGCTACTTCCTGCTGAGGGGG - Intergenic
1026224184 7:68426314-68426336 CTGGGTCCTTCCTGTTATGGAGG + Intergenic
1028163770 7:87514929-87514951 CTGGCTACTTCCATTTTTGTTGG + Intronic
1028287288 7:89017972-89017994 CTGACTTCTTCCTTTTTAGTTGG + Intronic
1028805675 7:95023664-95023686 CTGCCTCCTTCCTGAGTAGCTGG + Intronic
1030622043 7:111800808-111800830 CTGGCTACTTCCTGTTGAAAAGG - Intronic
1032200568 7:129819802-129819824 TTGGGTCCTTCCTCTTGAGTTGG + Intergenic
1038275622 8:26118405-26118427 CTGTCTCCTGCCTGTGTTGTGGG - Intergenic
1038499270 8:28029952-28029974 CAGGCTCTTTCCTGTTTTGGTGG - Intronic
1038972833 8:32656432-32656454 CTGGCTTCTTCCCTTTTTGTAGG - Intronic
1042205654 8:66327414-66327436 CTGGCTGCTTCCTGCTGAATAGG - Intergenic
1042744892 8:72097115-72097137 CTGGCTACTTCCTGATGAGAGGG + Intronic
1042846856 8:73177123-73177145 CTGGCTTCTGCCTGTTTCATGGG - Intergenic
1043749419 8:83916800-83916822 CTGGCTACTTCCTGCTGAATGGG - Intergenic
1046193494 8:110830359-110830381 CTGGCTACTTCCTGCTTAAAAGG + Intergenic
1046385377 8:113502050-113502072 CTGGCTACTTCCTGCTGAGAGGG + Intergenic
1049418150 8:142504894-142504916 CTGGCTTCTTTCTGTTATGTGGG + Intronic
1051182944 9:14430105-14430127 CTTGCTCCCTCCAGTATAGTGGG - Intergenic
1052350512 9:27453978-27454000 CTACCTCCTTCCTGTTAAGAAGG + Intronic
1052384185 9:27805674-27805696 CTGGCTGCTTCCTGCTTAGTAGG + Intergenic
1052553514 9:29984160-29984182 CTAGCTACTTCCTGTTGATTTGG + Intergenic
1055286005 9:74728439-74728461 TTGGCTCCTTCAAGTTTACTGGG - Intronic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056464591 9:86841352-86841374 CAGGCTGTTTCCTGTTTTGTGGG - Intergenic
1057029105 9:91760102-91760124 CTGGTTCCTTGTTGTTCAGTTGG + Intronic
1057342086 9:94211983-94212005 ATGCCTACTTCCTGTTTAATAGG + Intergenic
1057347749 9:94266362-94266384 CTGGCTACTTCCTGCTGAGATGG + Intronic
1058972377 9:110095473-110095495 CTGGCTCCTTTCTGTTTCTAAGG - Intronic
1059876492 9:118641164-118641186 CTGGCTGCTTCCTGCTGAATAGG - Intergenic
1060429727 9:123540370-123540392 CTGGCTGACTCCTGTTAAGTAGG + Intronic
1186854656 X:13614330-13614352 CTAGCCCCTTCCTGTTTCCTGGG + Intronic
1187120663 X:16403271-16403293 CTGGCTCTGTCCTGTTTCGAAGG - Intergenic
1187678779 X:21744960-21744982 CTGGATGCTTCCTGTTTCATAGG - Intronic
1188734405 X:33694963-33694985 CTGGGCCATTCCTCTTTAGTAGG - Intergenic
1189253466 X:39619579-39619601 CTCTCTCCATCCTGTTTACTTGG + Intergenic
1190071824 X:47285953-47285975 CTGGCTACTTCCTGCTGAGGTGG + Intergenic
1194176477 X:90655347-90655369 CTGGCTTCTTCCTGCTGAGGAGG - Intergenic
1195065000 X:101232537-101232559 CTTCCTCCTTCCTGTATATTCGG - Intronic
1195653922 X:107316038-107316060 CTGTCCCCTTCCTGTTGAGATGG - Intergenic
1196628301 X:117904545-117904567 CAGTCTACTTCCTGTTTTGTAGG + Intronic
1196936901 X:120739346-120739368 TTGGCTCCTTCCTATATTGTAGG + Intergenic
1197599672 X:128513720-128513742 CTGGCTATTTCCTTTTTACTGGG - Intergenic
1200523104 Y:4236259-4236281 CTGGCTTCTTCCTGCTGAGGAGG - Intergenic
1201629903 Y:16059558-16059580 CTGGCTCCTTCCTGCTGACAAGG + Intergenic
1201639543 Y:16164607-16164629 CTGGCTACTTCCTGCTTGTTAGG + Intergenic
1201663270 Y:16420717-16420739 CTGGCTACTTCCTGCTTGTTAGG - Intergenic